ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3f16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X05576.1|HVTHIOR1 Barley mRNA for leaf-specific thionin (clo... 127 4e-27
2gb|L36882.1|BLYBTH6T Hordeum vulgare thionin (bth6) gene, comple... 127 4e-27
3gb|L36883.1|BLYBTH7T Hordeum vulgare thionin (BTH7) gene, comple... 119 9e-25
4emb|X05590.1|HVTHIOR5 Barley mRNA for leaf-specific thionin (clo... 119 9e-25
5emb|X05587.1|HVTHIOR2 Barley mRNA for leaf-specific thionin (clo... 119 9e-25
6gb|M19048.1|BLYTHNC Barley leaf specific thionin mRNA, complete ... 119 9e-25
7gb|M19047.1|BLYTHNB Barley leaf specific thionin mRNA, complete ... 119 9e-25
8gb|M19046.1|BLYTHNA Barley leaf specific thionin mRNA, complete ... 119 9e-25
9emb|X05589.1|HVTHIOR4 Barley mRNA for leaf-specific thionin (clo... 111 2e-22
10emb|X05588.1|HVTHIOR3 Barley mRNA for leaf-specific thionin (clo... 111 2e-22
11emb|AJ508712.1|HVU508712 Hordeum vulgare mRNA for putative thionin 100 8e-19
12emb|BX322615.6| Zebrafish DNA sequence from clone DKEY-81L20 in ... 40 0.67
13dbj|AB072341.1| Avena sativa mRNA for thionin Asthi4, complete cds 40 0.67
14gb|AC107868.9| Mus musculus chromosome 17, clone RP23-405A17, co... 38 2.6
15gb|AC113038.14| Mus musculus chromosome 17, clone RP23-228K17, c... 38 2.6
16gb|AC118232.10| Mus musculus chromosome 9, clone RP23-462C3, com... 38 2.6
17gb|AC161258.2| Mus musculus BAC clone RP23-457H24 from chromosom... 38 2.6
18emb|CR860756.1| Pongo pygmaeus mRNA; cDNA DKFZp459O016 (from clo... 38 2.6
19gb|AC010325.7| Homo sapiens chromosome 19 clone CTD-2568A17, com... 38 2.6
20emb|BX510352.17| Zebrafish DNA sequence from clone DKEY-96J11 in... 38 2.6

>emb|X05576.1|HVTHIOR1 Barley mRNA for leaf-specific thionin (clone DB4)
          Length = 637

 Score =  127 bits (64), Expect = 4e-27
 Identities = 64/64 (100%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 438 gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 379

               
Query: 65  gttg 68
           ||||
Sbjct: 378 gttg 375



to top

>gb|L36882.1|BLYBTH6T Hordeum vulgare thionin (bth6) gene, complete cds
          Length = 2406

 Score =  127 bits (64), Expect = 4e-27
 Identities = 64/64 (100%)
 Strand = Plus / Minus

                                                                        
Query: 5    gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2138 gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 2079

                
Query: 65   gttg 68
            ||||
Sbjct: 2078 gttg 2075



to top

>gb|L36883.1|BLYBTH7T Hordeum vulgare thionin (BTH7) gene, complete cds
          Length = 2259

 Score =  119 bits (60), Expect = 9e-25
 Identities = 63/64 (98%)
 Strand = Plus / Minus

                                                                        
Query: 5    gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 2161 gcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacgggcacatgc 2102

                
Query: 65   gttg 68
            ||||
Sbjct: 2101 gttg 2098



to top

>emb|X05590.1|HVTHIOR5 Barley mRNA for leaf-specific thionin (clone DD3)
          Length = 491

 Score =  119 bits (60), Expect = 9e-25
 Identities = 63/64 (98%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 304 gcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacgggcacatgc 245

               
Query: 65  gttg 68
           ||||
Sbjct: 244 gttg 241



to top

>emb|X05587.1|HVTHIOR2 Barley mRNA for leaf-specific thionin (clone DC4)
          Length = 658

 Score =  119 bits (60), Expect = 9e-25
 Identities = 63/64 (98%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 445 gcatgattaggcttcaacagactgaatgactgcaccatcattacaaaaacgggcacatgc 386

               
Query: 65  gttg 68
           ||||
Sbjct: 385 gttg 382



to top

>gb|M19048.1|BLYTHNC Barley leaf specific thionin mRNA, complete cds, clone pKG1940
          Length = 663

 Score =  119 bits (60), Expect = 9e-25
 Identities = 63/64 (98%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 463 gcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacgggcacatgc 404

               
Query: 65  gttg 68
           ||||
Sbjct: 403 gttg 400



to top

>gb|M19047.1|BLYTHNB Barley leaf specific thionin mRNA, complete cds, clone pKG1348
          Length = 608

 Score =  119 bits (60), Expect = 9e-25
 Identities = 63/64 (98%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 463 gcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacgggcacatgc 404

