ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3i21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 809 0.0
2gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein... 373 e-100
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 172 1e-39
4dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 172 1e-39
5dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 170 4e-39
6dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 170 4e-39
7dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
8dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
9dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
10dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
11gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 170 4e-39
12gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 170 4e-39
13emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 170 4e-39
14emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 170 4e-39
15dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfe... 143 9e-31
16gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA,... 123 9e-25
17gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein... 80 1e-11
18emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 66 2e-07
19gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 64 7e-07
20emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 64 7e-07
21emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 64 7e-07
22dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 7e-07
23dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 7e-07
24dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 7e-07
25gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 64 7e-07
26gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 62 3e-06
27gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 58 4e-05
28gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 58 4e-05
29emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 58 4e-05
30emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 58 4e-05
31emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 58 4e-05
32emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 58 4e-05
33emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 58 4e-05
34gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 58 4e-05
35gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 58 4e-05
36gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 58 4e-05
37gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 58 4e-05
38gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 58 4e-05
39gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 58 4e-05
40gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 58 4e-05
41gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 58 4e-05
42gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 58 4e-05
43gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 58 4e-05
44gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 58 4e-05
45gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 58 4e-05
46gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 58 4e-05
47gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 58 4e-05
48gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 58 4e-05
49gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 58 4e-05
50gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 58 4e-05
51gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 58 4e-05
52gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 58 4e-05
53gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 58 4e-05
54gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 58 4e-05
55gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 58 4e-05
56gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 58 4e-05
57gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 58 4e-05
58gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 58 4e-05
59gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 58 4e-05
60gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 58 4e-05
61gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 58 4e-05
62gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 58 4e-05
63gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 58 4e-05
64gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 58 4e-05
65gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 58 4e-05
66gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 58 4e-05
67gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 58 4e-05
68gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 58 4e-05
69gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 58 4e-05
70gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 58 4e-05
71gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 58 4e-05
72gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 58 4e-05
73gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 58 4e-05
74gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 58 4e-05
75gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 56 2e-04
76gb|AF439446.1|AF439446 Setaria italica lipid transfer protein mR... 54 7e-04
77dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 7e-04
78dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 7e-04
79dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 7e-04
80dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 7e-04
81dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 7e-04
82dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 7e-04
83gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 52 0.003
84gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 52 0.003
85gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 52 0.003
86gb|AC123514.2| Oryza sativa (japonica cultivar-group) chromosome... 52 0.003
87gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 52 0.003
88dbj|AK064888.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.003
89dbj|AK061740.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.003
90dbj|AK060108.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.003
91gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 52 0.003
92gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 52 0.003
93gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 52 0.003
94gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 50 0.010
95gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 50 0.010
96gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 50 0.010
97emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 50 0.010
98emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 50 0.010
99emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 50 0.010
100emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 50 0.010
101emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 50 0.010
102emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 50 0.010
103dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
104dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
105dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
106gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 50 0.010
107gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 50 0.010
108emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 48 0.041
109emb|X92648.1|HALTP H.annuus mRNA for non-specific lipid-transfer... 48 0.041
110gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 48 0.041
111ref|XM_600291.2| PREDICTED: Bos taurus similar to PYRIN-containi... 44 0.64
112emb|AJ704771.1| Oryza sativa (japonica cultivar-group) mRNA for ... 44 0.64
113emb|X57477.1|OCCCBI2 Rabbit mRNA for calcium channel BI-2 44 0.64
114emb|X57476.1|OCCCBI1 Rabbit mRNA for calcium channel BI-1 44 0.64
115emb|X57689.1|OCCCBI2CB Rabbit mRNA for calcium channel BI-2 (lam... 44 0.64
116emb|X57688.1|OCCCBI1CB Rabbit mRNA for calcium channel BI-1 (lam... 44 0.64
117ref|XM_512395.1| PREDICTED: Pan troglodytes similar to zHuC (LOC... 42 2.5
118ref|XM_475420.1| Oryza sativa (japonica cultivar-group), predic... 42 2.5
119gb|AC144737.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.5
120gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 42 2.5
121gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, compl... 42 2.5
122gb|AF200742.1|AF200742 Azoarcus sp. BH72 Mo-nitrogenase operon, ... 42 2.5
123dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.5
124gb|AF263912.1|AF263912 Streptomyces noursei ATCC 11455 nystatin ... 42 2.5
125dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.5
126dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.5
127gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 42 2.5
128dbj|AP000346.1| Homo sapiens genomic DNA, chromosome 22q11.2, cl... 42 2.5
129dbj|AP000345.1| Homo sapiens genomic DNA, chromosome 22q11.2, cl... 42 2.5
130gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 40 10.0
131gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence 40 10.0
132gb|AC096672.14| Trypanosoma brucei chromosome 4 clone RPCI93-24M... 40 10.0
133gb|AC125444.9| Mus musculus chromosome 1, clone RP24-499L20, com... 40 10.0
134ref|XM_588833.2| PREDICTED: Bos taurus similar to CG2186-PA (LOC... 40 10.0
135gb|AC161180.3| Mus musculus chromosome 1, clone RP23-149C6, comp... 40 10.0
136gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 10.0
137ref|XM_976324.1| PREDICTED: Mus musculus RIKEN cDNA 5530401N06 g... 40 10.0
138ref|XM_975832.1| PREDICTED: Mus musculus RIKEN cDNA A030005L19 g... 40 10.0
139ref|XM_919110.2| PREDICTED: Mus musculus RIKEN cDNA 5530401N06 g... 40 10.0
140ref|XM_919025.2| PREDICTED: Mus musculus RIKEN cDNA A030005L19 g... 40 10.0
141ref|XM_896507.2| PREDICTED: Mus musculus RIKEN cDNA 5530401N06 g... 40 10.0
142ref|XM_896385.2| PREDICTED: Mus musculus RIKEN cDNA A030005L19 g... 40 10.0
143ref|XM_818195.1| Trypanosoma brucei TREU927 hypothetical protein... 40 10.0
144ref|XM_856358.1| PREDICTED: Canis familiaris hypothetical protei... 40 10.0
145gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 40 10.0
146emb|AL022018.1|DMC8D8 Drosophila melanogaster cosmid clone 8D8 40 10.0
147gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell ... 40 10.0
148dbj|AB256661.1| Phragmites australis PhaHAK3 mRNA for potassium ... 40 10.0
149dbj|AB256660.1| Phragmites australis PhaHAK3 mRNA for potassium ... 40 10.0
150gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 10.0
151ref|NM_078977.2| Drosophila melanogaster toutatis CG10897-RA, tr... 40 10.0
152gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell... 40 10.0
153gb|AF314193.1| Drosophila melanogaster Toutatis (tou) gene, comp... 40 10.0
154gb|AF325500.1|AF325500 Antheraea yamamai transposon mariner-like... 40 10.0
155dbj|AK020696.1| Mus musculus 6 days neonate skin cDNA, RIKEN ful... 40 10.0
156dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 10.0
157gb|AC011696.4|AC011696 Drosophila melanogaster, chromosome 2R, r... 40 10.0
158gb|AC007473.10|AC007473 Drosophila melanogaster, chromosome 2R, ... 40 10.0
159gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, comple... 40 10.0
160gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 10.0
161dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 10.0
162dbj|AP005395.3| Oryza sativa (japonica cultivar-group) genomic D... 40 10.0
163dbj|AK119747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 10.0
164gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 10.0
165emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 10.0
166gb|AE003825.3| Drosophila melanogaster chromosome 2R, section 25... 40 10.0
167gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 o... 40 10.0
168gb|AC123676.9| Mus musculus chromosome 1, clone RP23-275F9, comp... 40 10.0
169gb|DQ147214.1| Zea diploperennis isolate d8 phospholipid transfe... 40 10.0
170gb|DQ147212.1| Zea diploperennis isolate d6 phospholipid transfe... 40 10.0
171gb|DQ147211.1| Zea diploperennis isolate d5 phospholipid transfe... 40 10.0
172gb|DQ147208.1| Zea diploperennis isolate d3 phospholipid transfe... 40 10.0
173gb|DQ147206.1| Zea diploperennis isolate d1 phospholipid transfe... 40 10.0
174gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 40 10.0
175dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rie... 40 10.0

