| Clone Name | rbags3h12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_475262.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2568 Score = 268 bits (135), Expect = 2e-68 Identities = 202/227 (88%) Strand = Plus / Minus Query: 217 cctgtcgcggacgaggagctgcgtcctcgagtcgntgtaggccacgaagaaggtgagggc 276 ||||||||||||||||||||| ||||| |||||| ||||||| ||||||||||||||| | Sbjct: 417 cctgtcgcggacgaggagctgagtcctggagtcgatgtaggcgacgaagaaggtgaggac 358 Query: 277 gatgtcgacggcgaagaagatgtcgacgaccatgtcggccacctccagnnnnnnnttggg 336 |||||||||||||||||||| ||||||||| |||||||||||||| || ||||| Sbjct: 357 gatgtcgacggcgaagaagaggtcgacgacgatgtcggccacctcgaggccgcccttggg 298 Query: 337 cgaggcttccatgaaggccacctcgaacgggtacacccatgccgagtaggccaccaggat 396 ||| || | |||||| ||||||||||||||||||||||| |||||||| |||||||| | Sbjct: 297 cgacgcgttcatgaacgccacctcgaacgggtacacccacgccgagtacgccaccagcac 238 Query: 397 caccatgaacgtctcccagcacctgtatctggagtcgaggggcgaga 443 |||||||||||| |||||||||||||||||||||||||| ||||||| Sbjct: 237 caccatgaacgtgtcccagcacctgtatctggagtcgagaggcgaga 191 Score = 73.8 bits (37), Expect = 7e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 487 gccgagcggcggcagcatgagcttggacaggttccggaggttgaaggagcctgagcc 543 |||||| |||||||| ||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 132 gccgagaggcggcaggatgagcttggataggttccggaggttgaacgagccggagcc 76
>emb|AJ132686.1|ZMA132686 Zea mays mRNA for potassium channel protein ZMK2 (ZMK2 gene) Length = 2550 Score = 246 bits (124), Expect = 8e-62 Identities = 212/244 (86%) Strand = Plus / Minus Query: 206 gttatcctcttcctgtcgcggacgaggagctgcgtcctcgagtcgntgtaggccacgaag 265 |||||| |||||||||| |||||||||||||| ||||| |||| ||||||| |||||| Sbjct: 422 gttatcttcttcctgtcacggacgaggagctgggtcctgccgtcgatgtaggcaacgaag 363 Query: 266 aaggtgagggcgatgtcgacggcgaagaagatgtcgacgaccatgtcggccacctccagn 325 |||||||| | ||||||||||||||||||| ||| ||||| ||||| ||||||||||| Sbjct: 362 aaggtgagcactatgtcgacggcgaagaagaggtccacgacgatgtccgccacctccagc 303 Query: 326 nnnnnnttgggcgaggcttccatgaaggccacctcgaacgggtacacccatgccgagtag 385 ||||| || || | |||||||||||||||||||||||||||||| |||||||| Sbjct: 302 ccgcccttgggggacgcgttcatgaaggccacctcgaacgggtacacccacgccgagtac 243 Query: 386 gccaccaggatcaccatgaacgtctcccagcacctgtatctggagtcgaggggcgagacg 445 |||||||||| |||||||||||| ||||| |||||||||||||||||||| ||||||||| Sbjct: 242 gccaccaggaccaccatgaacgtatcccaccacctgtatctggagtcgagcggcgagacg 183 Query: 446 accc 449 |||| Sbjct: 182 accc 179 Score = 83.8 bits (42), Expect = 7e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 487 gccgagcggcggcagcatgagcttggacaggttccggaggttgaaggagcctgagccg 544 |||||||||||| || |||| |||||||||||||||||||||||||||||| |||||| Sbjct: 132 gccgagcggcgggaggatgaccttggacaggttccggaggttgaaggagccggagccg 75
>gb|AC130600.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0048I21, complete sequence Length = 137650 Score = 230 bits (116), Expect = 5e-57 Identities = 180/204 (88%) Strand = Plus / Plus Query: 217 cctgtcgcggacgaggagctgcgtcctcgagtcgntgtaggccacgaagaaggtgagggc 276 ||||||||||||||||||||| ||||| |||||| ||||||| ||||||||||||||| | Sbjct: 26885 cctgtcgcggacgaggagctgagtcctggagtcgatgtaggcgacgaagaaggtgaggac 26944 Query: 277 gatgtcgacggcgaagaagatgtcgacgaccatgtcggccacctccagnnnnnnnttggg 336 |||||||||||||||||||| ||||||||| |||||||||||||| || ||||| Sbjct: 26945 gatgtcgacggcgaagaagaggtcgacgacgatgtcggccacctcgaggccgcccttggg 27004 Query: 337 cgaggcttccatgaaggccacctcgaacgggtacacccatgccgagtaggccaccaggat 396 ||| || | |||||| ||||||||||||||||||||||| |||||||| |||||||| | Sbjct: 27005 cgacgcgttcatgaacgccacctcgaacgggtacacccacgccgagtacgccaccagcac 27064 Query: 397 caccatgaacgtctcccagcacct 420 |||||||||||| ||||||||||| Sbjct: 27065 caccatgaacgtgtcccagcacct 27088 Score = 73.8 bits (37), Expect = 7e-10 Identities = 52/57 (91%) Strand = Plus / Plus Query: 487 gccgagcggcggcagcatgagcttggacaggttccggaggttgaaggagcctgagcc 543 |||||| |||||||| ||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 27261 gccgagaggcggcaggatgagcttggataggttccggaggttgaacgagccggagcc 27317 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 417 acctgtatctggagtcgaggggcgaga 443 ||||||||||||||||||| ||||||| Sbjct: 27176 acctgtatctggagtcgagaggcgaga 27202
>gb|AC135429.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0636F09, complete sequence Length = 177374 Score = 230 bits (116), Expect = 5e-57 Identities = 180/204 (88%) Strand = Plus / Plus Query: 217 cctgtcgcggacgaggagctgcgtcctcgagtcgntgtaggccacgaagaaggtgagggc 276 ||||||||||||||||||||| ||||| |||||| ||||||| ||||||||||||||| | Sbjct: 155908 cctgtcgcggacgaggagctgagtcctggagtcgatgtaggcgacgaagaaggtgaggac 155967 Query: 277 gatgtcgacggcgaagaagatgtcgacgaccatgtcggccacctccagnnnnnnnttggg 336 |||||||||||||||||||| ||||||||| |||||||||||||| || ||||| Sbjct: 155968 gatgtcgacggcgaagaagaggtcgacgacgatgtcggccacctcgaggccgcccttggg 156027 Query: 337 cgaggcttccatgaaggccacctcgaacgggtacacccatgccgagtaggccaccaggat 396 ||| || | |||||| ||||||||||||||||||||||| |||||||| |||||||| | Sbjct: 156028 cgacgcgttcatgaacgccacctcgaacgggtacacccacgccgagtacgccaccagcac 156087 Query: 397 caccatgaacgtctcccagcacct 420 |||||||||||| ||||||||||| Sbjct: 156088 caccatgaacgtgtcccagcacct 156111 Score = 73.8 bits (37), Expect = 7e-10 Identities = 52/57 (91%) Strand = Plus / Plus Query: 487 gccgagcggcggcagcatgagcttggacaggttccggaggttgaaggagcctgagcc 543 |||||| |||||||| ||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 156284 gccgagaggcggcaggatgagcttggataggttccggaggttgaacgagccggagcc 156340 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 417 acctgtatctggagtcgaggggcgaga 443 ||||||||||||||||||| ||||||| Sbjct: 156199 acctgtatctggagtcgagaggcgaga 156225
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 230 bits (116), Expect = 5e-57 Identities = 180/204 (88%) Strand = Plus / Plus Query: 217 cctgtcgcggacgaggagctgcgtcctcgagtcgntgtaggccacgaagaaggtgagggc 276 ||||||||||||||||||||| ||||| |||||| ||||||| ||||||||||||||| | Sbjct: 20900107 cctgtcgcggacgaggagctgagtcctggagtcgatgtaggcgacgaagaaggtgaggac 20900166 Query: 277 gatgtcgacggcgaagaagatgtcgacgaccatgtcggccacctccagnnnnnnnttggg 336 |||||||||||||||||||| ||||||||| |||||||||||||| || ||||| Sbjct: 20900167 gatgtcgacggcgaagaagaggtcgacgacgatgtcggccacctcgaggccgcccttggg 20900226 Query: 337 cgaggcttccatgaaggccacctcgaacgggtacacccatgccgagtaggccaccaggat 396 ||| || | |||||| ||||||||||||||||||||||| |||||||| |||||||| | Sbjct: 20900227 cgacgcgttcatgaacgccacctcgaacgggtacacccacgccgagtacgccaccagcac 20900286 Query: 397 caccatgaacgtctcccagcacct 420 |||||||||||| ||||||||||| Sbjct: 20900287 caccatgaacgtgtcccagcacct 20900310 Score = 73.8 bits (37), Expect = 7e-10 Identities = 52/57 (91%) Strand = Plus / Plus Query: 487 gccgagcggcggcagcatgagcttggacaggttccggaggttgaaggagcctgagcc 543 |||||| |||||||| ||||||||||| ||||||||||||||||| ||||| ||||| Sbjct: 20900483 gccgagaggcggcaggatgagcttggataggttccggaggttgaacgagccggagcc 20900539 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 417 acctgtatctggagtcgaggggcgaga 443 ||||||||||||||||||| ||||||| Sbjct: 20900398 acctgtatctggagtcgagaggcgaga 20900424
