Clone Name	rbags3e05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein,...	706	0.0
2	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	392	e-106
3	dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D...	392	e-106
4	dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clon...	392	e-106
5	dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clon...	392	e-106
6	dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clon...	385	e-103
7	gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps...	361	1e-96
8	gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA,...	347	2e-92
9	gb|BT016261.1| Zea mays clone Contig94 mRNA sequence	339	5e-90
10	gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds	337	2e-89
11	gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence	329	5e-87
12	ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predic...	252	1e-63
13	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	252	1e-63
14	dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic D...	252	1e-63
15	dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clon...	252	1e-63
16	ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predic...	246	6e-62
17	gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome...	246	6e-62
18	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	246	6e-62
19	dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clon...	246	6e-62
20	emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4	192	8e-46
21	gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4...	190	3e-45
22	emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Co...	170	3e-39
23	gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, comple...	168	1e-38
24	gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete s...	168	1e-38
25	ref|NM_001036769.1| Arabidopsis thaliana structural constituent ...	163	7e-37
26	ref|NM_120791.2| Arabidopsis thaliana structural constituent of ...	163	7e-37
27	gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal prote...	163	7e-37
28	gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal prote...	163	7e-37
29	emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, B...	163	7e-37
30	gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co...	163	7e-37
31	gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co...	163	7e-37
32	emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Co...	163	7e-37
33	emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Co...	163	7e-37
34	emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Co...	163	7e-37
35	gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete s...	163	7e-37
36	dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	163	7e-37
37	ref|NM_125228.3| Arabidopsis thaliana structural constituent of ...	157	4e-35
38	gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, comp...	157	4e-35
39	gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, comp...	157	4e-35
40	gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mR...	157	4e-35
41	emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Co...	157	4e-35
42	emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Co...	157	4e-35
43	emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Co...	157	4e-35
44	emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Co...	157	4e-35
45	emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Co...	157	4e-35
46	gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete s...	157	4e-35
47	dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	157	4e-35
48	emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Co...	149	1e-32
49	dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, com...	141	3e-30
50	emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Co...	141	3e-30
51	gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete s...	139	1e-29
52	ref|NM_127291.2| Arabidopsis thaliana structural constituent of ...	131	2e-27
53	gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S...	131	2e-27
54	gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S...	131	2e-27
55	gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, comple...	131	2e-27
56	gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA...	131	2e-27
57	emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Co...	131	2e-27
58	gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II sectio...	131	2e-27
59	emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal pro...	131	2e-27
60	gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal prot...	125	2e-25
61	emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Co...	123	6e-25
62	emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Co...	123	6e-25
63	emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal prote...	119	9e-24
64	emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
65	gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence	113	6e-22
66	emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Co...	88	3e-14
67	gb|AY769318.1| Bombyx mori ribosomal protein S4 (RpS4) mRNA, com...	72	2e-09
68	dbj|D21302.1|RICSS536 Oryza sativa SS536 mRNA for ribosomal prot...	72	2e-09
69	gb|AY110862.1| Zea mays CL1882_8 mRNA sequence	68	3e-08
70	ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hyp...	64	5e-07
71	emb|CR712301.2|CNS0GCK9 Tetraodon nigroviridis full-length cDNA	64	5e-07
72	emb|CR720218.2|CNS0GIO0 Tetraodon nigroviridis full-length cDNA	64	5e-07
73	emb|CR720216.2|CNS0GINY Tetraodon nigroviridis full-length cDNA	64	5e-07
74	emb|CR722715.2|CNS0GKLD Tetraodon nigroviridis full-length cDNA	64	5e-07
75	emb|CR721883.2|CNS0GJY9 Tetraodon nigroviridis full-length cDNA	64	5e-07
76	emb|CR720853.2|CNS0GJ5N Tetraodon nigroviridis full-length cDNA	64	5e-07
77	emb|CR720472.2|CNS0GIV2 Tetraodon nigroviridis full-length cDNA	64	5e-07
78	emb|CR719441.2|CNS0GI2F Tetraodon nigroviridis full-length cDNA	64	5e-07
79	emb|CR719306.2|CNS0GHYO Tetraodon nigroviridis full-length cDNA	64	5e-07
80	emb|CR717405.2|CNS0GGHV Tetraodon nigroviridis full-length cDNA	64	5e-07
81	emb|CR717315.2|CNS0GGFD Tetraodon nigroviridis full-length cDNA	64	5e-07
82	emb|CR716926.2|CNS0GG4N Tetraodon nigroviridis full-length cDNA	64	5e-07
83	emb|CR711409.2|CNS0GBVH Tetraodon nigroviridis full-length cDNA	64	5e-07
84	emb|CR714124.2|CNS0GDYW Tetraodon nigroviridis full-length cDNA	64	5e-07
85	emb|CR714283.2|CNS0GE3B Tetraodon nigroviridis full-length cDNA	64	5e-07
86	emb|CR712945.2|CNS0GD25 Tetraodon nigroviridis full-length cDNA	64	5e-07
87	emb|CR713157.2|CNS0GD81 Tetraodon nigroviridis full-length cDNA	64	5e-07
88	emb|CR710675.2|CNS0GBB3 Tetraodon nigroviridis full-length cDNA	64	5e-07
89	emb|CR710088.2|CNS0GAUS Tetraodon nigroviridis full-length cDNA	64	5e-07
90	emb|CR708708.2|CNS0G9SG Tetraodon nigroviridis full-length cDNA	64	5e-07
91	emb|CR707417.2|CNS0G8SL Tetraodon nigroviridis full-length cDNA	64	5e-07
92	emb|CR706939.2|CNS0G8FB Tetraodon nigroviridis full-length cDNA	64	5e-07
93	emb|CR704562.2|CNS0G6LA Tetraodon nigroviridis full-length cDNA	64	5e-07
94	emb|CR704014.2|CNS0G662 Tetraodon nigroviridis full-length cDNA	64	5e-07
95	emb|CR703820.2|CNS0G60O Tetraodon nigroviridis full-length cDNA	64	5e-07
96	emb|CR703584.2|CNS0G5U4 Tetraodon nigroviridis full-length cDNA	64	5e-07
97	emb|CR703489.2|CNS0G5RH Tetraodon nigroviridis full-length cDNA	64	5e-07
98	emb|CR702840.2|CNS0G59G Tetraodon nigroviridis full-length cDNA	64	5e-07
99	emb|CR702635.2|CNS0G53R Tetraodon nigroviridis full-length cDNA	64	5e-07
100	emb|CR702209.2|CNS0G4RX Tetraodon nigroviridis full-length cDNA	64	5e-07
101	emb|CR702145.2|CNS0G4Q5 Tetraodon nigroviridis full-length cDNA	64	5e-07
102	emb|CR700232.2|CNS0G390 Tetraodon nigroviridis full-length cDNA	64	5e-07
103	emb|CR697958.2|CNS0G1HU Tetraodon nigroviridis full-length cDNA	64	5e-07
104	emb|CR697195.2|CNS0G0WN Tetraodon nigroviridis full-length cDNA	64	5e-07
105	emb|CR697018.2|CNS0G0RQ Tetraodon nigroviridis full-length cDNA	64	5e-07
106	emb|CR696565.2|CNS0G0F5 Tetraodon nigroviridis full-length cDNA	64	5e-07
107	emb|CR696312.2|CNS0G084 Tetraodon nigroviridis full-length cDNA	64	5e-07
108	emb|CR694977.2|CNS0FZ71 Tetraodon nigroviridis full-length cDNA	64	5e-07
109	emb|CR694101.2|CNS0FYIP Tetraodon nigroviridis full-length cDNA	64	5e-07
110	emb|CR693396.2|CNS0FXZ4 Tetraodon nigroviridis full-length cDNA	64	5e-07
111	emb|CR691738.2|CNS0FWP2 Tetraodon nigroviridis full-length cDNA	64	5e-07
112	emb|CR688407.2|CNS0FU4J Tetraodon nigroviridis full-length cDNA	64	5e-07
113	emb|CR689769.2|CNS0FV6D Tetraodon nigroviridis full-length cDNA	64	5e-07
114	emb|CR687727.2|CNS0FTLN Tetraodon nigroviridis full-length cDNA	64	5e-07
115	emb|CR686869.2|CNS0FSXT Tetraodon nigroviridis full-length cDNA	64	5e-07
116	emb|CR685258.2|CNS0FRP2 Tetraodon nigroviridis full-length cDNA	64	5e-07
117	emb|CR685076.2|CNS0FRK0 Tetraodon nigroviridis full-length cDNA	64	5e-07
118	emb|CR684709.2|CNS0FR9T Tetraodon nigroviridis full-length cDNA	64	5e-07
119	emb|CR684226.2|CNS0FQWE Tetraodon nigroviridis full-length cDNA	64	5e-07
120	emb|CR683325.2|CNS0FQ7D Tetraodon nigroviridis full-length cDNA	64	5e-07
121	emb|CR682942.2|CNS0FPWQ Tetraodon nigroviridis full-length cDNA	64	5e-07
122	emb|CR682258.2|CNS0FPDQ Tetraodon nigroviridis full-length cDNA	64	5e-07
123	emb|CR681455.2|CNS0FORF Tetraodon nigroviridis full-length cDNA	64	5e-07
124	emb|CR681050.2|CNS0FOG6 Tetraodon nigroviridis full-length cDNA	64	5e-07
125	emb|CR680145.2|CNS0FNR1 Tetraodon nigroviridis full-length cDNA	64	5e-07
126	emb|CR676429.2|CNS0FKW9 Tetraodon nigroviridis full-length cDNA	64	5e-07
127	emb|CR675710.2|CNS0FKCK Tetraodon nigroviridis full-length cDNA	64	5e-07
128	emb|CR673595.2|CNS0FIPT Tetraodon nigroviridis full-length cDNA	64	5e-07
129	emb|CR670866.2|CNS0FGM0 Tetraodon nigroviridis full-length cDNA	64	5e-07
130	emb|CR669893.2|CNS0FFUZ Tetraodon nigroviridis full-length cDNA	64	5e-07
131	emb|CR669083.2|CNS0FF8H Tetraodon nigroviridis full-length cDNA	64	5e-07
132	emb|CR663251.2|CNS0FAQH Tetraodon nigroviridis full-length cDNA	64	5e-07
133	emb|CR659804.2|CNS0F82Q Tetraodon nigroviridis full-length cDNA	64	5e-07
134	emb|CR659262.2|CNS0F7NO Tetraodon nigroviridis full-length cDNA	64	5e-07
135	emb|CR658566.2|CNS0F74C Tetraodon nigroviridis full-length cDNA	64	5e-07
136	emb|CR657212.2|CNS0F62Q Tetraodon nigroviridis full-length cDNA	64	5e-07
137	emb|CR656191.2|CNS0F5AD Tetraodon nigroviridis full-length cDNA	64	5e-07
138	emb|CR655155.2|CNS0F4HL Tetraodon nigroviridis full-length cDNA	64	5e-07
139	emb|CR654105.2|CNS0F3OF Tetraodon nigroviridis full-length cDNA	64	5e-07
140	emb|CR652992.2|CNS0F2TI Tetraodon nigroviridis full-length cDNA	64	5e-07
141	emb|CR651314.2|CNS0F1IW Tetraodon nigroviridis full-length cDNA	64	5e-07