>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score =  809 bits (408), Expect = 0.0
 Identities = 424/427 (99%), Gaps = 2/427 (0%)
 Strand = Plus / Minus

                                                                        
Query: 301  cttggagcaatcggttctggggctgatggcgtaggggatgttgacgccgcacttgctggg 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2791 cttggagcaatcggttctggggctgatggcgtaggggatgttgacgccgcacttgctggg 2732

                                                                        
Query: 361  gatgccggcgacgaggtcgggcttgatgccgcccatgccgctcgtctgctgcttgaggca 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2731 gatgccggcgacgaggtcgggcttgatgccgcccatgccgctcgtctgctgcttgaggca 2672

                                                                        
Query: 421  ggtgcaggtggcttggcggtcggcgggggtggcagccgccgcgttaaggctacgcacgcc 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2671 ggtgcaggtggcttggcggtcggcgggggtggcagccgccgcgttaaggctacgcacgcc 2612

                                                                        
Query: 481  cgtgcagcagcccccgccaggtgcacgctccctgcccatagcgtaaccgatacacggcgc 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2611 cgtgcagcagcccccgccaggtgcacgctccctgcccatagcgtaaccgatacacggcgc 2552

                                                                        
Query: 541  caggtagctcaccacctgaccgcagctcgcaaccgcaccctccgccggcgccggtgcccc 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2551 caggtagctcaccacctgaccgcagctcgcaaccgcaccctccgccggcgccggtgcccc 2492

                                                                        
Query: 601  agacagcacaagcgccaccaccagcagtgccatggtcgcggctgcgtgggcacggcgaga 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2491 agacagcacaagcgccaccaccagcagtgccatggtcgcggctgcgtgggcacggcgaga 2432

                                                                        
Query: 661  tgccatggtggaaactagcctagtgtgcttgctttgtcggcttagtcgggtgcgtcagtg 720
            |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2431 tgccatggtggaaactag-ctagtgtgcttgctttgtcggcttagtc-ggtgcgtcagtg 2374

                   
Query: 721  aangctg 727
            || ||||
Sbjct: 2373 aaggctg 2367



 Score =  392 bits (198), Expect = e-106
 Identities = 200/201 (99%)
 Strand = Plus / Minus

                                                                        
Query: 1    atgcattacagagttccgacaaagtacacgagttccctngggagtacaagatcacagctc 60
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 3227 atgcattacagagttccgacaaagtacacgagttccctcgggagtacaagatcacagctc 3168

                                                                        
Query: 61   tcgtggcaacaacggccacaacgtacgaacgaagctgcggcggcagcagcagtaaaacta 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3167 tcgtggcaacaacggccacaacgtacgaacgaagctgcggcggcagcagcagtaaaacta 3108

                                                                        
Query: 121  atttattatgagaaagcggtagaactagtaaagcagtaaactaaacgcggtggagccatg 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3107 atttattatgagaaagcggtagaactagtaaagcagtaaactaaacgcggtggagccatg 3048

                                 
Query: 181  catgcatccagtactgctaga 201
            |||||||||||||||||||||
Sbjct: 3047 catgcatccagtactgctaga 3027



 Score =  168 bits (85), Expect = 2e-38
 Identities = 85/85 (100%)
 Strand = Plus / Minus

                                                                        
Query: 217  acgcatacagtactgctagctatagctagcaaggacggggcttccacaatttatttcgct 276
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3011 acgcatacagtactgctagctatagctagcaaggacggggcttccacaatttatttcgct 2952

                                     
Query: 277  ctcaccatgcaacgcttaacgcacc 301
            |||||||||||||||||||||||||
Sbjct: 2951 ctcaccatgcaacgcttaacgcacc 2927



to top

>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA,
           complete cds
          Length = 841

 Score =  373 bits (188), Expect = e-100
 Identities = 324/368 (88%), Gaps = 1/368 (0%)
 Strand = Plus / Minus

                                                                       
Query: 324 tgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcgggct 383
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcgacgaggtcgggct 342

