ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3h10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY036609.1| Triticum aestivum serine/threonine protein kinase... 121 5e-25
2gb|AC129623.4| Homo sapiens 12 BAC CTD-2107C6 (Cal Tech Human BA... 40 1.3
3gb|AC133796.2| Homo sapiens 3 BAC RP11-10I2 (Roswell Park Cancer... 40 1.3
4gb|AC074237.4| Homo sapiens chromosome 18, clone RP11-333K18, co... 40 1.3
5emb|AL391397.4|CNS06C87 Human chromosome 14 DNA sequence BAC R-6... 40 1.3
6gb|AC169509.1| Mus musculus BAC clone RP23-137L8 from chromosome... 38 5.3
7gb|AF196779.2| Homo sapiens chromosome X multiple clones map p11... 38 5.3
8gb|AC116484.12| Mus musculus chromosome 16, clone RP23-425F12, c... 38 5.3
9gb|AC154548.3| Mus musculus BAC clone RP23-437N23 from chromosom... 38 5.3
10emb|AL603845.11| Mouse DNA sequence from clone RP23-145C12 on ch... 38 5.3
11gb|AC116605.1| Homo sapiens chromosome 5 clone RP11-443O6, compl... 38 5.3
12gb|AC106762.2| Homo sapiens chromosome 5 clone RP11-218A1, compl... 38 5.3
13gb|AC106811.2| Homo sapiens chromosome 5 clone RP11-551B15, comp... 38 5.3
14dbj|AK141354.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 38 5.3
15gb|AC161423.1| Mus musculus BAC clone RP23-291E12 from chromosom... 38 5.3
16gb|AC022404.7|AC022404 Homo sapiens chromosome 14 clone CTD-2308... 38 5.3
17gb|AC131683.4| Mus musculus BAC clone RP23-359C21 from 16, compl... 38 5.3

>gb|AY036609.1| Triticum aestivum serine/threonine protein kinase mRNA, complete cds
          Length = 1805

 Score =  121 bits (61), Expect = 5e-25
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                        
Query: 1    tttctgcttctgtatcaaaagtattaatataannaatacatgggatttaacttctctcca 60
            |||||||||||||||||||||||||||||| |  ||||||||||||||||||||||||||
Sbjct: 1594 tttctgcttctgtatcaaaagtattaatatgataaatacatgggatttaacttctctcca 1535

                                                                   
Query: 61   aattgcnnnnnnnncttttgaattctgcctgccttagtctaaggtcatgggttgg 115
             |||||        ||  || ||||||||||| ||||||||||||||||||||||
Sbjct: 1534 gattgctttctcttctcctggattctgcctgctttagtctaaggtcatgggttgg 1480



to top

>gb|AC129623.4| Homo sapiens 12 BAC CTD-2107C6 (Cal Tech Human BAC Library D) complete
             sequence
          Length = 133581

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    tacatgggatttaacttctc 56
             ||||||||||||||||||||
Sbjct: 96939 tacatgggatttaacttctc 96958



to top

>gb|AC133796.2| Homo sapiens 3 BAC RP11-10I2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 125170

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    tatcaaaagtattaatataa 32
             ||||||||||||||||||||
Sbjct: 82418 tatcaaaagtattaatataa 82399



to top

>gb|AC074237.4| Homo sapiens chromosome 18, clone RP11-333K18, complete sequence
          Length = 181390

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    tacatgggatttaacttctc 56
             ||||||||||||||||||||
Sbjct: 71251 tacatgggatttaacttctc 71270



to top

>emb|AL391397.4|CNS06C87 Human chromosome 14 DNA sequence BAC R-625F13 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 165622

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     tgcttctgtatcaaaagtat 24
             ||||||||||||||||||||
Sbjct: 64611 tgcttctgtatcaaaagtat 64630



to top

>gb|AC169509.1| Mus musculus BAC clone RP23-137L8 from chromosome 16, complete sequence
          Length = 206061

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     cttctgtatcaaaagtatt 25
             |||||||||||||||||||
Sbjct: 12696 cttctgtatcaaaagtatt 12714



to top

>gb|AF196779.2| Homo sapiens chromosome X multiple clones map p11.23, complete sequence
          Length = 176767

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 46    tttaacttctctccaaatt 64
             |||||||||||||||||||
Sbjct: 14210 tttaacttctctccaaatt 14192



to top

>gb|AC116484.12| Mus musculus chromosome 16, clone RP23-425F12, complete sequence
          Length = 206793

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 7     cttctgtatcaaaagtatt 25
             |||||||||||||||||||
Sbjct: 25787 cttctgtatcaaaagtatt 25769



to top

>gb|AC154548.3| Mus musculus BAC clone RP23-437N23 from chromosome 13, complete
             sequence
          Length = 173722

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     tctgcttctgtatcaaaag 21
             |||||||||||||||||||
Sbjct: 50954 tctgcttctgtatcaaaag 50972



to top

>emb|AL603845.11| Mouse DNA sequence from clone RP23-145C12 on chromosome 11 Contains a
              ribosomal protein L7a (Rpl7a) pseudogene and the 3' end of
              the gene for a novel protein similar to Tensin Tns,
              complete sequence
          Length = 223491

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 79     tgaattctgcctgccttag 97
              |||||||||||||||||||
Sbjct: 192198 tgaattctgcctgccttag 192180



to top

>gb|AC116605.1| Homo sapiens chromosome 5 clone RP11-443O6, complete sequence
          Length = 164774

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 9      tctgtatcaaaagtattaa 27
              |||||||||||||||||||
Sbjct: 106336 tctgtatcaaaagtattaa 106318



to top

>gb|AC106762.2| Homo sapiens chromosome 5 clone RP11-218A1, complete sequence
          Length = 72568

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     tctgtatcaaaagtattaa 27
             |||||||||||||||||||
Sbjct: 69835 tctgtatcaaaagtattaa 69817



to top

>gb|AC106811.2| Homo sapiens chromosome 5 clone RP11-551B15, complete sequence
          Length = 148362

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     tctgtatcaaaagtattaa 27
             |||||||||||||||||||
Sbjct: 29435 tctgtatcaaaagtattaa 29417



to top

>dbj|AK141354.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:C430037J11
            product:unclassifiable, full insert sequence
          Length = 3113

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 46   tttaacttctctccaaatt 64
            |||||||||||||||||||
Sbjct: 1397 tttaacttctctccaaatt 1379



to top

>gb|AC161423.1| Mus musculus BAC clone RP23-291E12 from chromosome 16, complete sequence
          Length = 226870

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     tttaacttctctccaaatt 64
              |||||||||||||||||||
Sbjct: 147542 tttaacttctctccaaatt 147560



to top

>gb|AC022404.7|AC022404 Homo sapiens chromosome 14 clone CTD-2308C24 and RP11-757H14 map 14q31,
              complete sequence
          Length = 232309

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 10     ctgtatcaaaagtattaatataa 32
              ||||||||||| |||||||||||
Sbjct: 116306 ctgtatcaaaattattaatataa 116328



to top

>gb|AC131683.4| Mus musculus BAC clone RP23-359C21 from 16, complete sequence
          Length = 200615

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     tttaacttctctccaaatt 64
              |||||||||||||||||||
Sbjct: 183172 tttaacttctctccaaatt 183190


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,208,189
Number of Sequences: 3902068
Number of extensions: 1208189
Number of successful extensions: 75461
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75434
Number of HSP's gapped (non-prelim): 27
length of query: 115
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 94
effective length of database: 17,151,101,840
effective search space: 1612203572960
effective search space used: 1612203572960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top