142	emb|CR647718.2|CNS0EYR0 Tetraodon nigroviridis full-length cDNA	64	5e-07
143	emb|CR646899.2|CNS0EY49 Tetraodon nigroviridis full-length cDNA	64	5e-07
144	emb|CR645541.2|CNS0EX2J Tetraodon nigroviridis full-length cDNA	64	5e-07
145	emb|CR644913.2|CNS0EWL3 Tetraodon nigroviridis full-length cDNA	64	5e-07
146	emb|CR642563.2|CNS0EURT Tetraodon nigroviridis full-length cDNA	64	5e-07
147	emb|CR642362.2|CNS0EUM8 Tetraodon nigroviridis full-length cDNA	64	5e-07
148	emb|CR641651.2|CNS0EU2H Tetraodon nigroviridis full-length cDNA	64	5e-07
149	emb|CR641329.2|CNS0ETTJ Tetraodon nigroviridis full-length cDNA	64	5e-07
150	emb|CR641017.2|CNS0ETKV Tetraodon nigroviridis full-length cDNA	64	5e-07
151	emb|CR639635.2|CNS0ESIH Tetraodon nigroviridis full-length cDNA	64	5e-07
152	emb|CR638530.2|CNS0ERNS Tetraodon nigroviridis full-length cDNA	64	5e-07
153	emb|CR637949.2|CNS0ER7N Tetraodon nigroviridis full-length cDNA	64	5e-07
154	emb|CR636021.2|CNS0EPQ3 Tetraodon nigroviridis full-length cDNA	64	5e-07
155	emb|CR634987.2|CNS0EOXD Tetraodon nigroviridis full-length cDNA	64	5e-07
156	emb|CR634338.2|CNS0EOFC Tetraodon nigroviridis full-length cDNA	64	5e-07
157	gb|AY190741.1| Pagrus major 40S ribosomal protein S4 mRNA, parti...	62	2e-06
158	gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA	60	7e-06
159	emb|CR696954.2|CNS0G0PY Tetraodon nigroviridis full-length cDNA	60	7e-06
160	ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG...	60	7e-06
161	ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG...	60	7e-06
162	gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell ...	60	7e-06
163	gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46...	60	7e-06
164	dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribos...	60	7e-06
165	gb|AY130367.1| Petromyzon marinus ribosomal protein S4-like mRNA...	58	3e-05
166	dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	58	3e-05
167	ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothe...	56	1e-04
168	emb|CR671087.2|CNS0FGS5 Tetraodon nigroviridis full-length cDNA	56	1e-04
169	gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-lik...	56	1e-04
170	gb|BT018605.1| Zea mays clone EL01N0450E04.d mRNA sequence	54	5e-04
171	gb|DQ066214.1| Ixodes scapularis isolate ISUFL21 ribosomal prote...	54	5e-04
172	ref|XM_521131.1| PREDICTED: Pan troglodytes similar to 40S ribos...	52	0.002
173	gb|AY389947.1| Latimeria chalumnae ribosomal protein S4 mRNA, pa...	52	0.002
174	gb|BC000472.2| Homo sapiens ribosomal protein S4, X-linked, mRNA...	52	0.002
175	gb|BC007308.1| Homo sapiens ribosomal protein S4, X-linked, mRNA...	52	0.002
176	gb|BC000236.1| Homo sapiens translin-associated factor X, mRNA (...	52	0.002
177	ref|NM_001007.3| Homo sapiens ribosomal protein S4, X-linked (RP...	52	0.002
178	gb|BC100904.1| Homo sapiens ribosomal protein S4, X-linked, mRNA...	52	0.002
179	gb|BC100903.1| Homo sapiens ribosomal protein S4, X-linked, mRNA...	52	0.002
180	emb|AL135749.3|HSN14 Homo sapiens chromosome X sequence from BAC...	52	0.002
181	emb|CR601794.1| full-length cDNA clone CS0DI031YB06 of Placenta ...	52	0.002
182	emb|CR623958.1| full-length cDNA clone CS0DE004YB10 of Placenta ...	52	0.002
183	emb|CR620411.1| full-length cDNA clone CS0DE011YG15 of Placenta ...	52	0.002
184	dbj|AK097914.1| Homo sapiens cDNA FLJ40595 fis, clone THYMU20107...	52	0.002
185	emb|CR597791.1| full-length cDNA clone CS0DI068YM24 of Placenta ...	52	0.002
186	emb|CR595707.1| full-length cDNA clone CL0BB017ZH01 of Neuroblas...	52	0.002
187	emb|CR456735.1| Homo sapiens full open reading frame cDNA clone ...	52	0.002
188	dbj|AK222479.1| Homo sapiens mRNA for ribosomal protein S4, X-li...	52	0.002
189	gb|BC071662.1| Homo sapiens ribosomal protein S4, X-linked, mRNA...	52	0.002
190	gb|AF041428.1|AF041428 Homo sapiens ribosomal protein s4 X isofo...	52	0.002
191	gb|M58458.1|HUMRPS4X Human ribosomal protein S4 (RPS4X) isoform ...	52	0.002
192	gb|M22146.1|HUMSCAR Human scar protein mRNA, complete cds	52	0.002
193	dbj|AB024285.1| Macaca fuscata mRNA for ribosomal protein S4X (R...	52	0.002
194	dbj|D50104.1| Macaca fuscata mRNA for ribosomal protein S4, part...	52	0.002
195	dbj|AB015610.1| Chlorocebus aethiops mRNA for ribosomal protein ...	52	0.002
196	gb|AC024780.1| Caenorhabditis elegans cosmid Y43B11AR, complete ...	50	0.007
197	ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predi...	50	0.007
198	ref|NM_068702.2| Caenorhabditis elegans Ribosomal Protein, Small...	50	0.007
199	gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 ...	50	0.007
200	emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1...	50	0.007
201	gb|BC047994.1| Mus musculus RIKEN cDNA 1110033J19 gene, mRNA (cD...	48	0.029
202	gb|AC126683.4| Mus musculus BAC clone RP23-62G15 from 6, complet...	48	0.029
203	ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.029
204	gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putat...	48	0.029
205	dbj|AK132160.1| Mus musculus 17 days embryo head cDNA, RIKEN ful...	48	0.029
206	dbj|AK012382.1| Mus musculus 11 days embryo whole body cDNA, RIK...	48	0.029
207	dbj|AK004068.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	48	0.029
208	gb|BC028445.1| Mus musculus, clone IMAGE:963029, mRNA	48	0.029
209	gb|AC142274.3| Mus musculus BAC clone RP23-251M14 from 6, comple...	48	0.029
210	ref|NM_025405.2| Mus musculus RIKEN cDNA 1110033J19 gene (111003...	48	0.029
211	gb|AY224232.1|AY224229S4 Pongo pygmaeus ribosomal protein S4 (RP...	46	0.11
212	ref|XM_591678.2| PREDICTED: Bos taurus ribosomal protein S4, X-l...	44	0.44
213	ref|XM_537399.2| PREDICTED: Canis familiaris similar to 40S ribo...	44	0.44
214	emb|BX067601.1|CNS09OBP Single read from an extremity of a full-...	44	0.44
215	emb|BX067600.1|CNS09OBO Single read from an extremity of a full-...	44	0.44
216	ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.44
217	gb|AC008087.11| Homo sapiens chromosome 17, clone RP5-1127L24, c...	44	0.44
218	gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gen...	44	0.44
219	gb|AC084630.1|CBRG45E13 Caenorhabditis briggsae cosmid G45E13, c...	44	0.44
220	gb|AF429978.1| Spodoptera frugiperda ribosomal protein S4 mRNA, ...	44	0.44
221	gb|AC027455.22| Homo sapiens chromosome 17, clone RP11-411G7, co...	44	0.44
222	dbj|D50109.1| Equus caballus mRNA for ribosomal protein S4, part...	44	0.44
223	dbj|D50107.1| Bos taurus mRNA for ribosomal protein S4, partial cds	44	0.44
224	gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic sma...	42	1.8
225	gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribo...	42	1.8
226	gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein ...	42	1.8
227	ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical prote...	42	1.8
228	ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small rib...	42	1.8
229	emb|AM048930.1| Mycetophagus quadripustulatus mRNA for ribosomal...	42	1.8
230	emb|CR938551.1| Single read from an extremity of a full-length c...	42	1.8
231	emb|CR938407.1| Single read from an extremity of a full-length c...	42	1.8
232	emb|CR938406.1| Single read from an extremity of a full-length c...	42	1.8
233	emb|CR938380.1| Single read from an extremity of a full-length c...	42	1.8
234	emb|CR938366.1| Single read from an extremity of a full-length c...	42	1.8
235	gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete s...	42	1.8
236	dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020	42	1.8
237	gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA ...	40	6.9
238	ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1...	40	6.9
239	gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	6.9
240	gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, com...	40	6.9
241	gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence	40	6.9
242	gb|AF359361.3| Gibberella zeae strain GZ3639 trichothecene gene ...	40	6.9
243	gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ...	40	6.9
244	ref|XM_383708.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	40	6.9
245	ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 h...	40	6.9
246	gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome...	40	6.9
247	ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (...	40	6.9
248	gb|AY231807.1| Drosophila yakuba clone yak-em_RpS4 mRNA sequence	40	6.9
249	gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRN...	40	6.9
250	emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227...	40	6.9
251	emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chrom...	40	6.9
252	ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predi...	40	6.9
253	emb|BX066422.1|CNS09NEY Single read from an extremity of a full-...	40	6.9
254	emb|BX055169.1|CNS09EQD Single read from an extremity of a full-...	40	6.9
255	ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypoth...	40	6.9
256	emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clo...	40	6.9
257	emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 i...	40	6.9
258	gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, com...	40	6.9
259	gb|AF336366.2| Gibberella zeae H-11 trichothecene biosynthesis g...	40	6.9
260	gb|AY857461.1| Suberites domuncula S4 mRNA, complete cds	40	6.9
261	emb|CR391662.1| Gallus gallus finished cDNA, clone ChEST418k16	40	6.9
262	emb|BX934312.1| Gallus gallus finished cDNA, clone ChEST670k21	40	6.9
263	emb|BX930717.1| Gallus gallus finished cDNA, clone ChEST374l2	40	6.9
264	ref|NM_205108.1| Gallus gallus ribosomal protein S4 (LOC396001),...	40	6.9
265	dbj|D25237.1|RICSS620B Oryza sativa SS620 mRNA for scar protein,...	40	6.9
266	dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21,...	40	6.9
267	emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1...	40	6.9
268	gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein ...	40	6.9
269	gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosom...	40	6.9
270	dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	40	6.9
271	gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple...	40	6.9
272	gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, com...	40	6.9
273	gb|L24368.1|CHKRPS4A Gallus gallus (clone pDP1435) domesticus ri...	40	6.9
274	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	40	6.9
275	emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-6...	40	6.9
276	dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL...	40	6.9
277	dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, co...	40	6.9
278	dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21...	40	6.9
279	dbj|D50110.1| Porcine mRNA for ribosomal protein S4, partial cds	40	6.9
280	dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related...	40	6.9