                                                                       
Query: 384 tgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcggtcgg 443
           |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||
Sbjct: 341 tgatgccgcccatgccgctcgtctgctgcttgaggcagctgcaggtggcctggcggtcgg 282

                                                                       
Query: 444 cgggggtggcagccgccgcgttaaggctacgcacgcccgtgcagcagcccccgccaggtg 503
           ||| |||||  ||||||||||||||||||||||||||  |||||||||| |||  |||  
Sbjct: 281 cggtggtggaggccgccgcgttaaggctacgcacgccgctgcagcagccaccgttaggac 222

                                                                       
Query: 504 cacgctccctgcccatagcgtaaccgatacacggcgccaggtagctcaccacctgaccgc 563
           || || |||||||| | |||||   ||| ||||| ||||||||||| |||||||| ||||
Sbjct: 221 caggcgccctgcccgttgcgtacgtgatgcacggggccaggtagcttaccacctggccgc 162

                                                                       
Query: 564 agctcgcaaccgcaccctccgccggcgccggtgccccagacagcacaagcgccaccacca 623
           || |||  || |||||||||||||| ||||| ||| |||||||||||||  || || | |
Sbjct: 161 agttcgagacggcaccctccgccggtgccggcgccgcagacagcacaagaaccgccgcga 102

                                                                       
Query: 624 gcagtgccatggtcgcggctgcgtgggcacggcgagatgccatggtggaaactagcctag 683
           |||| |||| ||| ||||| ||||||||||||||||  ||||||| ||||||||| ||||
Sbjct: 101 gcagggccaaggttgcggcggcgtgggcacggcgagcggccatggcggaaactag-ctag 43

                   
Query: 684 tgtgcttg 691
           ||||||||
Sbjct: 42  tgtgcttg 35



 Score = 48.1 bits (24), Expect = 0.041
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 139 gtagaactagtaaagcagtaaactaaacgcggtggagccatgcatgcatcca 190
           |||||||||||||||||||||   | |||  ||||||| |||||||||||||
Sbjct: 593 gtagaactagtaaagcagtaattaatacgacgtggagctatgcatgcatcca 542



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 1   atgcattacagagttccgacaaagtac 27
           |||||||||||||||||||| ||||||
Sbjct: 734 atgcattacagagttccgacgaagtac 708



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  tcacagctctcgtggcaaca 71
           ||||||||||||||||||||
Sbjct: 677 tcacagctctcgtggcaaca 658



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  172 bits (87), Expect = 1e-39
 Identities = 117/127 (92%)
 Strand = Plus / Minus

                                                                            
Query: 320      gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
                ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 14437049 gggctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 14436990

                                                                            
Query: 380      ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
                ||| | | ||||||||||||||||||||||||||||| ||||| ||||||||  ||| ||
Sbjct: 14436989 ggcctcaggccgcccatgccgctcgtctgctgcttgatgcaggcgcaggtggtctggtgg 14436930

                       
Query: 440      tcggcgg 446
                |||||||
Sbjct: 14436929 tcggcgg 14436923



to top

>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score =  172 bits (87), Expect = 1e-39
 Identities = 117/127 (92%)
 Strand = Plus / Minus

                                                                         
Query: 320   gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
             ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 45547 gggctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 45488

                                                                         
Query: 380   ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
             ||| | | ||||||||||||||||||||||||||||| ||||| ||||||||  ||| ||
Sbjct: 45487 ggcctcaggccgcccatgccgctcgtctgctgcttgatgcaggcgcaggtggtctggtgg 45428

                    
Query: 440   tcggcgg 446
             |||||||
Sbjct: 45427 tcggcgg 45421



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                          
Query: 320    gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
              |||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 722712 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 722653

                                                                          
Query: 380    ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
              ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 722652 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 722593

                            
Query: 440    tcggcgggggtggc 453
              ||||||| ||||||
Sbjct: 722592 tcggcggtggtggc 722579



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 319    ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
              ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 732602 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 732551



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                             
Query: 340    gttgacgccgcacttgctggggatgccggcg 370
              ||||||||||||||||| |||||||||||||
Sbjct: 745552 gttgacgccgcacttgccggggatgccggcg 745522



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 322    gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
              |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 736726 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 736678



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 340    gttgacgccgcacttgctggggatgccggcgacg 373
              |||||||||||| |||| ||||| ||||||||||
Sbjct: 760344 gttgacgccgcatttgccggggacgccggcgacg 760311



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11,
              complete sequence
          Length = 28386948

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                          
Query: 320    gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
              ||||||||||||||||||||||||||| ||||||||  ||||||||||||||||||||||
Sbjct: 679454 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 679395

                                                                          
Query: 380    ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
              ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 679394 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 679335

                            
Query: 440    tcggcgggggtggc 453
              ||||||| ||||||
Sbjct: 679334 tcggcggtggtggc 679321



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 319    ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
              ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 692750 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 692699



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                             
Query: 340    gttgacgccgcacttgctggggatgccggcg 370
              ||||||||||||||||| |||||||||||||
Sbjct: 714842 gttgacgccgcacttgccggggatgccggcg 714812



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                
Query: 340    gttgacgccgcacttgctggggatgccggcgacg 373
              ||||||||||||||||| ||||| ||||||||||
Sbjct: 722372 gttgacgccgcacttgccggggacgccggcgacg 722339



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 322      gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
                |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 13090040 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 13089992



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 322    gctgatggcgtaggggatgttgacgccgcactt 354
              |||||||| |||||||| | |||||||||||||
Sbjct: 702424 gctgatggtgtaggggacgctgacgccgcactt 702392



to top

>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                       
Query: 320 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
           |||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 415 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 356

                                                                       
Query: 380 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
           ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 355 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 296

                         
Query: 440 tcggcgggggtggc 453
           ||||||| ||||||
Sbjct: 295 tcggcggtggtggc 282



to top

>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                        
Query: 320  gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
            |||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 3501 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 3442

                                                                        
Query: 380  ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
            ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 3441 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 3382

                          
Query: 440  tcggcgggggtggc 453
            ||||||| ||||||
Sbjct: 3381 tcggcggtggtggc 3368



to top

>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                       
Query: 320 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
           |||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 417 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 358

