ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3i05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL161723.12| Human DNA sequence from clone RP13-172P13 on ch... 42 2.1
2emb|AL132657.33|HSA258F22 Human DNA sequence from clone RP11-258... 42 2.1
3dbj|AK125538.1| Homo sapiens cDNA FLJ43550 fis, clone PROST2017441 42 2.1
4gb|AE009811.1|AE009811 Pyrobaculum aerophilum strain IM2 section... 42 2.1
5emb|BX569800.8| Zebrafish DNA sequence from clone DKEY-106C24 in... 42 2.1
6dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 42 2.1
7gb|AC009479.4|AC009479 Homo sapiens BAC clone RP11-278L6 from Y,... 42 2.1
8emb|AL953866.5| Zebrafish DNA sequence from clone DKEY-60I9 in l... 42 2.1
9dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome 42 2.1
10gb|AC103646.6| Mus musculus chromosome 3, clone RP24-549G23, com... 40 8.3
11gb|AC167221.9| Mus musculus 10 BAC RP23-3P24 (Roswell Park Cance... 40 8.3
12gb|AC166082.11| Mus musculus 10 BAC RP23-150M2 (Roswell Park Can... 40 8.3
13gb|AC102458.8| Mus musculus chromosome 1, clone RP24-312N11, com... 40 8.3
14gb|AF527417.1| Homo sapiens cell division cycle 25A (CDC25A) gen... 40 8.3
15gb|AC158932.5| Mus musculus chromosome 3, clone RP24-338G13, com... 40 8.3
16gb|AC162894.4| Mus musculus chromosome 3, clone RP23-326A24, com... 40 8.3
17gb|AC164411.4| Mus musculus chromosome 1, clone RP23-60E6, compl... 40 8.3
18gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, com... 40 8.3
19gb|AC129303.5| Mus musculus BAC clone RP24-447E12 from chromosom... 40 8.3
20emb|Z80903.1|HSU162C4 Human DNA sequence from clone LL0XNC01-162... 40 8.3
21emb|Z82975.1|HS36J3 Human DNA sequence from clone RP1-36J3 on ch... 40 8.3
22emb|AL683842.11| Human DNA sequence from clone RP11-47G11 on chr... 40 8.3
23gb|AC095281.6| Rattus norvegicus 4 BAC CH230-10M16 (Children's H... 40 8.3
24emb|CR536620.6| Zebrafish DNA sequence from clone CH211-235C15 i... 40 8.3
25emb|BX572090.1| Prochlorococcus marinus MED4 complete genome; se... 40 8.3
26gb|AC064801.10| Homo sapiens chromosome 18, clone RP11-120K19, c... 40 8.3
27gb|AC069360.7| Homo sapiens chromosome 11, clone CTD1-2003C8, co... 40 8.3
28dbj|AK140532.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 8.3
29gb|AC124916.3| Homo sapiens chromosome 3 clone RP11-1029M24, com... 40 8.3
30gb|AC073621.20| Homo sapiens chromosome 17, clone CTD-3073J20, c... 40 8.3
31gb|AC104190.3| Homo sapiens chromosome 3 clone RP11-502L5, compl... 40 8.3
32emb|BX663502.9| Zebrafish DNA sequence from clone CH211-202C21 i... 40 8.3
33gb|AC172623.3| Mus musculus chromosome 8, clone RP23-478A9, comp... 40 8.3
34gb|AC153560.5| Mus musculus 10 BAC RP23-376E10 (Roswell Park Can... 40 8.3
35gb|AC140228.3| Mus musculus BAC clone RP24-488C4 from 10, comple... 40 8.3
36gb|AC158363.2| Mus musculus BAC clone RP23-214J3 from chromosome... 40 8.3
37emb|AL773530.9| Mouse DNA sequence from clone RP23-180A8 on chro... 40 8.3

>emb|AL161723.12| Human DNA sequence from clone RP13-172P13 on chromosome X, complete
              sequence
          Length = 155725

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 309    tgtttttgaaattattttctt 329
              |||||||||||||||||||||
Sbjct: 132287 tgtttttgaaattattttctt 132307



to top

>emb|AL132657.33|HSA258F22 Human DNA sequence from clone RP11-258F22 on chromosome 10 Contains a
              novel gene and a CpG island, complete sequence
          Length = 160743

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 291    agatggcttagtgaaagctgt 311
              |||||||||||||||||||||
Sbjct: 126072 agatggcttagtgaaagctgt 126092



to top

>dbj|AK125538.1| Homo sapiens cDNA FLJ43550 fis, clone PROST2017441
          Length = 2479

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 291  agatggcttagtgaaagctgt 311
            |||||||||||||||||||||
Sbjct: 1412 agatggcttagtgaaagctgt 1392



to top

>gb|AE009811.1|AE009811 Pyrobaculum aerophilum strain IM2 section 66 of 201 of the complete
             genome
          Length = 14032