---

>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds
          Length = 1053

 Score =  706 bits (356), Expect = 0.0
 Identities = 475/514 (92%), Gaps = 2/514 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    cattacatctagcagacatccatgggttcgcaaatcaacaaacatcaggcaaaacttaaa 60
            ||||||||||||||| || |||||||||| ||| |||||||||||||||||||| |||||
Sbjct: 1026 cattacatctagcag-caaccatgggttcacaattcaacaaacatcaggcaaaatttaaa 968

                                                                        
Query: 61   aaagatggttccaggaacatagttctatatccttgcagataactggctatagcaaaacga 120
            || ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 967  aacgatggttccagaaacatagttctatatcctt-cagataactggctatagcaaaacga 909

                                                                        
Query: 121  ctcaatgcctcagaatcaggccttggcagcagcctgagctgcggcatccctcttcctctg 180
             |||| |||||||||||||||||||||||| ||||| || ||||||||||||||||||||
Sbjct: 908  atcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccctcttcctctg 849

                                                                        
Query: 181  ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnnanggcttggt 240
            ||||||||||||||| ||||||||||| ||||||||||||||| |||   | ||||||||
Sbjct: 848  ctcctcaatgatggtcagcttgatacctttgcccttggggagggtcacccacggcttggt 789

                                                                        
Query: 241  gcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccctgggcatc 300
            ||||||||| ||||||||||| ||||| ||||||||||| |||||| ||||||| |||||
Sbjct: 788  gcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgaccctgagcatc 729

                                                                        
Query: 301  ctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 360
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 728  ctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgatcacaccaac 669

                                                                        
Query: 361  acgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaa 420
            ||| |||||||| ||||||||||| |||||||| || ||||| || ||||||||||||||
Sbjct: 668  acggccagtgttacgcccaccagtaaccatgacaacattgccaacatcaaacttgatgaa 609

                                                                        
Query: 421  gtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgg 480
            ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 608  gtcaacaatcttgttggtctccaggtcgagcttgatggtgtcattggccttgatgagtgg 549

                                              
Query: 481  gtctgggtagcggatggtgcggccatcataggtg 514
            ||| ||||||||||||||||| ||||||| ||||
Sbjct: 548  gtcagggtagcggatggtgcgaccatcattggtg 515