                                                                       
Query: 380 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
           ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 357 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 298

                         
Query: 440 tcggcgggggtggc 453
           ||||||| ||||||
Sbjct: 297 tcggcggtggtggc 284



to top

>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                       
Query: 320 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
           ||||||||||||||||||||||||||| ||||||||  ||||||||||||||||||||||
Sbjct: 419 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 360

                                                                       
Query: 380 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
           ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 359 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 300

                         
Query: 440 tcggcgggggtggc 453
           ||||||| ||||||
Sbjct: 299 tcggcggtggtggc 286



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                          
Query: 320    gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
              ||||||||||||||||||||||||||| ||||||||  ||||||||||||||||||||||
Sbjct: 679454 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 679395

                                                                          
Query: 380    ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
              ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 679394 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 679335

                            
Query: 440    tcggcgggggtggc 453
              ||||||| ||||||
Sbjct: 679334 tcggcggtggtggc 679321



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 319    ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
              ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 692750 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 692699



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                             
Query: 340    gttgacgccgcacttgctggggatgccggcg 370
              ||||||||||||||||| |||||||||||||
Sbjct: 714842 gttgacgccgcacttgccggggatgccggcg 714812



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                
Query: 340    gttgacgccgcacttgctggggatgccggcgacg 373
              ||||||||||||||||| ||||| ||||||||||
Sbjct: 722372 gttgacgccgcacttgccggggacgccggcgacg 722339



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 322      gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
                |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 13170219 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 13170171



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 322    gctgatggcgtaggggatgttgacgccgcactt 354
              |||||||| |||||||| | |||||||||||||
Sbjct: 702424 gctgatggtgtaggggacgctgacgccgcactt 702392



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                          
Query: 320    gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
              |||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 722712 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 722653

                                                                          
Query: 380    ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
              ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 722652 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 722593

                            
Query: 440    tcggcgggggtggc 453
              ||||||| ||||||
Sbjct: 722592 tcggcggtggtggc 722579



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 319    ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
              ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 732602 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 732551



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                             
Query: 340    gttgacgccgcacttgctggggatgccggcg 370
              ||||||||||||||||| |||||||||||||
Sbjct: 745552 gttgacgccgcacttgccggggatgccggcg 745522



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 322    gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
              |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 736726 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 736678



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 340    gttgacgccgcacttgctggggatgccggcgacg 373
              |||||||||||| |||| ||||| ||||||||||
Sbjct: 760344 gttgacgccgcatttgccggggacgccggcgacg 760311



to top

>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Plus

                                                                         
Query: 320   gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
             |||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 56422 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 56481

                                                                         
Query: 380   ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
             ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 56482 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 56541

                           
Query: 440   tcggcgggggtggc 453
             ||||||| ||||||
Sbjct: 56542 tcggcggtggtggc 56555



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                 
Query: 319   ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
             ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 46532 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 46583



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 340   gttgacgccgcacttgctggggatgccggcg 370
             ||||||||||||||||| |||||||||||||
Sbjct: 33582 gttgacgccgcacttgccggggatgccggcg 33612



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 322   gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
             |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 42408 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 42456



 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 340   gttgacgccgcacttgctggggatgccggcgacg 373
             |||||||||||| |||| ||||| ||||||||||
Sbjct: 18790 gttgacgccgcatttgccggggacgccggcgacg 18823



to top

>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score =  170 bits (86), Expect = 4e-39
 Identities = 122/134 (91%)
 Strand = Plus / Plus

                                                                         
Query: 320   gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
             ||||||||||||||||||||||||||| ||||||||  ||||||||||||||||||||||
Sbjct: 63518 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 63577

                                                                         
Query: 380   ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
             ||| | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 63578 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 63637

                           
Query: 440   tcggcgggggtggc 453
             ||||||| ||||||
Sbjct: 63638 tcggcggtggtggc 63651



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                 
Query: 319   ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
             ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 50222 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 50273



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 340   gttgacgccgcacttgctggggatgccggcg 370
             ||||||||||||||||| |||||||||||||
Sbjct: 28130 gttgacgccgcacttgccggggatgccggcg 28160



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 340   gttgacgccgcacttgctggggatgccggcgacg 373
             ||||||||||||||||| ||||| ||||||||||
Sbjct: 20600 gttgacgccgcacttgccggggacgccggcgacg 20633



 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 322   gctgatggcgtaggggatgttgacgccgcactt 354
             |||||||| |||||||| | |||||||||||||
Sbjct: 40548 gctgatggtgtaggggacgctgacgccgcactt 40580



to top

>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein
          Length = 372

 Score =  143 bits (72), Expect = 9e-31
 Identities = 112/126 (88%)
 Strand = Plus / Minus

                                                                       
Query: 320 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
           ||||||||| ||||||||||||||||| ||||||||  |||||||||| |||||||||||
Sbjct: 126 gggctgatgccgtaggggatgttgacgtcgcacttggaggggatgccgncgacgaggtcg 67

                                                                       
Query: 380 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
           | | | | |||||||||| |||| ||||||||||||||||||| ||||||||  ||||||
Sbjct: 66  gncctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 7

                 
Query: 440 tcggcg 445
           ||||||
Sbjct: 6   tcggcg 1



to top

>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 766

 Score =  123 bits (62), Expect = 9e-25
 Identities = 116/134 (86%)
 Strand = Plus / Minus

                                                                       
Query: 320 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 379
           |||||||| ||||||||||||||||| |||||||||  |||||||||||||||| |||||
Sbjct: 369 gggctgatagcgtaggggatgttgaccccgcacttggaggggatgccggcgacgtggtcg 310

                                                                       
Query: 380 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 439
           ||| | |  | ||||||| |  | ||||||||||||||||||| ||||||||  ||||||
Sbjct: 309 ggcctcagccggcccatggccttggtctgctgcttgaggcaggcgcaggtggtctggcgg 250

                         
Query: 440 tcggcgggggtggc 453
           ||||||| ||||||
Sbjct: 249 tcggcggtggtggc 236



to top

>gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein precursor (LTP) mRNA,
           complete cds
          Length = 650