>gb|AY109626.1| Zea mays CL1397_1 mRNA sequence Length = 2550 Score = 159 bits (80), Expect = 2e-35 Identities = 98/104 (94%) Strand = Plus / Minus Query: 346 catgaaggccacctcgaacgggtacacccatgccgagtaggccaccaggatcaccatgaa 405 |||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||| Sbjct: 282 catgaaggccacctcgaacgggtacacccacgccgagtacgccaccaggaccaccatgaa 223 Query: 406 cgtctcccagcacctgtatctggagtcgaggggcgagacgaccc 449 ||| ||||| |||||||||||||||||||| ||||||||||||| Sbjct: 222 cgtatcccaccacctgtatctggagtcgagcggcgagacgaccc 179 Score = 119 bits (60), Expect = 1e-23 Identities = 104/119 (87%) Strand = Plus / Minus Query: 206 gttatcctcttcctgtcgcggacgaggagctgcgtcctcgagtcgntgtaggccacgaag 265 |||||| |||||||||| |||||||||||||| ||||| |||| ||||||| |||||| Sbjct: 422 gttatcttcttcctgtcacggacgaggagctgggtcctgccgtcgatgtaggcaacgaag 363 Query: 266 aaggtgagggcgatgtcgacggcgaagaagatgtcgacgaccatgtcggccacctccag 324 |||||||| | ||||||||||||||||||| ||| ||||| ||||| ||||||||||| Sbjct: 362 aaggtgagcactatgtcgacggcgaagaagaggtccacgacgatgtccgccacctccag 304 Score = 65.9 bits (33), Expect = 2e-07 Identities = 36/37 (97%) Strand = Plus / Minus Query: 508 cttggacaggttccggaggttgaaggagcctgagccg 544 |||||||||||||||||||||||||||||| |||||| Sbjct: 111 cttggacaggttccggaggttgaaggagccggagccg 75
>ref|XM_476807.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2724 Score = 67.9 bits (34), Expect = 4e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 247 gtcgntgtaggccacgaagaaggtgagggcgatgtcgacggcgaagaag 295 |||| ||||||| |||||||||||||| |||||||||||||||||||| Sbjct: 381 gtcggtgtaggcgacgaagaaggtgagcacgatgtcgacggcgaagaag 333
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 67.9 bits (34), Expect = 4e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 247 gtcgntgtaggccacgaagaaggtgagggcgatgtcgacggcgaagaag 295 |||| ||||||| |||||||||||||| |||||||||||||||||||| Sbjct: 4002922 gtcggtgtaggcgacgaagaaggtgagcacgatgtcgacggcgaagaag 4002874
>dbj|AP003843.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1656_E11 Length = 116211 Score = 67.9 bits (34), Expect = 4e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 247 gtcgntgtaggccacgaagaaggtgagggcgatgtcgacggcgaagaag 295 |||| ||||||| |||||||||||||| |||||||||||||||||||| Sbjct: 105648 gtcggtgtaggcgacgaagaaggtgagcacgatgtcgacggcgaagaag 105600
>ref|NM_191783.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1782 Score = 56.0 bits (28), Expect = 2e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 257 gccacgaagaaggtgagggcgatgtcgacggcgaagaagatgtcgacgacca 308 ||||||||||||| || ||| |||||||||||||||||| |||||| |||| Sbjct: 257 gccacgaagaaggagacggcaatgtcgacggcgaagaaggcgtcgaccacca 206
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 56.0 bits (28), Expect = 2e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 257 gccacgaagaaggtgagggcgatgtcgacggcgaagaagatgtcgacgacca 308 ||||||||||||| || ||| |||||||||||||||||| |||||| |||| Sbjct: 29937520 gccacgaagaaggagacggcaatgtcgacggcgaagaaggcgtcgaccacca 29937469
>dbj|AP003453.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0480C01 Length = 151100 Score = 56.0 bits (28), Expect = 2e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 257 gccacgaagaaggtgagggcgatgtcgacggcgaagaagatgtcgacgacca 308 ||||||||||||| || ||| |||||||||||||||||| |||||| |||| Sbjct: 82078 gccacgaagaaggagacggcaatgtcgacggcgaagaaggcgtcgaccacca 82027