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score =  392 bits (198), Expect = e-106
 Identities = 327/372 (87%)
 Strand = Plus / Plus

                                                                          
Query: 143    ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
              |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026

                                                                          
Query: 203    atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
              || |||||||||||||| |||||||   | |||||| |||||||||||||||||||||| 
Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086

                                                                          
Query: 263    ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
              ||||||||||||||||| || ||| | ||| ||||||||||||||||||||||||| |||
Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146

                                                                          
Query: 323    gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
               | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 317206

                                                                          
Query: 383    gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
              ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 317207 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 317266

                                                                          
Query: 443    aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
              || |||| |||||| |||||  | ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 317267 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 317326

                          
Query: 503    ccatcataggtg 514
              ||||||||||||
Sbjct: 317327 ccatcataggtg 317338



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 79     atagttctatatccttgcagataactggctatagcaaaac 118
              ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935

---

>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score =  392 bits (198), Expect = e-106
 Identities = 327/372 (87%)
 Strand = Plus / Plus

                                                                         
Query: 143   ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
             |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810

                                                                         
Query: 203   atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
             || |||||||||||||| |||||||   | |||||| |||||||||||||||||||||| 
Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870

                                                                         
Query: 263   ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
             ||||||||||||||||| || ||| | ||| ||||||||||||||||||||||||| |||
Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930

                                                                         
Query: 323   gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
              | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 45990

                                                                         
Query: 383   gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
             ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 45991 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 46050

                                                                         
Query: 443   aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
             || |||| |||||| |||||  | ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 46051 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 46110

                         
Query: 503   ccatcataggtg 514
             ||||||||||||
Sbjct: 46111 ccatcataggtg 46122



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 79    atagttctatatccttgcagataactggctatagcaaaac 118
             ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719

---

>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full
           insert sequence
          Length = 1016

 Score =  392 bits (198), Expect = e-106
 Identities = 327/372 (87%)
 Strand = Plus / Minus

                                                                       
Query: 143 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827

                                                                       
Query: 203 atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
           || |||||||||||||| |||||||   | |||||| |||||||||||||||||||||| 
Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767

                                                                       
Query: 263 ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
           ||||||||||||||||| || ||| | ||| ||||||||||||||||||||||||| |||
Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707

                                                                       
Query: 323 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 647

                                                                       
Query: 383 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
           ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 646 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 587

                                                                       
Query: 443 aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           || |||| |||||| |||||  | ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 586 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 527

                       
Query: 503 ccatcataggtg 514
           ||||||||||||
Sbjct: 526 ccatcataggtg 515



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 79  atagttctatatccttgcagataactggctatagcaaaac 118
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918

---

>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full
           insert sequence
          Length = 1157

 Score =  392 bits (198), Expect = e-106
 Identities = 327/372 (87%)
 Strand = Plus / Minus

                                                                       
Query: 143 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831

                                                                       
Query: 203 atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
           || |||||||||||||| |||||||   | |||||| |||||||||||||||||||||| 
Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771

                                                                       
Query: 263 ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
           ||||||||||||||||| || ||| | ||| ||||||||||||||||||||||||| |||
Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711

                                                                       
Query: 323 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 651

                                                                       
Query: 383 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
           ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 650 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 591

                                                                       
Query: 443 aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           || |||| |||||| |||||  | ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 590 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 531

                       
Query: 503 ccatcataggtg 514
           ||||||||||||
Sbjct: 530 ccatcataggtg 519



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 79  atagttctatatccttgcagataactggctatagcaaaac 118
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922

---

>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full
           insert sequence
          Length = 1079

 Score =  385 bits (194), Expect = e-103
 Identities = 326/372 (87%)
 Strand = Plus / Minus

                                                                       
Query: 143 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823

                                                                       
Query: 203 atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
           || |||||||||||||| |||||||   | |||||| |||||||||||||||||||||  
Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763

                                                                       
Query: 263 ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
           ||||||||||||||||| || ||| | ||| ||||||||||||||||||||||||| |||
Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703

                                                                       
Query: 323 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 643

                                                                       
Query: 383 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
           ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 642 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 583

                                                                       
Query: 443 aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           || |||| |||||| |||||  | ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 582 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 523

                       
Query: 503 ccatcataggtg 514
           ||||||||||||
Sbjct: 522 ccatcataggtg 511



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 79  atagttctatatccttgcagataactggctatagcaaaac 118
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914

---

>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds
          Length = 1013

 Score =  361 bits (182), Expect = 1e-96
 Identities = 320/368 (86%)
 Strand = Plus / Minus

                                                                       
Query: 143 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805

                                                                       
Query: 203 atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
           || |||||||||||||| |||||||   | |||||  | |||||||| ||||||||||||
Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745

                                                                       
Query: 263 ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
           ||||||| ||||||||| |||||| | ||| |||  ||||| ||||| ||||||||||||
Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685

                                                                       
Query: 323 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
            | ||||| |||||||||||||||||||| ||||| || || |||||||| |  || |||
Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacccacgcggccagtgttccttccgcca 625

                                                                       
Query: 383 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
           |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 624 gtcaccatgacgacgttgccaacatcaaacttgatgaagtccacaatcttgttggtctcc 565

                                                                       
Query: 443 aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           || |||| ||||||||||||  ||||||||||||| ||||| ||||||||||||||||||
Sbjct: 564 agatcgatcttgatggtgtcgttggccttgatgagggggtcagggtagcggatggtgcgg 505

                   
Query: 503 ccatcata 510
           || |||||
Sbjct: 504 ccgtcata 497



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 75  gaacatagttctatatccttgcaga 99
           |||||| ||||||||||||||||||
Sbjct: 936 gaacattgttctatatccttgcaga 912

---

>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds
          Length = 1090

 Score =  347 bits (175), Expect = 2e-92
 Identities = 298/341 (87%)
 Strand = Plus / Minus

                                                                       
Query: 174 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnnang 233
           ||||||||||||| |||||| ||||||||||||||||||||||||| |||||||   | |
Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785

                                                                       
Query: 234 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccct 293
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||| | ||| 
Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725

                                                                       
Query: 294 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 353
            ||  ||||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665

                                                                       
Query: 354 caccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaact 413
           |||| |||||||| ||||| | ||| || ||||||||||| |||||||||||||||||||
Sbjct: 664 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgccgacgtcaaact 605

                                                                       
Query: 414 tgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggccttga 473
           |||||||||| |  ||||||||||||||||| |||| ||||||||||||  |||||||||
Sbjct: 604 tgatgaagtccatgatcttgttggtctccagatcgatcttgatggtgtcgttggccttga 545

                                                    
Query: 474 tgagtgggtctgggtagcggatggtgcggccatcataggtg 514
           |||| ||||| |||||||||||||||||||| || ||||||
Sbjct: 544 tgagcgggtcggggtagcggatggtgcggccgtcgtaggtg 504

---

>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence
          Length = 1116

 Score =  339 bits (171), Expect = 5e-90
 Identities = 297/341 (87%)
 Strand = Plus / Minus

                                                                       
Query: 174 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnnang 233
           ||||||||||||| |||||| ||||||||||||||||||||||||| |||||||   | |
Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806

                                                                       
Query: 234 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccct 293
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||| | ||| 
Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746

                                                                       
Query: 294 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 353
            ||  ||||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686

                                                                       
Query: 354 caccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaact 413
           |||| |||||||| ||||| | ||| || ||||||||||| |||||||||||||||||||
Sbjct: 685 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgccgacgtcaaact 626

                                                                       
Query: 414 tgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggccttga 473
           |||||||||| |  ||||||||||||||||| |||| ||||||||||||  |||||||||
Sbjct: 625 tgatgaagtccatgatcttgttggtctccagatcgatcttgatggtgtcgttggccttga 566

                                                    
Query: 474 tgagtgggtctgggtagcggatggtgcggccatcataggtg 514
           |||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 565 tgagcgggtcggggtagcggatggtacggccgtcgtaggtg 525

---

>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds
          Length = 1037

 Score =  337 bits (170), Expect = 2e-89
 Identities = 317/368 (86%)
 Strand = Plus / Minus

                                                                       
Query: 143 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803

                                                                       
Query: 203 atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
           || |||||||||||||| |||||||   | |||||  | |||||||| ||||||||||||
Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743

                                                                       
Query: 263 ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
           ||||||| ||||||||| |||||| | ||| |||  ||||| ||||| |||||||||| |
Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683