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                       
Query: 331 gtaggggatgttgacgccgcacttgctggggatgccggcgacga 374
           |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 349 gtaggggatgttgacgccgcacttgccggggatgccggcgacga 306



to top

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||||| | |||||||||||  ||||||||||||||
Sbjct: 384 gctgatggcgtaggggatgctaacgccgcactttgtggggatgccggcg 336



to top

>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 455 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 404



to top

>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 687 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 636



to top

>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 317 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 266



to top

>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 94  ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 145



to top

>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 640 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 589



to top

>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 423 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 372



to top

>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 405 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 354



to top

>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 320 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 322 gggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 272



to top

>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 369



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 327 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 288



to top

>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 326 atggcgtaggggatgttgacgccgcacttgctggggatgcc 366
           ||||||||||||||| ||||||||||||||  |||||||||
Sbjct: 314 atggcgtaggggatgctgacgccgcacttggaggggatgcc 274



to top

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 332 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 284



to top

>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 948 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 900



to top

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 377 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 329



to top

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 322  gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
            ||||||||||||||||| | | |||||||||||  ||||||||||||||
Sbjct: 1575 gctgatggcgtaggggacgctaacgccgcactttgtggggatgccggcg 1527



to top

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 322  gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
            ||||||||||||||||| | | |||||||||||  ||||||||||||||
Sbjct: 1587 gctgatggcgtaggggacgctaacgccgcactttgtggggatgccggcg 1539



to top

>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 406 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 358



to top

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||||||||
Sbjct: 403 gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcg 355



to top

>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 316 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 268



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 226 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 187



to top

>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 260



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 218 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 179



to top

>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 260



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 218 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 179



to top

>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 369



to top

>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 399 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 351



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 309 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 270



to top

>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 324 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 276



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 234 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 195



to top

>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 423 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 375



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 333 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 294



to top

>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 388



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 346 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 307



to top

>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 438 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 390



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 348 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 309



to top

>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 385



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 343 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 304



to top

>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 388



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 346 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 307



to top

>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 385



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 343 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 304



to top

>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 385



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 343 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 304



to top

>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 386



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 344 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 305



to top

>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279



to top

>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 253



to top

>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 253



to top

>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 397 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 349



to top

>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350



to top

>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 247 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 199



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 157 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 118



to top

>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 386



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 344 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 305



to top

>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 319 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||||| |||||||||  ||||||||||||||  |||||||| ||||
Sbjct: 400 ggggctgatggtgtaggggatcgtgacgccgcacttggaggggatgctggcg 349



to top

>gb|AF439446.1|AF439446 Setaria italica lipid transfer protein mRNA, complete cds
          Length = 851

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 343 gacgccgcacttgctggggatgccggcgacg 373
           |||||||||||||| ||||||||||||||||
Sbjct: 381 gacgccgcacttgccggggatgccggcgacg 351



to top

>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full
           insert sequence
          Length = 760

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 340 gttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||| |||||||||||||
Sbjct: 397 gttgacgccgcacttgccggggatgccggcg 367



to top

>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full
            insert sequence
          Length = 2914

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 340  gttgacgccgcacttgctggggatgccggcg 370
            ||||||||||||||||| |||||||||||||
Sbjct: 2484 gttgacgccgcacttgccggggatgccggcg 2454



to top

>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full
           insert sequence
          Length = 646

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 340 gttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||| |||||||||||||
Sbjct: 391 gttgacgccgcacttgccggggatgccggcg 361



to top

>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full
           insert sequence
          Length = 928

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 340 gttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||| |||||||||||||
Sbjct: 396 gttgacgccgcacttgccggggatgccggcg 366



to top

>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full
           insert sequence
          Length = 853

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 340 gttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||| |||||||||||||
Sbjct: 391 gttgacgccgcacttgccggggatgccggcg 361



to top

>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full
           insert sequence
          Length = 773

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 340 gttgacgccgcacttgctggggatgccggcg 370
           ||||||||||||||||| |||||||||||||
Sbjct: 396 gttgacgccgcacttgccggggatgccggcg 366



to top

>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 322 gctgatggcgtaggggatgttgacgccgcacttg 355
           |||||||| |||||||||| ||||||||||||||
Sbjct: 318 gctgatggagtaggggatgctgacgccgcacttg 285



to top

>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 322 gctgatggcgtaggggatgttgacgccgcacttg 355
           |||||||| |||||||||| ||||||||||||||
Sbjct: 318 gctgatggagtaggggatgctgacgccgcacttg 285



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 322  gctgatggcgtaggggatgttgacgccgcacttg 355
            |||||||| |||||||||| ||||||||||||||
Sbjct: 3174 gctgatggagtaggggatgctgacgccgcacttg 3141



to top

>gb|AC123514.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
           OSJNBb0004B05, complete sequence
          Length = 121223

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 340 gttgacgccgcacttgctggggatgccggcgacg 373
           ||||||||||||||||| ||||| ||||||||||
Sbjct: 663 gttgacgccgcacttgccggggacgccggcgacg 630



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 322 gctgatggcgtaggggatgttgacgccgcacttg 355
           |||||||| |||||||||| ||||||||||||||
Sbjct: 378 gctgatggagtaggggatgctgacgccgcacttg 345



to top

>dbj|AK064888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000K13, full
           insert sequence
          Length = 737

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 340 gttgacgccgcacttgctggggatgccggcgacg 373
           ||||||||||||||||| ||||| ||||||||||
Sbjct: 439 gttgacgccgcacttgccggggacgccggcgacg 406



to top

>dbj|AK061740.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-E11, full
            insert sequence
          Length = 1437

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 340  gttgacgccgcacttgctggggatgccggcgacg 373
            ||||||||||||||||| ||||| ||||||||||
Sbjct: 1121 gttgacgccgcacttgccggggacgccggcgacg 1088



to top

>dbj|AK060108.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C09, full
           insert sequence
          Length = 1196

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 340 gttgacgccgcacttgctggggatgccggcgacg 373
           ||||||||||||||||| ||||| ||||||||||
Sbjct: 391 gttgacgccgcacttgccggggacgccggcgacg 358



to top

>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 322 gctgatggcgtaggggatgttgacgccgcacttg 355
           |||||||| |||||||||| ||||||||||||||
Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttg 268