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 274 ggcgatgtcgacggcgaagaag 295 |||||||||||||||||||||| Sbjct: 11375270 ggcgatgtcgacggcgaagaag 11375249
>dbj|AP006164.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1386G10 Length = 121827 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 274 ggcgatgtcgacggcgaagaag 295 |||||||||||||||||||||| Sbjct: 62979 ggcgatgtcgacggcgaagaag 62958
>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence Length = 196951 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 124 ccacacccatccatgcctttg 144 ||||||||||||||||||||| Sbjct: 139274 ccacacccatccatgcctttg 139294
>ref|XM_381625.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01449.1) partial mRNA Length = 1455 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 291 agaagatgtcgacgaccatgt 311 ||||||||||||||||||||| Sbjct: 790 agaagatgtcgacgaccatgt 770
>gb|AY375160.1| Homo sapiens cardiomyopathy associated protein 1 (CMYA1) mRNA, complete cds Length = 6451 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 ctggctgaggctgtggccgag 492 ||||||||||||||||||||| Sbjct: 426 ctggctgaggctgtggccgag 446
>gb|AC092053.3| Homo sapiens chromosome 3 clone RP11-331G2, complete sequence Length = 176593 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 ctggctgaggctgtggccgag 492 ||||||||||||||||||||| Sbjct: 105921 ctggctgaggctgtggccgag 105941
>gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosome 9, complete sequence Length = 215002 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 124 ccacacccatccatgcctttg 144 ||||||||||||||||||||| Sbjct: 201023 ccacacccatccatgcctttg 201003
>emb|AJ626899.1| Homo sapiens mRNA for Xin B (CMYA1 gene) Length = 6047 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 ctggctgaggctgtggccgag 492 ||||||||||||||||||||| Sbjct: 434 ctggctgaggctgtggccgag 454
>emb|CR749430.1| Homo sapiens mRNA; cDNA DKFZp779C1947 (from clone DKFZp779C1947) Length = 6059 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 ctggctgaggctgtggccgag 492 ||||||||||||||||||||| Sbjct: 436 ctggctgaggctgtggccgag 456
>emb|AJ626900.1| Homo sapiens mRNA for Xin A (CMYA1 gene) Length = 6474 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 ctggctgaggctgtggccgag 492 ||||||||||||||||||||| Sbjct: 434 ctggctgaggctgtggccgag 454
>emb|BX648565.1|HSM808713 Homo sapiens mRNA; cDNA DKFZp779C1255 (from clone DKFZp779C1255) Length = 2075 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 ctggctgaggctgtggccgag 492 ||||||||||||||||||||| Sbjct: 436 ctggctgaggctgtggccgag 456
>gb|AF145272.1|AF145272 Samanea saman pulvinus inward-rectifying channel SPICK2 mRNA, complete cds Length = 2714 Score = 42.1 bits (21), Expect = 2.5 Identities = 51/61 (83%) Strand = Plus / Minus Query: 368 tacacccatgccgagtaggccaccaggatcaccatgaacgtctcccagcacctgtatctg 427 ||||||||||| || || ||||||| | |||||| || ||||||| |||||||||||| Sbjct: 368 tacacccatgctgaatatcccaccagcaccaccatcaaactctcccaacacctgtatctg 309 Query: 428 g 428 | Sbjct: 308 g 308
>ref|NM_194293.2| Homo sapiens cardiomyopathy associated 1 (CMYA1), mRNA Length = 6451 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 472 ctggctgaggctgtggccgag 492 ||||||||||||||||||||| Sbjct: 426 ctggctgaggctgtggccgag 446
>gb|AC101795.9| Mus musculus chromosome 5, clone RP24-201P24, complete sequence Length = 170688 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 132 atccatgcctttggctgcca 151 |||||||||||||||||||| Sbjct: 110334 atccatgcctttggctgcca 110353