                                                                       
Query: 323 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
            | ||||| |||||||||||||||||||| ||||| ||||| |||||||| |  || |||
Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagtgttccttccgcca 623

                                                                       
Query: 383 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
           ||||||||||| |||||||| || ||||||||||||||||| ||||| ||||||||||||
Sbjct: 622 gtcaccatgacaacgttgccaacatcaaacttgatgaagtccacaattttgttggtctcc 563

                                                                       
Query: 443 aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           || |||| ||||||||||||  ||||||||||| | ||||| ||||||||||||||||||
Sbjct: 562 agatcgatcttgatggtgtcgttggccttgatgggcgggtcagggtagcggatggtgcgg 503

                   
Query: 503 ccatcata 510
           || |||||
Sbjct: 502 ccgtcata 495



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 75  gaacatagttctatatccttgcaga 99
           |||||| ||||||||||||||||||
Sbjct: 934 gaacattgttctatatccttgcaga 910

---

>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence
          Length = 1145

 Score =  329 bits (166), Expect = 5e-87
 Identities = 316/368 (85%)
 Strand = Plus / Plus

                                                                       
Query: 143 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 202
           |||||||||||||| || || ||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237

                                                                       
Query: 203 atacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacg 262
           || ||||| |||||||| |||||||   | |||||  | |||||||| ||||||||||||
Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297

                                                                       
Query: 263 ttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaag 322
           ||||||| ||||||||| |||||| | ||| |||  ||||| ||||| || |||||||||
Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357

                                                                       
Query: 323 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 382
            | ||||| |||||||||||||||||||| ||||| |||||  ||||||| |  || |||
Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacgggcagtgttccttccccca 417

                                                                       
Query: 383 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 442
           |||||||||||||||||||| || ||||||||||||||||| |||||||||||||| |||
Sbjct: 418 gtcaccatgacgacgttgccaacatcaaacttgatgaagtccacaatcttgttggtatcc 477

                                                                       
Query: 443 aggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           || |||| ||||||||||||  ||||||||||||| ||||| ||||||||||||||||||
Sbjct: 478 agatcgatcttgatggtgtcgttggccttgatgagggggtcagggtagcggatggtgcgg 537

                   
Query: 503 ccatcata 510
           || |||||
Sbjct: 538 ccgtcata 545



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 74  ggaacatagttctatatccttgcaga 99
           ||||||| ||||||||||||||||||
Sbjct: 105 ggaacattgttctatatccttgcaga 130

---

>ref|NM_193994.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 768

 Score =  252 bits (127), Expect = 1e-63
 Identities = 307/369 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 205
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699

                                                                       
Query: 206 cccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacgttg 265
           ||||||||||| |||||   ||   | |||||| |||||||||| ||||||||||| |||
Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639

                                                                       
Query: 266 cccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaaggtt 325
           |||||||||||||| ||     | |||   || ||||| || ||||||||||||||  | 
Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579

                                                                       
Query: 326 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 385
           ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 578 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 519

                                                                       
Query: 386 accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 445
           ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 518 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 459

                                                                       
Query: 446 tcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcggcca 505
           || | |||||| |||||  | ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 458 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 399

                    
Query: 506 tcataggtg 514
           |||||||||
Sbjct: 398 tcataggtg 390

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  252 bits (127), Expect = 1e-63
 Identities = 307/369 (83%)
 Strand = Plus / Minus

                                                                            
Query: 146      gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 205
                |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910

                                                                            
Query: 206      cccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacgttg 265
                ||||||||||| |||||   ||   | |||||| |||||||||| ||||||||||| |||
Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850

                                                                            
Query: 266      cccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaaggtt 325
                |||||||||||||| ||     | |||   || ||||| || ||||||||||||||  | 
Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790

                                                                            
Query: 326      cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 385
                ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 14497789 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 14497730

                                                                            
Query: 386      accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 445
                ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 14497729 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 14497670

                                                                            
Query: 446      tcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcggcca 505
                || | |||||| |||||  | ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 14497669 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 14497610

                         
Query: 506      tcataggtg 514
                |||||||||
Sbjct: 14497609 tcataggtg 14497601

---

>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0514H03
          Length = 167230

 Score =  252 bits (127), Expect = 1e-63
 Identities = 307/369 (83%)
 Strand = Plus / Minus

                                                                         
Query: 146   gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 205
             |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223

                                                                         
Query: 206   cccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacgttg 265
             ||||||||||| |||||   ||   | |||||| |||||||||| ||||||||||| |||
Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163

                                                                         
Query: 266   cccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaaggtt 325
             |||||||||||||| ||     | |||   || ||||| || ||||||||||||||  | 
Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103

                                                                         
Query: 326   cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 385
             ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 57102 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 57043

                                                                         
Query: 386   accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 445
             ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 57042 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 56983

                                                                         
Query: 446   tcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcggcca 505
             || | |||||| |||||  | ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 56982 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 56923

                      
Query: 506   tcataggtg 514
             |||||||||
Sbjct: 56922 tcataggtg 56914

---

>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full
           insert sequence
          Length = 1035

 Score =  252 bits (127), Expect = 1e-63
 Identities = 307/369 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 205
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816

                                                                       
Query: 206 cccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacacgttg 265
           ||||||||||| |||||   ||   | |||||| |||||||||| ||||||||||| |||
Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756

                                                                       
Query: 266 cccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaaggtt 325
           |||||||||||||| ||     | |||   || ||||| || ||||||||||||||  | 
Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696

                                                                       
Query: 326 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 385
           ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 695 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 636

                                                                       
Query: 386 accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 445
           ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 635 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 576

                                                                       
Query: 446 tcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcggcca 505
           || | |||||| |||||  | ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 575 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 516

                    
Query: 506 tcataggtg 514
           |||||||||
Sbjct: 515 tcataggtg 507

---

>ref|XM_475130.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 738

 Score =  246 bits (124), Expect = 6e-62
 Identities = 277/330 (83%)
 Strand = Plus / Minus

                                                                       
Query: 172 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnna 231
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |   |
Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649

                                                                       
Query: 232 nggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 291
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589

                                                                       
Query: 292 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 351
             |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529

                                                                       
Query: 352 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 411
           ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 528 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 469

                                                                       
Query: 412 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggcctt 471
           |||||||||||| || |||||||||||||||| ||| | ||||||||||||  |||||||
Sbjct: 468 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 409

                                         
Query: 472 gatgagtgggtctgggtagcggatggtgcg 501
           |||||||||||||||||||||||| |||||
Sbjct: 408 gatgagtgggtctgggtagcggatcgtgcg 379

---

>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07,
             complete sequence
          Length = 159932

 Score =  246 bits (124), Expect = 6e-62
 Identities = 277/330 (83%)
 Strand = Plus / Minus

                                                                         
Query: 172   cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnna 231
             |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |   |
Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974

                                                                         
Query: 232   nggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 291
              |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914

                                                                         
Query: 292   ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 351
               |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854

                                                                         
Query: 352   cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 411
             ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 80853 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 80794

                                                                         
Query: 412   cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggcctt 471
             |||||||||||| || |||||||||||||||| ||| | ||||||||||||  |||||||
Sbjct: 80793 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 80734

                                           
Query: 472   gatgagtgggtctgggtagcggatggtgcg 501
             |||||||||||||||||||||||| |||||
Sbjct: 80733 gatgagtgggtctgggtagcggatcgtgcg 80704

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  246 bits (124), Expect = 6e-62
 Identities = 277/330 (83%)
 Strand = Plus / Minus

                                                                            
Query: 172      cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnna 231
                |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |   |
Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169

                                                                            
Query: 232      nggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 291
                 |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109

                                                                            
Query: 292      ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 351
                  |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049

                                                                            
Query: 352      cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 411
                ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 17551048 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 17550989

                                                                            
Query: 412      cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggcctt 471
                |||||||||||| || |||||||||||||||| ||| | ||||||||||||  |||||||
Sbjct: 17550988 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 17550929

                                              
Query: 472      gatgagtgggtctgggtagcggatggtgcg 501
                |||||||||||||||||||||||| |||||
Sbjct: 17550928 gatgagtgggtctgggtagcggatcgtgcg 17550899

---

>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full
           insert sequence
          Length = 1162