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 211 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 172



to top

>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 322 gctgatggcgtaggggatgttgacgccgcacttg 355
           |||||||| |||||||||| ||||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttg 365



to top

>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 322 gctgatggcgtaggggatgttgacgccgcacttg 355
           |||||||| |||||||||| ||||||||||||||
Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttg 365



to top

>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 322   gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
             |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 94040 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 94088



to top

>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgcc 366
           ||||||||||||||||| | | |||||||||||  ||||||||||
Sbjct: 318 gctgatggcgtaggggacgctaacgccgcactttgtggggatgcc 274



to top

>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgcc 366
           ||||||||||||||||| | | |||||||||||  ||||||||||
Sbjct: 318 gctgatggcgtaggggacgctaacgccgcactttgtggggatgcc 274



to top

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||||||| |||| | | |||||||||||  ||||||||||||||
Sbjct: 283 gctgatggcgtaagggacgctaacgccgcactttgtggggatgccggcg 235



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 322  gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
            ||||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 1347 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 1299



to top

>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 277 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 229



to top

>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 980 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 932



to top

>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 421 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 373



to top

>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 396 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 348



to top

>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 440 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 392



to top

>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 439 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 391



to top

>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 653 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 605



to top

>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||| |||||||| | ||||||||||||||  |||||||| ||||
Sbjct: 421 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 373



to top

>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           ||||||||  ||||||||| ||||||||||||||  |||||||| ||||
Sbjct: 302 gctgatggtataggggatgctgacgccgcacttggaggggatgctggcg 254



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 212 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 173



to top

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 323 ctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
           |||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 981 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 934



to top

>emb|X92648.1|HALTP H.annuus mRNA for non-specific lipid-transfer protein
          Length = 520

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 297 gcaccttggagcaatcggttctggggctgatggcgtaggggatgttgacgccgcacttgc 356
           ||||||||||||||||||| || ||||||||   ||| |||||| |||| || |||||||
Sbjct: 385 gcaccttggagcaatcggtgcttgggctgatcttgtaagggatgctgacaccacacttgc 326



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                            
Query: 323  ctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 370
            |||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 2377 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 2330



to top

>ref|XM_600291.2| PREDICTED: Bos taurus similar to PYRIN-containing APAF1-like protein
            7 isoform 2 (LOC522018), mRNA
          Length = 2934

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 406  ctgctgcttgaggcaggtgcag 427
            ||||||||||||||||||||||
Sbjct: 1251 ctgctgcttgaggcaggtgcag 1230



to top

>emb|AJ704771.1| Oryza sativa (japonica cultivar-group) mRNA for lipid transfer
           protein (ltp2 gene)
          Length = 417

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 340 gttgacgccgcacttgctggggatgccggcgacg 373
           ||||||||||||||||| ||||| ||| ||||||
Sbjct: 339 gttgacgccgcacttgccggggacgccagcgacg 306



to top

>emb|X57477.1|OCCCBI2 Rabbit mRNA for calcium channel BI-2
          Length = 8405

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 91   gaagctgcggcggcagcagcag 112
            ||||||||||||||||||||||
Sbjct: 1424 gaagctgcggcggcagcagcag 1445



to top

>emb|X57476.1|OCCCBI1 Rabbit mRNA for calcium channel BI-1
          Length = 8820

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 91   gaagctgcggcggcagcagcag 112
            ||||||||||||||||||||||
Sbjct: 1424 gaagctgcggcggcagcagcag 1445



to top

>emb|X57689.1|OCCCBI2CB Rabbit mRNA for calcium channel BI-2 (lambda CBP109 and CB101)
          Length = 8405

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 91   gaagctgcggcggcagcagcag 112
            ||||||||||||||||||||||
Sbjct: 1424 gaagctgcggcggcagcagcag 1445



to top

>emb|X57688.1|OCCCBI1CB Rabbit mRNA for calcium channel BI-1 (lambda CBP109 and CB101)
          Length = 8820

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 91   gaagctgcggcggcagcagcag 112
            ||||||||||||||||||||||
Sbjct: 1424 gaagctgcggcggcagcagcag 1445



to top

>ref|XM_512395.1| PREDICTED: Pan troglodytes similar to zHuC (LOC455732), mRNA
          Length = 1158

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 490 gcccccgccaggtgcacgctccctg 514
           ||||||||||||||||| |||||||
Sbjct: 546 gcccccgccaggtgcaccctccctg 522



to top

>ref|XM_475420.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 417

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggc 444
           ||||||||||||||||| |||  ||||||||||
Sbjct: 267 cttgaggcaggtgcaggcggcgcggcggtcggc 235



to top

>gb|AC144737.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0018K15, complete sequence
          Length = 168519

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 412   cttgaggcaggtgcaggtggcttggcggtcggc 444
             ||||||||||||||||| |||  ||||||||||
Sbjct: 50083 cttgaggcaggtgcaggcggcgcggcggtcggc 50051



to top

>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcactt 354
           |||||||| |||||||| | |||||||||||||
Sbjct: 409 gctgatggtgtaggggacgctgacgccgcactt 377



to top

>gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, complete sequence
          Length = 142645

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 490   gcccccgccaggtgcacgctccctg 514
             ||||||||||||||||| |||||||
Sbjct: 42423 gcccccgccaggtgcaccctccctg 42447



to top

>gb|AF200742.1|AF200742 Azoarcus sp. BH72 Mo-nitrogenase operon, complete sequence
          Length = 6480

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 369  cgacgaggtcgggcttgatgc 389
            |||||||||||||||||||||
Sbjct: 2895 cgacgaggtcgggcttgatgc 2875



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 412      cttgaggcaggtgcaggtggcttggcggtcggc 444
                ||||||||||||||||| |||  ||||||||||
Sbjct: 23364547 cttgaggcaggtgcaggcggcgcggcggtcggc 23364515



to top

>gb|AF263912.1|AF263912 Streptomyces noursei ATCC 11455 nystatin biosynthetic gene cluster,
            complete sequence
          Length = 123580