>gb|BC101894.1| Rattus norvegicus RNA polymerase II associated protein 1, mRNA (cDNA clone MGC:124682 IMAGE:7930932), complete cds Length = 4700 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 731 tgctgcaatctcttgggcaa 712
>ref|NM_001033999.1| Rattus norvegicus RNA polymerase II associated protein 1 (Rpap1), mRNA Length = 4700 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 731 tgctgcaatctcttgggcaa 712
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 652 acgtatagctagctaattgg 671 |||||||||||||||||||| Sbjct: 62341 acgtatagctagctaattgg 62360
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 652 acgtatagctagctaattgg 671 |||||||||||||||||||| Sbjct: 125279 acgtatagctagctaattgg 125260
>ref|XM_712529.1| Candida albicans SC5314 karyopherin (CaO19_5085), mRNA Length = 3276 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 492 gcggcggcagcatgagcttg 511 |||||||||||||||||||| Sbjct: 1430 gcggcggcagcatgagcttg 1411
>ref|XM_712455.1| Candida albicans SC5314 karyopherin (CaO19_12551), mRNA Length = 3276 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 492 gcggcggcagcatgagcttg 511 |||||||||||||||||||| Sbjct: 1430 gcggcggcagcatgagcttg 1411
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 652 acgtatagctagctaattgg 671 |||||||||||||||||||| Sbjct: 28941984 acgtatagctagctaattgg 28941965
>ref|XM_390944.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG10768.1) partial mRNA Length = 1419 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 471 actggctgaggctgtggccgagcg 494 |||||||||||||| ||||||||| Sbjct: 1119 actggctgaggctgaggccgagcg 1142
>ref|XM_810687.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507615.90) partial mRNA Length = 6372 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 563 ctggccccgccgctgctgct 582 |||||||||||||||||||| Sbjct: 65 ctggccccgccgctgctgct 84
>emb|AJ699419.1| Gallus gallus mRNA for alpha-2,8-sialyltransferase (SIAT8B gene) Length = 1128 Score = 40.1 bits (20), Expect = 9.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 397 caccatgaacgtctcccagcacctgtat 424 ||||||||||||||| ||| |||||||| Sbjct: 393 caccatgaacgtctcgcagaacctgtat 420
>gb|AC161535.5| Mus musculus chromosome 5, clone RP23-26J13, complete sequence Length = 209259 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 132 atccatgcctttggctgcca 151 |||||||||||||||||||| Sbjct: 11572 atccatgcctttggctgcca 11591
>emb|AL160291.31| Human DNA sequence from clone RP11-85G18 on chromosome 10 Contains the 5' end of the YME1L1 gene for YME1-like 1 (S. cerevisiae), the gene for a novel protein kinase domain containing protein (FLJ14813), the gene for endozepine-related protein precursor (DKFZp434A2417) (FLJ32907 KIAA1996), a novel pseudogene (KIAA0563, FLJ34306), the 5' end of a novel pseudogene (FLJ10376) and six CpG islands, complete sequence Length = 155962 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 565 ggccccgccgctgctgctct 584 |||||||||||||||||||| Sbjct: 131449 ggccccgccgctgctgctct 131468
>emb|AL161630.12| Human DNA sequence from clone RP11-500B12 on chromosome 9 Contains a novel gene, a ribosomal protein L35a (RPL35A) and a CpG island. pseudogene, complete sequence Length = 200970 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tttatggaaatgagttgcat 183 |||||||||||||||||||| Sbjct: 21101 tttatggaaatgagttgcat 21120