               
Query: 65  gttg 68
           ||||
Sbjct: 403 gttg 400



to top

>gb|M19046.1|BLYTHNA Barley leaf specific thionin mRNA, complete cds, clone pKG2872
          Length = 540

 Score =  119 bits (60), Expect = 9e-25
 Identities = 63/64 (98%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 463 gcatgattaggcttcaacagactgaatgacttcaccatcattacagaaacgggcacatgc 404

               
Query: 65  gttg 68
           ||||
Sbjct: 403 gttg 400



to top

>emb|X05589.1|HVTHIOR4 Barley mRNA for leaf-specific thionin (clone DG3)
          Length = 544

 Score =  111 bits (56), Expect = 2e-22
 Identities = 62/64 (96%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 390 gcatgattaggcttcaagagactgaatgacttcaccatcattacagaaacgggcacatgc 331

               
Query: 65  gttg 68
           ||||
Sbjct: 330 gttg 327



to top

>emb|X05588.1|HVTHIOR3 Barley mRNA for leaf-specific thionin (clone DF2)
          Length = 453

 Score =  111 bits (56), Expect = 2e-22
 Identities = 62/64 (96%)
 Strand = Plus / Minus

                                                                       
Query: 5   gcatgattaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgc 64
           ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 265 gcatgattaggattcaacagactgaatgactgcaccatcattacaaaaacgggcacatgc 206

               
Query: 65  gttg 68
           ||||
Sbjct: 205 gttg 202



to top

>emb|AJ508712.1|HVU508712 Hordeum vulgare mRNA for putative thionin
          Length = 414

 Score = 99.6 bits (50), Expect = 8e-19
 Identities = 56/58 (96%)
 Strand = Plus / Minus

                                                                     
Query: 11  ttaggcttcaacagactgaatgactgcaccatcattacagaaacgggcacatgcgttg 68
           ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||
Sbjct: 414 ttaggcttcaacagactgaatgacatcaccatcattacagaaacgggcacatgcgttg 357



to top

>emb|BX322615.6| Zebrafish DNA sequence from clone DKEY-81L20 in linkage group 17,
             complete sequence
          Length = 120315

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    aacagactgaatgactgcac 39
             ||||||||||||||||||||
Sbjct: 61583 aacagactgaatgactgcac 61602



to top

>dbj|AB072341.1| Avena sativa mRNA for thionin Asthi4, complete cds
          Length = 678

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 45  ttacagaaacgggcacatgcgttg 68
           |||||||||||| |||||||||||
Sbjct: 476 ttacagaaacggacacatgcgttg 453



to top

>gb|AC107868.9| Mus musculus chromosome 17, clone RP23-405A17, complete sequence
          Length = 193624

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     aatgactgcaccatcatta 47
              |||||||||||||||||||
Sbjct: 139396 aatgactgcaccatcatta 139378



to top

>gb|AC113038.14| Mus musculus chromosome 17, clone RP23-228K17, complete sequence
          Length = 226769

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 29     aatgactgcaccatcatta 47
              |||||||||||||||||||
Sbjct: 149335 aatgactgcaccatcatta 149353



to top

>gb|AC118232.10| Mus musculus chromosome 9, clone RP23-462C3, complete sequence
          Length = 192990

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 45     ttacagaaacgggcacatg 63
              |||||||||||||||||||
Sbjct: 120087 ttacagaaacgggcacatg 120069



to top

>gb|AC161258.2| Mus musculus BAC clone RP23-457H24 from chromosome 17, complete sequence
          Length = 201842

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     acagactgaatgactgcac 39
              |||||||||||||||||||
Sbjct: 188410 acagactgaatgactgcac 188428



to top

>emb|CR860756.1| Pongo pygmaeus mRNA; cDNA DKFZp459O016 (from clone DKFZp459O016)
          Length = 4585

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 17   ttcaacagactgaatgact 35
            |||||||||||||||||||
Sbjct: 3842 ttcaacagactgaatgact 3860



to top

>gb|AC010325.7| Homo sapiens chromosome 19 clone CTD-2568A17, complete sequence
          Length = 166439

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    ttcaacagactgaatgact 35
             |||||||||||||||||||
Sbjct: 41354 ttcaacagactgaatgact 41336



to top

>emb|BX510352.17| Zebrafish DNA sequence from clone DKEY-96J11 in linkage group 18,
             complete sequence
          Length = 152387

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    tcaacagactgaatgactg 36
             |||||||||||||||||||
Sbjct: 43952 tcaacagactgaatgactg 43934


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 387,838
Number of Sequences: 3902068
Number of extensions: 387838
Number of successful extensions: 27500
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27480
Number of HSP's gapped (non-prelim): 20
length of query: 68
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 47
effective length of database: 17,151,101,840
effective search space: 806101786480
effective search space used: 806101786480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top