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 604  cagcacaagcgccaccaccagcagtgcca 632
            |||||| |||||||||| |||||||||||
Sbjct: 3919 cagcaccagcgccaccagcagcagtgcca 3947



to top

>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 322  gctgatggcgtaggggatgttgacgccgcactt 354
            |||||||| |||||||| | |||||||||||||
Sbjct: 2428 gctgatggtgtaggggacgctgacgccgcactt 2396



to top

>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcactt 354
           |||||||| |||||||| | |||||||||||||
Sbjct: 305 gctgatggtgtaggggacgctgacgccgcactt 273



to top

>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 322 gctgatggcgtaggggatgttgacgccgcactt 354
           |||||||| |||||||| | |||||||||||||
Sbjct: 356 gctgatggtgtaggggacgctgacgccgcactt 324



to top

>dbj|AP000346.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB1572G7
          Length = 151600

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 615  ccaccaccagcagtgccatggtcgc 639
            |||||||||||| ||||||||||||
Sbjct: 8151 ccaccaccagcaatgccatggtcgc 8127



to top

>dbj|AP000345.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB208E9
          Length = 113255

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 615   ccaccaccagcagtgccatggtcgc 639
             |||||||||||| ||||||||||||
Sbjct: 45555 ccaccaccagcaatgccatggtcgc 45531



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 403    cgtctgctgcttgaggcagg 422
              ||||||||||||||||||||
Sbjct: 352102 cgtctgctgcttgaggcagg 352121



to top

>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence
          Length = 1590432

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 92      aagctgcggcggcagcagca 111
               ||||||||||||||||||||
Sbjct: 1583046 aagctgcggcggcagcagca 1583027



to top

>gb|AC096672.14| Trypanosoma brucei chromosome 4 clone RPCI93-24M18, complete sequence
          Length = 158627

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     aagctgcggcggcagcagca 111
              ||||||||||||||||||||
Sbjct: 151241 aagctgcggcggcagcagca 151222



to top

>gb|AC125444.9| Mus musculus chromosome 1, clone RP24-499L20, complete sequence
          Length = 162238

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     agctgcggcggcagcagcag 112
              ||||||||||||||||||||
Sbjct: 132069 agctgcggcggcagcagcag 132050



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 85039 agctgcggcggcagcagcag 85020



to top

>ref|XM_588833.2| PREDICTED: Bos taurus similar to CG2186-PA (LOC511489), mRNA
          Length = 3255

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 93   agctgcggcggcagcagcag 112
            ||||||||||||||||||||
Sbjct: 2684 agctgcggcggcagcagcag 2703



to top

>gb|AC161180.3| Mus musculus chromosome 1, clone RP23-149C6, complete sequence
          Length = 215599

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 93     agctgcggcggcagcagcag 112
              ||||||||||||||||||||
Sbjct: 161604 agctgcggcggcagcagcag 161623



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 93     agctgcggcggcagcagcag 112
              ||||||||||||||||||||
Sbjct: 114575 agctgcggcggcagcagcag 114594



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 74245 agctgcggcggcagcagcag 74264



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 13941 agctgcggcggcagcagcag 13960



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 361    gatgccggcgacgaggtcgg 380
              ||||||||||||||||||||
Sbjct: 321682 gatgccggcgacgaggtcgg 321701



to top

>ref|XM_976324.1| PREDICTED: Mus musculus RIKEN cDNA 5530401N06 gene (5530401N06Rik),
           mRNA
          Length = 992

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 361 agctgcggcggcagcagcag 342



to top

>ref|XM_975832.1| PREDICTED: Mus musculus RIKEN cDNA A030005L19 gene (A030005L19Rik),
           mRNA
          Length = 806

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 301 agctgcggcggcagcagcag 282



to top

>ref|XM_919110.2| PREDICTED: Mus musculus RIKEN cDNA 5530401N06 gene (5530401N06Rik),
           mRNA
          Length = 992

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 361 agctgcggcggcagcagcag 342



to top

>ref|XM_919025.2| PREDICTED: Mus musculus RIKEN cDNA A030005L19 gene (A030005L19Rik),
           mRNA
          Length = 806

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 301 agctgcggcggcagcagcag 282



to top

>ref|XM_896507.2| PREDICTED: Mus musculus RIKEN cDNA 5530401N06 gene (5530401N06Rik),
           mRNA
          Length = 992

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 361 agctgcggcggcagcagcag 342



to top

>ref|XM_896385.2| PREDICTED: Mus musculus RIKEN cDNA A030005L19 gene (A030005L19Rik),
           mRNA
          Length = 806

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 301 agctgcggcggcagcagcag 282



to top

>ref|XM_818195.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.406.0230)
            partial mRNA
          Length = 2982

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 393  ccatgccgctcgtctgctgc 412
            ||||||||||||||||||||
Sbjct: 2816 ccatgccgctcgtctgctgc 2797



to top

>ref|XM_856358.1| PREDICTED: Canis familiaris hypothetical protein LOC608347
           (LOC608347), mRNA
          Length = 948

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 438 ggtcggcgggggtggcagccgccg 461
           ||||||||||||| ||||||||||
Sbjct: 537 ggtcggcgggggtcgcagccgccg 560



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 361    gatgccggcgacgaggtcgg 380
              ||||||||||||||||||||
Sbjct: 402477 gatgccggcgacgaggtcgg 402496



to top

>emb|AL022018.1|DMC8D8 Drosophila melanogaster cosmid clone 8D8
          Length = 38397

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 18644 agctgcggcggcagcagcag 18625



to top

>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 181360

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 15035 agctgcggcggcagcagcag 15016



to top

>dbj|AB256661.1| Phragmites australis PhaHAK3 mRNA for potassium transporter, complete
            cds, strain: Enchi
          Length = 2251

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 571  aaccgcaccctccgccggcg 590
            ||||||||||||||||||||
Sbjct: 1942 aaccgcaccctccgccggcg 1923



to top

>dbj|AB256660.1| Phragmites australis PhaHAK3 mRNA for potassium transporter, complete
            cds, strain: Nanpi
          Length = 2423