>gb|AC131631.5| Rattus norvegicus 2 BAC CH230-16C23 (Children's Hospital Oakland Research Institute) complete sequence Length = 207805 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 ttatttatggaaatgagttg 180 |||||||||||||||||||| Sbjct: 93188 ttatttatggaaatgagttg 93169
>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11, complete sequence Length = 147806 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 569 ccgccgctgctgctcttgct 588 |||||||||||||||||||| Sbjct: 81253 ccgccgctgctgctcttgct 81234
>ref|NM_001001604.1| Gallus gallus ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 (ST8SIA2), mRNA Length = 1128 Score = 40.1 bits (20), Expect = 9.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 397 caccatgaacgtctcccagcacctgtat 424 ||||||||||||||| ||| |||||||| Sbjct: 393 caccatgaacgtctcgcagaacctgtat 420
>gb|AC103768.2| Homo sapiens chromosome 18, clone RP11-108G18, complete sequence Length = 180473 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 164 tttatggaaatgagttgcatgaaa 187 ||||||||||| |||||||||||| Sbjct: 11737 tttatggaaattagttgcatgaaa 11760
>gb|AC103774.2| Homo sapiens chromosome 18, clone RP11-177E16, complete sequence Length = 175384 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 164 tttatggaaatgagttgcatgaaa 187 ||||||||||| |||||||||||| Sbjct: 11372 tttatggaaattagttgcatgaaa 11395
>gb|AC104988.4| Homo sapiens chromosome 18, clone RP11-732E23, complete sequence Length = 171501 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 164 tttatggaaatgagttgcatgaaa 187 ||||||||||| |||||||||||| Sbjct: 161819 tttatggaaattagttgcatgaaa 161842
>dbj|AK154007.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430021H11 product:RNA polymerase II associated protein 1, full insert sequence Length = 4728 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 636 tgctgcaatctcttgggcaa 617
>dbj|AK171233.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630312L09 product:hypothetical ARM repeat fold containing protein, full insert sequence Length = 4080 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 609 tgctgcaatctcttgggcaa 590
>dbj|AK167589.1| Mus musculus 14 days pregnant adult female placenta cDNA, RIKEN full-length enriched library, clone:I530024D07 product:RNA polymerase II associated protein 1, full insert sequence Length = 4722 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 636 tgctgcaatctcttgggcaa 617
>dbj|AK166232.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN full-length enriched library, clone:G830022A06 product:RNA polymerase II associated protein 1, full insert sequence Length = 4724 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 636 tgctgcaatctcttgggcaa 617
>dbj|AK161487.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932441I04 product:RNA polymerase II associated protein 1, full insert sequence Length = 4715 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 713 tgctgcaatctcttgggcaa 694
>dbj|AK164658.1| Mus musculus 13 days embryo stomach cDNA, RIKEN full-length enriched library, clone:D530022E13 product:RNA polymerase II associated protein 1, full insert sequence Length = 4716 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 713 tgctgcaatctcttgggcaa 694
>gb|AC135056.4| Homo sapiens chromosome 17, clone RP13-650J16, complete sequence Length = 96066 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 121 cacccacacccatccatgcc 140 |||||||||||||||||||| Sbjct: 49831 cacccacacccatccatgcc 49850
>dbj|AK042776.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:A730023M06 product:hypothetical protein, full insert sequence Length = 1386 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 631 tgctgcaatctcttgggcaa 612