 Score =  246 bits (124), Expect = 6e-62
 Identities = 277/330 (83%)
 Strand = Plus / Minus

                                                                       
Query: 172 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnna 231
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |   |
Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801

                                                                       
Query: 232 nggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 291
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741

                                                                       
Query: 292 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 351
             |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681

                                                                       
Query: 352 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 411
           ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 680 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 621

                                                                       
Query: 412 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggcctt 471
           |||||||||||| || |||||||||||||||| ||| | ||||||||||||  |||||||
Sbjct: 620 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 561

                                         
Query: 472 gatgagtgggtctgggtagcggatggtgcg 501
           |||||||||||||||||||||||| |||||
Sbjct: 560 gatgagtgggtctgggtagcggatcgtgcg 531

---

>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4
          Length = 1148

 Score =  192 bits (97), Expect = 8e-46
 Identities = 189/217 (87%), Gaps = 3/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 143 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctt 201
           |||||||||||||| || || || |||| |||||| ||||||| | |||||| |||||||
Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807

                                                                       
Query: 202 gatacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtgaacac 261
           ||| |||||||||||||| |||||||   | |||||| ||||||||||||||||||||||
Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747

                                                                       
Query: 262 gttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatggtctcaaa 321
            ||||||||||||||||| || ||| | ||| ||||||||||||||||||||||||| ||
Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687

                                                
Query: 322 ggttcccttatgcttctccctgttcttgatcacacca 358
            | | |||| |||||||||||||| ||||||||||||
Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 72/84 (85%), Gaps = 2/84 (2%)
 Strand = Plus / Minus

                                                                       
Query: 380 ccagtcaccatgacgacgttgccgacgtcaaac-ttgatgaagtcaacaatcttgttggt 438
           |||||||||||||| || ||||| || |||||| |||||||||||   | ||||||||||
Sbjct: 632 ccagtcaccatgac-acattgccaacatcaaaccttgatgaagtcgcaattcttgttggt 574

                                   
Query: 439 ctccaggtcgagcttgatggtgtc 462
           |||||| |||| |||||| |||||
Sbjct: 573 ctccagatcgatcttgattgtgtc 550



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 79  atagttctatatcc-ttgcagataactggctatagcaaaac 118
           |||||||||||||| ||||| | |||| |||||||||||||
Sbjct: 937 atagttctatatcctttgcaaacaactcgctatagcaaaac 897

---

>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds
          Length = 1086

 Score =  190 bits (96), Expect = 3e-45
 Identities = 216/257 (84%)
 Strand = Plus / Minus

                                                                       
Query: 242 cccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccctgggcatcc 301
           |||||||||||||||||||| || || || || || ||||||| | ||||   |||||||
Sbjct: 726 cccttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcc 667

                                                                       
Query: 302 tcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaaca 361
           | ||||||||||||||||||| ||||||||||||||||||||||||| || || ||||||
Sbjct: 666 tgaacgtggatggtctcaaagcttcccttatgcttctccctgttcttaatgactccaaca 607

                                                                       
Query: 362 cgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaag 421
           || ||  |||| |  ||||||||||||||||| || || || || |||||||| ||||||
Sbjct: 606 cgacctctgtttcttccaccagtcaccatgacaacatttccaacatcaaacttaatgaag 547

                                                                       
Query: 422 tcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtggg 481
           ||    |||||||| ||||||| ||| |||||||| |||||  ||||||||||||| |||
Sbjct: 546 tcggtgatcttgtttgtctccaagtccagcttgatagtgtcattggccttgatgaggggg 487

                            
Query: 482 tctgggtagcggatggt 498
           || |||||||| |||||
Sbjct: 486 tcagggtagcgaatggt 470

---

>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score =  170 bits (86), Expect = 3e-39
 Identities = 174/204 (85%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||||||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 gtggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 506

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 505 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 446

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 445 gtaacggatggtgcgaccatcata 422

---

>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds
          Length = 1054

 Score =  168 bits (85), Expect = 1e-38
 Identities = 232/282 (82%)
 Strand = Plus / Minus

                                                                       
Query: 233 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccc 292
           ||||| |||||||||||||| |||||||| |||||||  || || ||||| |   | || 
Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgcccatgcgagtagcaaattcatgtcca 739

                                                                       
Query: 293 tgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatc 352
             || |||||  ||||| || ||||||||| | |||||||||||||||||||||||||||
Sbjct: 738 gtggaatcctgcacgtgaattgtctcaaagctacccttatgcttctccctgttcttgatc 679

                                                                       
Query: 353 acaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaac 412
           || |||||||||||  |||| | |||||| || ||||| || || || || || ||||| 
Sbjct: 678 actccaacacgccccctgtttctcccacctgttaccataactacattcccaacatcaaat 619

                                                                       
Query: 413 ttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggccttg 472
           ||||| || ||||||||||||||   |||||| || ||||| ||||||||  ||||| ||
Sbjct: 618 ttgataaaatcaacaatcttgttttcctccagatccagcttaatggtgtcgttggccctg 559

                                                     
Query: 473 atgagtgggtctgggtagcggatggtgcggccatcataggtg 514
           ||||| ||||||||||| ||||||||||| ||||||||||||
Sbjct: 558 atgagagggtctgggtaacggatggtgcgaccatcataggtg 517

---

>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence
          Length = 128856

 Score =  168 bits (85), Expect = 1e-38
 Identities = 232/282 (82%)
 Strand = Plus / Minus

                                                                         
Query: 233   ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccc 292
             ||||| || ||||||||||| |||||||| ||| ||||||| || |||||||   |||| 
Sbjct: 83646 ggctttgtccccttgccaatagtgaacacattgaccagacgagttgcaaactcatgacca 83587

                                                                         
Query: 293   tgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatc 352
               |||||||| ||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 83586 gtggcatcctgaacgtggattgtctcaaaggttcccttatgcttttctctgttcttgatc 83527

                                                                         
Query: 353   acaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaac 412
             || |||||||||||  | ||    |||||||| ||||| || || || || || || || 
Sbjct: 83526 actccaacacgccccctattcttaccaccagtaaccatcactacattcccaacatcgaat 83467

                                                                         
Query: 413   ttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggccttg 472
             |||||||| || |||||||||||   ||| ||||| |||||||| |||||  | ||| ||
Sbjct: 83466 ttgatgaaatcgacaatcttgttttcctcaaggtccagcttgattgtgtcattagccctg 83407

                                                       
Query: 473   atgagtgggtctgggtagcggatggtgcggccatcataggtg 514
             |||| |||||| ||||||||||| ||||| ||||||||||||
Sbjct: 83406 atgactgggtcagggtagcggatagtgcgaccatcataggtg 83365

---

>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.2 mRNA, complete cds
          Length = 1174

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 739 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 680

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 679 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 620

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 619 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 560

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 559 gtaacggatggtgcgaccatcata 536



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830

---

>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.1 mRNA, complete cds
          Length = 1088

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 535

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 534 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 475

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 474 gtaacggatggtgcgaccatcata 451



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745

---

>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 820

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 508

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 448

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 447 gtaacggatggtgcgaccatcata 424



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718

---

>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 1059

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 532

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 531 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 472

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 471 gtaacggatggtgcgaccatcata 448



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742

---

>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA
            project)
          Length = 104607

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                        
Query: 307  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
            |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 7896 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 7837

                                                                        
Query: 367  agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
              |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 7836 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 7777

                                                                        
Query: 427  aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
            |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 7776 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 7717

                                    
Query: 487  gtagcggatggtgcggccatcata 510
            ||| ||||||||||| ||||||||
Sbjct: 7716 gtaacggatggtgcgaccatcata 7693



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 182  tcctcaatgatggtgagcttgatacccttgccctt 216
            |||||||||||||| ||||| ||||| ||||||||
Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987

---

>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 789

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 508

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 448

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 447 gtaacggatggtgcgaccatcata 424



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718

---

>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 1008

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 532

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 531 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 472

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 471 gtaacggatggtgcgaccatcata 448



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742

---

>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1168

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Plus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 354 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 413

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 414 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 473

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 474 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 533

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 534 gtaacggatggtgcgaccatcata 557



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263

---

>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 976

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 621 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 562

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 561 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 502

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 501 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 442

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 441 gtaacggatggtgcgaccatcata 418



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712

---

>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 942

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 506

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 505 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 446