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 148   gcagtgcccctgtggaagtgg 168
             |||||||||||||||||||||
Sbjct: 12702 gcagtgcccctgtggaagtgg 12682



to top

>emb|BX569800.8| Zebrafish DNA sequence from clone DKEY-106C24 in linkage group 21,
             complete sequence
          Length = 188915

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 433   cacaatttcatttcatacact 453
             |||||||||||||||||||||
Sbjct: 97255 cacaatttcatttcatacact 97235



to top

>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA,
              complete genome
          Length = 2516575

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 425    actgttaccacaatttcattt 445
              |||||||||||||||||||||
Sbjct: 983135 actgttaccacaatttcattt 983155



to top

>gb|AC009479.4|AC009479 Homo sapiens BAC clone RP11-278L6 from Y, complete sequence
          Length = 155299

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 309    tgtttttgaaattattttctt 329
              |||||||||||||||||||||
Sbjct: 138504 tgtttttgaaattattttctt 138524



to top

>emb|AL953866.5| Zebrafish DNA sequence from clone DKEY-60I9 in linkage group 21,
             complete sequence
          Length = 198925

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 433   cacaatttcatttcatacact 453
             |||||||||||||||||||||
Sbjct: 87939 cacaatttcatttcatacact 87919



to top

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 324     tttcttcgccattgacaacat 344
               |||||||||||||||||||||
Sbjct: 3470595 tttcttcgccattgacaacat 3470615



to top

>gb|AC103646.6| Mus musculus chromosome 3, clone RP24-549G23, complete sequence
          Length = 130631

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 7    atgataacatcttagcatga 26
            ||||||||||||||||||||
Sbjct: 8595 atgataacatcttagcatga 8614



to top

>gb|AC167221.9| Mus musculus 10 BAC RP23-3P24 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 204841

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 311  tttttgaaattattttcttc 330
            ||||||||||||||||||||
Sbjct: 4466 tttttgaaattattttcttc 4447



to top

>gb|AC166082.11| Mus musculus 10 BAC RP23-150M2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 170819

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   tttttgaaattattttcttc 330
             ||||||||||||||||||||
Sbjct: 17126 tttttgaaattattttcttc 17107



to top

>gb|AC102458.8| Mus musculus chromosome 1, clone RP24-312N11, complete sequence
          Length = 167263

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      atgaaatgataacatcttag 21
              ||||||||||||||||||||
Sbjct: 134046 atgaaatgataacatcttag 134065



to top

>gb|AF527417.1| Homo sapiens cell division cycle 25A (CDC25A) gene, complete cds
          Length = 31868

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 54    ttcaaatatgacaatgttacactt 77
             |||||||||||||||| |||||||
Sbjct: 24346 ttcaaatatgacaatggtacactt 24323



to top

>gb|AC158932.5| Mus musculus chromosome 3, clone RP24-338G13, complete sequence
          Length = 159429

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      atgataacatcttagcatga 26
              ||||||||||||||||||||
Sbjct: 120754 atgataacatcttagcatga 120735



to top

>gb|AC162894.4| Mus musculus chromosome 3, clone RP23-326A24, complete sequence
          Length = 187598

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      atgataacatcttagcatga 26
              ||||||||||||||||||||
Sbjct: 162369 atgataacatcttagcatga 162350



to top

>gb|AC164411.4| Mus musculus chromosome 1, clone RP23-60E6, complete sequence
          Length = 228155

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     atgaaatgataacatcttag 21
             ||||||||||||||||||||
Sbjct: 82356 atgaaatgataacatcttag 82375



to top

>gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, complete sequence
          Length = 203086

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 311    tttttgaaattattttcttc 330
              ||||||||||||||||||||
Sbjct: 126215 tttttgaaattattttcttc 126196



to top

>gb|AC129303.5| Mus musculus BAC clone RP24-447E12 from chromosome 10, complete
             sequence
          Length = 135245

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 276   gatgtcctggaattgagatg 295
             ||||||||||||||||||||
Sbjct: 14034 gatgtcctggaattgagatg 14015



to top

>emb|Z80903.1|HSU162C4 Human DNA sequence from clone LL0XNC01-162C4 on chromosome X Contains
             5' UTR of the FGF13 gene for fibroblast growth factor 13,
             complete sequence
          Length = 39960

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     aatgataacatcttagcatg 25
             ||||||||||||||||||||
Sbjct: 35780 aatgataacatcttagcatg 35799



to top

>emb|Z82975.1|HS36J3 Human DNA sequence from clone RP1-36J3 on chromosome X Contains a
           CpG island, complete sequence
          Length = 105580

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 6   aatgataacatcttagcatg 25
           ||||||||||||||||||||
Sbjct: 860 aatgataacatcttagcatg 879



to top

>emb|AL683842.11| Human DNA sequence from clone RP11-47G11 on chromosome 10 Contains the
             gene for B cell RAG associated protein (GALNAC4S-6ST)
             (BRAG, KIAA0598), a novel pseudogene and three CpG
             islands, complete sequence
          Length = 149244

