>emb|AL589733.20| Human DNA sequence from clone RP11-164L23 on chromosome 6 Contains the
             5' end of a novel gene, the gene for HGC6.1.1 protein, the
             KNSL3 gene for kinesin-like 3, the gene for a novel
             protein and 5 CpG islands, complete sequence
          Length = 201088

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 179   agaaggtggggctgggctggg 199
             |||||||||||||||||||||
Sbjct: 85502 agaaggtggggctgggctggg 85482

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 183     ggtggggctgggctggggcag 203
               |||||||||||||||||||||
Sbjct: 2848467 ggtggggctgggctggggcag 2848447

>gb|AC084800.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-13A15, complete
             sequence
          Length = 213181

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   aaggtggggctgggctgggg 200
             ||||||||||||||||||||
Sbjct: 44499 aaggtggggctgggctgggg 44518

>gb|AC115880.11| Mus musculus chromosome 9, clone RP24-365N15, complete sequence
          Length = 202851

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   gaaggtggggctgggctggg 199
             ||||||||||||||||||||
Sbjct: 61427 gaaggtggggctgggctggg 61446

>emb|Y15994.1|HSMTM1 Homo sapiens 47kB DNA fragment from Xq28, proximal to MTM1 gene
          Length = 47300

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   aggtggggctgggctggggc 201
             ||||||||||||||||||||
Sbjct: 35141 aggtggggctgggctggggc 35160

>ref|XM_849105.1| PREDICTED: Canis familiaris hypothetical protein LOC611437
           (LOC611437), mRNA
          Length = 1126

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 184 gtggggctgggctggggcag 203
           ||||||||||||||||||||
Sbjct: 360 gtggggctgggctggggcag 341

>emb|AJ630366.1| Canis familiaris MHC class II region on chromosome CFA12, partial
             sequence, BAC clone 21p19, containing partial col11a2
             gene, RXRB, SLC39A7, HSD17B8, RING1, VPS52, RPS18 and
             B3GALT4 genes, C12H6orf11 ORF, KE2, RAB2L, TAPBP, ZNF297
             and DAXX genes
          Length = 143626

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   gaaggtggggctgggctggg 199
             ||||||||||||||||||||
Sbjct: 83158 gaaggtggggctgggctggg 83177

>gb|AC092980.5| Homo sapiens 3 BAC RP11-756L14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 136111

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 109   ggagcaaaattttattacagccaa 132
             |||||| |||||||||||||||||
Sbjct: 64511 ggagcacaattttattacagccaa 64534

>gb|AC118754.6| Homo sapiens, clone RP11-141J13, complete sequence
          Length = 185378

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   aggtggggctgggctggggc 201
             ||||||||||||||||||||
Sbjct: 85371 aggtggggctgggctggggc 85352

>gb|AF020663.1|HSMTM01 Homo sapiens myotubularin (MTM1) gene, promoter and exon 1
          Length = 4273

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 aggtggggctgggctggggc 201
           ||||||||||||||||||||
Sbjct: 895 aggtggggctgggctggggc 914

>gb|AC136957.1| Homo sapiens chromosome X clone RP11-477H13 map q28, complete sequence
          Length = 166719

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    aggtggggctgggctggggc 201
              ||||||||||||||||||||
Sbjct: 119248 aggtggggctgggctggggc 119267

>gb|AC109994.2| Homo sapiens chromosome X clone CTD-2537J14 map q28, complete sequence
          Length = 198434

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 182    aggtggggctgggctggggc 201
              ||||||||||||||||||||
Sbjct: 123519 aggtggggctgggctggggc 123538


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,241,186
Number of Sequences: 3902068
Number of extensions: 2241186
Number of successful extensions: 168110
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 168042
Number of HSP's gapped (non-prelim): 68
length of query: 218
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 196
effective length of database: 17,147,199,772
effective search space: 3360851155312
effective search space used: 3360851155312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)