>dbj|AK089874.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830035L01 product:unclassifiable, full insert sequence Length = 2701 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 132 atccatgcctttggctgcca 151 |||||||||||||||||||| Sbjct: 1134 atccatgcctttggctgcca 1153
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 569 ccgccgctgctgctcttgct 588 |||||||||||||||||||| Sbjct: 28074027 ccgccgctgctgctcttgct 28074008
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 652 acgtatagctagctaattgg 671 |||||||||||||||||||| Sbjct: 29033406 acgtatagctagctaattgg 29033387
>gb|AC024104.15| Homo sapiens 3 BAC RP11-259I19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 37501 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 386 gccaccaggatcaccatgaa 405 |||||||||||||||||||| Sbjct: 13948 gccaccaggatcaccatgaa 13929
>dbj|AK122505.1| Mus musculus mRNA for mKIAA1403 protein Length = 4784 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 697 tgctgcaatctcttgggcaa 678
>gb|BC087676.1| Rattus norvegicus similar to RIKEN cDNA 8430406I07, mRNA (cDNA clone MGC:105769 IMAGE:7319345), complete cds Length = 2065 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 575 ctgctgctcttgctctggaa 594 |||||||||||||||||||| Sbjct: 404 ctgctgctcttgctctggaa 385
>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome Length = 1751377 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 384 aggccaccaggatcaccatg 403 |||||||||||||||||||| Sbjct: 432283 aggccaccaggatcaccatg 432302
>ref|NM_001009655.1| Rattus norvegicus similar to RIKEN cDNA 8430406I07 (RGD1307465), mRNA Length = 2065 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 575 ctgctgctcttgctctggaa 594 |||||||||||||||||||| Sbjct: 404 ctgctgctcttgctctggaa 385
>ref|NM_177294.3| Mus musculus RNA polymerase II associated protein 1 (Rpap1), mRNA Length = 4784 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 697 tgctgcaatctcttgggcaa 678
>emb|AL844536.13| Mouse DNA sequence from clone RP23-22A15 on chromosome 2, complete sequence Length = 245993 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 633 tgctgcaatctcttgggcaa 652 |||||||||||||||||||| Sbjct: 241761 tgctgcaatctcttgggcaa 241780
>dbj|AP004979.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT44L05, TM0162b, complete sequence Length = 30916 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 155 ttatgtttatttatggaaatgagt 178 |||| ||||||||||||||||||| Sbjct: 21749 ttatatttatttatggaaatgagt 21772
>dbj|AB022095.1| Streptomyces griseus genes for MelC1 and MelC2, complete and partial cds Length = 6100 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 gtcgcggacgaggagctgcg 239 |||||||||||||||||||| Sbjct: 507 gtcgcggacgaggagctgcg 488 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,893,298 Number of Sequences: 3902068 Number of extensions: 4893298 Number of successful extensions: 108109 Number of sequences better than 10.0: 65 Number of HSP's better than 10.0 without gapping: 65 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 107645 Number of HSP's gapped (non-prelim): 460 length of query: 709 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 686 effective length of database: 17,143,297,704 effective search space: 11760302224944 effective search space used: 11760302224944 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)