ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY857762.1| Triticum monococcum peroxidase 8 (POX8) mRNA, com... 105 6e-20
2gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-6... 42 0.75
3gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete se... 42 0.75
4gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, c... 42 0.75
5gb|AY106338.1| Zea mays PCO074336 mRNA sequence 42 0.75
6gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 0.75
7ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical pro... 40 3.0
8gb|AC182808.1| Gasterosteus aculeatus clone VMRC28-105K03, compl... 40 3.0
9gb|AC113326.9| Mus musculus chromosome 1, clone RP23-454G7, comp... 40 3.0
10gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, co... 40 3.0

>gb|AY857762.1| Triticum monococcum peroxidase 8 (POX8) mRNA, complete cds
          Length = 1282

 Score =  105 bits (53), Expect = 6e-20
 Identities = 80/89 (89%)
 Strand = Plus / Minus

                                                                        
Query: 136  agtataggcgcgaacggacaccgactagccagcacgcccgtgcattggcattcaagcacg 195
            |||||| | |||||||||||||||| |||||||||||||||||||| ||||||||| |||
Sbjct: 1201 agtatacgtgcgaacggacaccgaccagccagcacgcccgtgcattcgcattcaaggacg 1142

                                         
Query: 196  cacacatcaggccatggcgaccttgtcgt 224
            || ||||||| || |||||||||| ||||
Sbjct: 1141 catacatcagcccttggcgaccttatcgt 1113



to top

>gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-64h15, complete
             sequence
          Length = 45758

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 34    ttattatttttgctcaattaa 54
             |||||||||||||||||||||
Sbjct: 12268 ttattatttttgctcaattaa 12288



to top

>gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete sequence
          Length = 124037

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 34    ttattatttttgctcaattaa 54
             |||||||||||||||||||||
Sbjct: 11525 ttattatttttgctcaattaa 11505



to top

>gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, complete sequence
          Length = 178059

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    tatttttgctcaattaacaac 58
             |||||||||||||||||||||
Sbjct: 79311 tatttttgctcaattaacaac 79291



to top

>gb|AY106338.1| Zea mays PCO074336 mRNA sequence
          Length = 849

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 87  gaaagggcatttcagcaaact 107
           |||||||||||||||||||||
Sbjct: 56  gaaagggcatttcagcaaact 36



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 189     aagcacgcacacatcaggcca 209
               |||||||||||||||||||||
Sbjct: 3726479 aagcacgcacacatcaggcca 3726459



to top

>ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical protein (PB103910.00.0)
            partial mRNA
          Length = 3190

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   attattatttttgctcaatt 52
            ||||||||||||||||||||
Sbjct: 1392 attattatttttgctcaatt 1373



to top

>gb|AC182808.1| Gasterosteus aculeatus clone VMRC28-105K03, complete sequence
          Length = 124886

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 81     ccatcggaaagggcatttca 100
              ||||||||||||||||||||
Sbjct: 120343 ccatcggaaagggcatttca 120324



to top

>gb|AC113326.9| Mus musculus chromosome 1, clone RP23-454G7, complete sequence
          Length = 192734

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     catgccacattattattttt 44
              ||||||||||||||||||||
Sbjct: 105697 catgccacattattattttt 105716



to top

>gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, complete sequence
          Length = 206197

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    aacacttgtacaagatggac 81
             ||||||||||||||||||||
Sbjct: 49033 aacacttgtacaagatggac 49052


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,436,982
Number of Sequences: 3902068
Number of extensions: 2436982
Number of successful extensions: 42841
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42822
Number of HSP's gapped (non-prelim): 19
length of query: 231
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 209
effective length of database: 17,147,199,772
effective search space: 3583764752348
effective search space used: 3583764752348
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top