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 445 gtaacggatggtgcgaccatcata 422



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716

---

>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence
          Length = 1011

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 535

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 534 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 475

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 474 gtaacggatggtgcgaccatcata 451



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745

---

>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9
          Length = 86380

 Score =  163 bits (82), Expect = 7e-37
 Identities = 173/204 (84%)
 Strand = Plus / Minus

                                                                         
Query: 307   gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
             |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 82619 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 82560

                                                                         
Query: 367   agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
               |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 82559 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 82500

                                                                         
Query: 427   aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
             |||||||||   ||| ||||| ||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 82499 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 82440

                                     
Query: 487   gtagcggatggtgcggccatcata 510
             ||| ||||||||||| ||||||||
Sbjct: 82439 gtaacggatggtgcgaccatcata 82416



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 182   tcctcaatgatggtgagcttgatacccttgccctt 216
             |||||||||||||| ||||| ||||| ||||||||
Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710

---

>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420
           mRNA, complete cds
          Length = 1080

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 720 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 661

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 660 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 601

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 600 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 541

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 540 gtaacggatggtgcgaccatc 520



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttggg 808

---

>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds
          Length = 789

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 568

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 567 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 508

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 507 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 448

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 447 gtaacggatggtgcgaccatc 427



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttggg 715

---

>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 995

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 640 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 581

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 580 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 521

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 520 gtaacggatggtgcgaccatc 500



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttggg 788

---

>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 1005

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 711 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 652

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 651 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 592

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 591 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 532

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 531 gtaacggatggtgcgaccatc 511



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttggg 799

---

>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 978

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 721 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 662

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 661 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 602

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 601 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 542

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 541 gtaacggatggtgcgaccatc 521



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttggg 809

---

>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 537

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 240 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 181

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 180 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 121

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 120 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 61

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 60  gtaacggatggtgcgaccatc 40



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttggg 328

---

>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 988

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 691 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 632

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 631 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 572

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 571 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 512

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 511 gtaacggatggtgcgaccatc 491



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttggg 779

---

>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 440 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 381

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 380 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 321

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 320 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 261

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 260 gtaacggatggtgcgaccatc 240



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttggg 528

---

>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 997

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 640 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 581

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 580 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 521

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 520 gtaacggatggtgcgaccatc 500



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttggg 788

---

>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence
          Length = 1010

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 715 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 656

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 655 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactccac 596

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 595 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 536

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 535 gtaacggatggtgcgaccatc 515



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttggg 803

---

>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score =  157 bits (79), Expect = 4e-35
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                        
Query: 307  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
            |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 6772 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 6713

                                                                        
Query: 367  agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
              |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 6712 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 6653

                                                                        
Query: 427  aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
            ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 6652 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 6593

                                 
Query: 487  gtagcggatggtgcggccatc 507
            ||| ||||||||||| |||||
Sbjct: 6592 gtaacggatggtgcgaccatc 6572



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 181  ctcctcaatgatggtgagcttgatacccttgcccttggg 219
            |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttggg 6860

---

>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB12ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 566

 Score =  149 bits (75), Expect = 1e-32
 Identities = 169/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 269 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 210

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 209 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 150

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           ||||||||||| ||| ||||||||||||||||||||  | | ||||||||| ||||  ||
Sbjct: 149 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtgagg 90

                                
Query: 487 gtagcggatggtgcggccatc 507
           ||| ||||||||||| |||||
Sbjct: 89  gtaacggatggtgcgaccatc 69



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggg 219
           |||||| ||||| || ||||||||||| |||||||||||
Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttggg 357

---

>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds
          Length = 1105

 Score =  141 bits (71), Expect = 3e-30
 Identities = 266/333 (79%)
 Strand = Plus / Minus

                                                                       
Query: 181 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcatnnanggcttggt 240
           ||||||||||||||| |  |||||||||||||||||||| ||   ||   | ||||| ||
Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781

                                                                       
Query: 241 gcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccctgggcatc 300
            || || || ||||| || || ||||| ||||| || ||||||| | ||||  ||| |||
Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721

                                                                       
Query: 301 ctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 360
           || || ||| |  ||||| ||| | |||||||| ||||||||||||||||| || |||||
Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgataactccaac 661

                                                                       
Query: 361 acgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaa 420
            |||||||| || | ||| |||||||||||||| || || || || || ||||| |||||
Sbjct: 660 tcgcccagtattcctccccccagtcaccatgacaacatttccaacatcgaacttaatgaa 601

                                                                       
Query: 421 gtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgg 480
            ||| | |||||||| | ||||| ||| || |||||||||||  ||||||| ||||| ||
Sbjct: 600 atcagctatcttgtttgcctccaagtcaagtttgatggtgtcattggccttaatgagcgg 541

                                            
Query: 481 gtctgggtagcggatggtgcggccatcataggt 513
           |||||| || ||||| || || |||||||||||
Sbjct: 540 gtctggataacggatagtacgcccatcataggt 508

---

>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 952

 Score =  141 bits (71), Expect = 3e-30
 Identities = 171/204 (83%), Gaps = 2/204 (0%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 614 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 555

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 554 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 495

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| |||||||||||  |  | | ||||||||| ||||| ||
Sbjct: 494 aatcttgttctcctcaaggtccagcttgatggt--catttggcttgatgagcgggtcagg 437

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 436 gtaacggatggtgcgaccatcata 413



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 182 tcctcaatgatggtgagcttgatacccttgccctt 216
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705

---

>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence
          Length = 1023

 Score =  139 bits (70), Expect = 1e-29
 Identities = 170/204 (83%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 680 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 621

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 620 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 561

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 560 gtaacggatggtgcgaccatcata 537

---

>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360
           mRNA, complete cds
          Length = 1074

 Score =  131 bits (66), Expect = 2e-27
 Identities = 169/204 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 680 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 621

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 620 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 561

                                   
Query: 487 gtagcggatggtgcggccatcata 510
            || ||||||||||| ||||||||
Sbjct: 560 ataacggatggtgcgaccatcata 537

---

>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 817

 Score =  131 bits (66), Expect = 2e-27
 Identities = 169/204 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 567 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 508

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 448

                                   
Query: 487 gtagcggatggtgcggccatcata 510
            || ||||||||||| ||||||||
Sbjct: 447 ataacggatggtgcgaccatcata 424

---

>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 1032

 Score =  131 bits (66), Expect = 2e-27
 Identities = 169/204 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 699 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 640

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 639 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 580

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 579 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 520

                                   
Query: 487 gtagcggatggtgcggccatcata 510
            || ||||||||||| ||||||||
Sbjct: 519 ataacggatggtgcgaccatcata 496

---

>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 813

 Score =  131 bits (66), Expect = 2e-27
 Identities = 169/204 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 567 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 508

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 448

                                   
Query: 487 gtagcggatggtgcggccatcata 510
            || ||||||||||| ||||||||
Sbjct: 447 ataacggatggtgcgaccatcata 424

---

>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 1034

 Score =  131 bits (66), Expect = 2e-27
 Identities = 169/204 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 700 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 641

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 640 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 581

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 580 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 521

                                   
Query: 487 gtagcggatggtgcggccatcata 510
            || ||||||||||| ||||||||
Sbjct: 520 ataacggatggtgcgaccatcata 497

---

>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZB04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1007

 Score =  131 bits (66), Expect = 2e-27
 Identities = 169/204 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 692 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 633

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 632 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 573

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 572 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 513

                                   
Query: 487 gtagcggatggtgcggccatcata 510
            || ||||||||||| ||||||||
Sbjct: 512 ataacggatggtgcgaccatcata 489

---

>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete
             sequence. Sequence from clones T23A1, F5J6, MJB20
          Length = 76170

 Score =  131 bits (66), Expect = 2e-27
 Identities = 169/204 (82%)
 Strand = Plus / Minus

                                                                         
Query: 307   gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
             ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 48796 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 48737

                                                                         
Query: 367   agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
               |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 48736 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 48677

                                                                         
Query: 427   aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
             |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 48676 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 48617

                                     
Query: 487   gtagcggatggtgcggccatcata 510
              || ||||||||||| ||||||||
Sbjct: 48616 ataacggatggtgcgaccatcata 48593