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 437   atttcatttcatacactcag 456
             ||||||||||||||||||||
Sbjct: 31548 atttcatttcatacactcag 31567



to top

>gb|AC095281.6| Rattus norvegicus 4 BAC CH230-10M16 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 228330

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 436  aatttcatttcatacactca 455
            ||||||||||||||||||||
Sbjct: 3567 aatttcatttcatacactca 3586



to top

>emb|CR536620.6| Zebrafish DNA sequence from clone CH211-235C15 in linkage group 16,
             complete sequence
          Length = 57729

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 309   tgtttttgaaattattttct 328
             ||||||||||||||||||||
Sbjct: 22561 tgtttttgaaattattttct 22542



to top

>emb|BX572090.1| Prochlorococcus marinus MED4 complete genome; segment 1/5
          Length = 349742

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 309   tgtttttgaaattattttct 328
             ||||||||||||||||||||
Sbjct: 75554 tgtttttgaaattattttct 75573



to top

>gb|AC064801.10| Homo sapiens chromosome 18, clone RP11-120K19, complete sequence
          Length = 167843

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 432   ccacaatttcatttcataca 451
             ||||||||||||||||||||
Sbjct: 73397 ccacaatttcatttcataca 73378



to top

>gb|AC069360.7| Homo sapiens chromosome 11, clone CTD1-2003C8, complete sequence
          Length = 124409

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   gctgtttttgaaattattttcttc 330
             ||||||||| ||||||||||||||
Sbjct: 50212 gctgttttttaaattattttcttc 50189



to top

>dbj|AK140532.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:B930021M06
            product:unclassifiable, full insert sequence
          Length = 3147

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 292  gatggcttagtgaaagctgt 311
            ||||||||||||||||||||
Sbjct: 2350 gatggcttagtgaaagctgt 2331



to top

>gb|AC124916.3| Homo sapiens chromosome 3 clone RP11-1029M24, complete sequence
          Length = 207596

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 54     ttcaaatatgacaatgttacactt 77
              |||||||||||||||| |||||||
Sbjct: 189471 ttcaaatatgacaatggtacactt 189494



to top

>gb|AC073621.20| Homo sapiens chromosome 17, clone CTD-3073J20, complete sequence
          Length = 141048

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   tctgctctctcacatatggt 274
             ||||||||||||||||||||
Sbjct: 52660 tctgctctctcacatatggt 52679



to top

>gb|AC104190.3| Homo sapiens chromosome 3 clone RP11-502L5, complete sequence
          Length = 171181

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 54    ttcaaatatgacaatgttacactt 77
             |||||||||||||||| |||||||
Sbjct: 53726 ttcaaatatgacaatggtacactt 53749



to top

>emb|BX663502.9| Zebrafish DNA sequence from clone CH211-202C21 in linkage group 18,
              complete sequence
          Length = 188674

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 43     atggcaaggttttcaaatat 62
              ||||||||||||||||||||
Sbjct: 135078 atggcaaggttttcaaatat 135059



to top

>gb|AC172623.3| Mus musculus chromosome 8, clone RP23-478A9, complete sequence
          Length = 182316

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 292   gatggcttagtgaaagctgt 311
             ||||||||||||||||||||
Sbjct: 80127 gatggcttagtgaaagctgt 80146



to top

>gb|AC153560.5| Mus musculus 10 BAC RP23-376E10 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 183485

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 309   tgtttttgaaattattttct 328
             ||||||||||||||||||||
Sbjct: 66685 tgtttttgaaattattttct 66666



to top

>gb|AC140228.3| Mus musculus BAC clone RP24-488C4 from 10, complete sequence
          Length = 137705

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 276   gatgtcctggaattgagatg 295
             ||||||||||||||||||||
Sbjct: 97644 gatgtcctggaattgagatg 97625



to top

>gb|AC158363.2| Mus musculus BAC clone RP23-214J3 from chromosome 15, complete sequence
          Length = 228138

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 39     aaacatggcaaggttttcaa 58
              ||||||||||||||||||||
Sbjct: 104366 aaacatggcaaggttttcaa 104347



to top

>emb|AL773530.9| Mouse DNA sequence from clone RP23-180A8 on chromosome 2, complete
              sequence
          Length = 188424

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 249    cctgcttctgctctctcaca 268
              ||||||||||||||||||||
Sbjct: 123715 cctgcttctgctctctcaca 123734


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,593,334
Number of Sequences: 3902068
Number of extensions: 5593334
Number of successful extensions: 123434
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 123311
Number of HSP's gapped (non-prelim): 123
length of query: 613
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 590
effective length of database: 17,143,297,704
effective search space: 10114545645360
effective search space used: 10114545645360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top