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 571  aaccgcaccctccgccggcg 590
            ||||||||||||||||||||
Sbjct: 2114 aaccgcaccctccgccggcg 2095



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 360     ggatgccggcgacgaggtcg 379
               ||||||||||||||||||||
Sbjct: 2803167 ggatgccggcgacgaggtcg 2803148



to top

>ref|NM_078977.2| Drosophila melanogaster toutatis CG10897-RA, transcript variant A
            (tou), mRNA
          Length = 10497

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 93   agctgcggcggcagcagcag 112
            ||||||||||||||||||||
Sbjct: 1014 agctgcggcggcagcagcag 1033



to top

>gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 164252

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 74550 agctgcggcggcagcagcag 74531



to top

>gb|AF314193.1| Drosophila melanogaster Toutatis (tou) gene, complete cds
          Length = 39574

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 26639 agctgcggcggcagcagcag 26658



to top

>gb|AF325500.1|AF325500 Antheraea yamamai transposon mariner-like element transposase gene,
            partial cds; and fibroin gene, complete cds
          Length = 9921

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 93   agctgcggcggcagcagcag 112
            ||||||||||||||||||||
Sbjct: 9063 agctgcggcggcagcagcag 9082



 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 93   agctgcggcggcagcagcag 112
            ||||||||||||||||||||
Sbjct: 7845 agctgcggcggcagcagcag 7864



to top

>dbj|AK020696.1| Mus musculus 6 days neonate skin cDNA, RIKEN full-length enriched
           library, clone:A030005L19 product:unclassifiable, full
           insert sequence
          Length = 808

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 302 agctgcggcggcagcagcag 283



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 418      gcaggtgcaggtggcttggc 437
                ||||||||||||||||||||
Sbjct: 28261160 gcaggtgcaggtggcttggc 28261179



to top

>gb|AC011696.4|AC011696 Drosophila melanogaster, chromosome 2R, region 48A-48C, BAC clone
            BACR35F01, complete sequence
          Length = 170869

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 93   agctgcggcggcagcagcag 112
            ||||||||||||||||||||
Sbjct: 7046 agctgcggcggcagcagcag 7027



to top

>gb|AC007473.10|AC007473 Drosophila melanogaster, chromosome 2R, region 48A-48B, BAC clone
             BACR38D12, complete sequence
          Length = 171831

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 47365 agctgcggcggcagcagcag 47346



to top

>gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, complete sequence
          Length = 191827

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 315   ttctggggctgatggcgtagggga 338
             ||||||||||||||||||| ||||
Sbjct: 63783 ttctggggctgatggcgtacggga 63806



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 573     ccgcaccctccgccggcgccggtgcccc 600
               |||| ||| |||||||||||||||||||
Sbjct: 3846689 ccgcgccccccgccggcgccggtgcccc 3846662



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 335     gggatgttgacgccgcactt 354
               ||||||||||||||||||||
Sbjct: 3074255 gggatgttgacgccgcactt 3074236



to top

>dbj|AP005395.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0623A10
          Length = 156517

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 418   gcaggtgcaggtggcttggc 437
             ||||||||||||||||||||
Sbjct: 59189 gcaggtgcaggtggcttggc 59208



to top

>dbj|AK119747.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-D09, full
           insert sequence
          Length = 3450

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 921 agctgcggcggcagcagcag 940



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 360    ggatgccggcgacgaggtcgggct 383
              |||||||||| |||||||||||||
Sbjct: 822386 ggatgccggccacgaggtcgggct 822409



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 611     agcgccaccaccagcagtgccatg 634
               ||||||||||||||||| ||||||
Sbjct: 3910818 agcgccaccaccagcagcgccatg 3910841



to top

>gb|AE003825.3| Drosophila melanogaster chromosome 2R, section 25 of 73 of the complete
              sequence
          Length = 261690

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     agctgcggcggcagcagcag 112
              ||||||||||||||||||||
Sbjct: 125538 agctgcggcggcagcagcag 125519



to top

>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete
              sequence
          Length = 308311

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     agctgcggcggcagcagcag 112
              ||||||||||||||||||||
Sbjct: 185870 agctgcggcggcagcagcag 185851



to top

>gb|AC123676.9| Mus musculus chromosome 1, clone RP23-275F9, complete sequence
          Length = 169201

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    agctgcggcggcagcagcag 112
             ||||||||||||||||||||
Sbjct: 60006 agctgcggcggcagcagcag 59987



to top

>gb|DQ147214.1| Zea diploperennis isolate d8 phospholipid transfer protein 1 (plt1)
           gene, complete cds
          Length = 814

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 326 cttgaggcagctgcaggcggcgcggcggtcggcggtggtg 287



to top

>gb|DQ147212.1| Zea diploperennis isolate d6 phospholipid transfer protein 1 (plt1)
           gene, complete cds
          Length = 814

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287



to top

>gb|DQ147211.1| Zea diploperennis isolate d5 phospholipid transfer protein 1 (plt1)
           gene, complete cds
          Length = 814

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287



to top

>gb|DQ147208.1| Zea diploperennis isolate d3 phospholipid transfer protein 1 (plt1)
           gene, complete cds
          Length = 812

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287



to top

>gb|DQ147206.1| Zea diploperennis isolate d1 phospholipid transfer protein 1 (plt1)
           gene, complete cds
          Length = 814

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287



to top

>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 412 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 451
           |||||||||| |||||| |||  |||||||||||| ||||
Sbjct: 213 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 174



to top

>dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rieske Fe-S
           precursor protein, complete cds
          Length = 1436

 Score = 40.1 bits (20), Expect = 10.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 93  agctgcggcggcagcagcag 112
           ||||||||||||||||||||
Sbjct: 821 agctgcggcggcagcagcag 840


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,752,691
Number of Sequences: 3902068
Number of extensions: 4752691
Number of successful extensions: 110034
Number of sequences better than 10.0: 176
Number of HSP's better than 10.0 without gapping: 178
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108271
Number of HSP's gapped (non-prelim): 1758
length of query: 729
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 706
effective length of database: 17,143,297,704
effective search space: 12103168179024
effective search space used: 12103168179024
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top