---

>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4
          Length = 966

 Score =  131 bits (66), Expect = 2e-27
 Identities = 172/208 (82%)
 Strand = Plus / Minus

                                                                       
Query: 288 gaccctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttct 347
           ||||||| | ||||| || ||||| |||||||||| | ||||||||||||||||||||||
Sbjct: 695 gaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttct 636

                                                                       
Query: 348 tgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgt 407
           | || |||||||| || ||  |||| |  || ||||||||||| || || || || ||||
Sbjct: 635 taataacaccaactcgtcccctgtttctacctccagtcaccatcacaacattcccaacgt 576

                                                                       
Query: 408 caaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntgg 467
           ||||||||||||| ||||||||||| ||||  |||| ||| ||||| ||||| ||  |||
Sbjct: 575 caaacttgatgaaatcaacaatcttattggattccaagtccagctttatggtatcgttgg 516

                                       
Query: 468 ccttgatgagtgggtctgggtagcggat 495
           |||||||||| || || || ||||||||
Sbjct: 515 ccttgatgagaggatcaggatagcggat 488

---

>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like
           protein mRNA, complete cds
          Length = 1052

 Score =  125 bits (63), Expect = 2e-25
 Identities = 157/189 (83%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||| |||||||||| | ||||||||||||||||||||||| || |||||||| || ||
Sbjct: 659 gtggagggtctcaaagctacccttatgcttctccctgttcttaataacaccaactcgtcc 600

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || || || || ||||||||||||||||| |||||
Sbjct: 599 cctgtttctacctccagtcaccatcacaacattcccaacgtcaaacttgatgaaatcaac 540

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||| ||||  |||| ||| ||||| ||||| ||  ||||||||||||| || || ||
Sbjct: 539 aatcttattggattccaagtccagctttatggtatcgttggccttgatgagaggatcagg 480

                    
Query: 487 gtagcggat 495
            ||||||||
Sbjct: 479 atagcggat 471

---

>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1000

 Score =  123 bits (62), Expect = 6e-25
 Identities = 165/200 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 685 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 626

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 625 tctgtttcttcctccagttaccataactacgttgcccacatcaaacttaatgaactccac 566

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||||||||||||||||||  | | ||||||||| ||||| ||
Sbjct: 565 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 506

                               
Query: 487 gtagcggatggtgcggccat 506
            || ||||||||||| ||||
Sbjct: 505 ataacggatggtgcgaccat 486

---

>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score =  123 bits (62), Expect = 6e-25
 Identities = 168/204 (82%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||| | |||||||||||||||| | |||||  |||||||| ||||||||
Sbjct: 625 gtggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacccacacgccc 566

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || ||||||||||| || ||||| || ||||||||||| ||||| |||||
Sbjct: 565 gctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttcatgaactcaac 506

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| ||||| |||||||||||||   | | ||| ||||| ||||  ||
Sbjct: 505 aatcttgttctcctcaaggtccagcttgatggtgtgatttggcttcatgagcgggtgagg 446

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||||||||||| ||||||||
Sbjct: 445 gtaacggatggtgcgaccatcata 422

---

>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e
          Length = 1090

 Score =  119 bits (60), Expect = 9e-24
 Identities = 151/182 (82%)
 Strand = Plus / Minus

                                                                       
Query: 311 atggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtg 370
           |||||||||||| | |||||||||||||||||||| || || || |||||||| ||  ||
Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacgacctctg 619

                                                                       
Query: 371 ttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatc 430
           || |  || || || |||||||| || || || ||||||||||||||||| || ||||||
Sbjct: 618 ttccttcctccggtgaccatgacaacattcccaacgtcaaacttgatgaaatcgacaatc 559

                                                                       
Query: 431 ttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtag 490
           |||||| |||| ||||| ||||| ||||||||  | |||||||| |  ||||||||||||
Sbjct: 558 ttgttgctctcaaggtccagcttaatggtgtcatttgccttgatcaaggggtctgggtag 499

             
Query: 491 cg 492
           ||
Sbjct: 498 cg 497

---

>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 984

 Score =  115 bits (58), Expect = 1e-22
 Identities = 167/204 (81%)
 Strand = Plus / Minus

                                                                       
Query: 307 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 366
           |||||| ||||||| | ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 gtggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 367 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 426
             |||| |  || || |||||||| || ||||| || ||||||||||||||||| || ||
Sbjct: 565 tctgtttctgcctccggtcaccatcacaacgttacccacgtcaaacttgatgaactcgac 506

                                                                       
Query: 427 aatcttgttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgg 486
           |||||||||   ||| |||||  |||||||||||||  | | ||||||||| ||||| ||
Sbjct: 505 aatcttgttctcctcaaggtccggcttgatggtgtcttttggcttgatgagcgggtcagg 446

                                   
Query: 487 gtagcggatggtgcggccatcata 510
           ||| ||| ||||||| || |||||
Sbjct: 445 gtaacggttggtgcgaccgtcata 422

---

>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence
          Length = 1292

 Score =  113 bits (57), Expect = 6e-22
 Identities = 195/242 (80%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtgaacacgttgcccagacgggtggcaaactggngaccctgggcatcctcaacgtggatg 313
           |||||||| || |||| |||||| |||||||   | ||| ||| ||||| || ||| |  
Sbjct: 760 gtgaacacatttcccaaacgggtagcaaactcatgccccagggaatcctgaatgtgaact 701

                                                                       
Query: 314 gtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttg 373
           ||||||||| | ||||| ||||||||||||||||| |  |  |||||||| ||  |||| 
Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttcttaagaattccaacacgtcccctgttt 641

                                                                       
Query: 374 cgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttg 433
           |  |||||||||| ||| || || || || || |||||||||||||||||||||||||| 
Sbjct: 640 ctaccaccagtcaacataaccacattaccaacatcaaacttgatgaagtcaacaatctta 581

                                                                       
Query: 434 ttggtctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcgg 493
           ||||  || | ||| ||||||||||||||  ||||||||||||| || || |||||||||
Sbjct: 580 ttggaatctaagtccagcttgatggtgtcattggccttgatgaggggatcggggtagcgg 521

             
Query: 494 at 495
           ||
Sbjct: 520 at 519

---

>emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 966

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 125/152 (82%)
 Strand = Plus / Minus

                                                                       
Query: 310 gatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagt 369
           |||||| |||||| | ||||| |  ||||| | |||||| |||||||||||||||||  |
Sbjct: 689 gatggtttcaaagctacccttgtttttctcacggttcttaatcacaccaacacgccctct 630

                                                                       
Query: 370 gttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaat 429
           ||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || |||||
Sbjct: 629 gtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaat 570

                                           
Query: 430 cttgttggtctccaggtcgagcttgatggtgt 461
           ||||||   ||| |||||||||||||||||||
Sbjct: 569 cttgttctcctcaaggtcgagcttgatggtgt 538

---

>gb|AY769318.1| Bombyx mori ribosomal protein S4 (RpS4) mRNA, complete cds
          Length = 908

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                   
Query: 470 ttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 532 ttgataagtgggtctgggtagcggatggtgcggccatcat 493

---

>dbj|D21302.1|RICSS536 Oryza sativa SS536 mRNA for ribosomal protein S4, partial sequence
          Length = 347

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 412 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggcctt 471
           |||||| ||| | | ||||||||||||||| ||  ||| |||||  ||| |  | |||||
Sbjct: 330 cttgatnaagncganaatcttgttggtctcnagancgatcttgantgtgccgtttgcctt 271

                                                      
Query: 472 gatgagtgggtctgggtagcggatggtgcggccatcataggtg 514
           |||||  ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 270 gatgatcgggtcagggtancggatggtgcgaccatcataggtg 228

---

>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence
          Length = 728

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 305 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 354
           |||||||||||||| ||| | ||||| |||||||||||||||||||||||
Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 334 cttctccctgttcttgatcacaccaacacgcccagtgtt 372
           ||||||||||||||||||||| || |||||||| |||||
Sbjct: 429 cttctccctgttcttgatcactcctacacgcccggtgtt 391

---

>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
           (FG08714.1) partial mRNA
          Length = 732

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 348 tgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgt 407
           |||| ||||||||||| ||  ||||||| |||||||| ||||||||||||  ||||  ||
Sbjct: 532 tgatgacaccaacacgacccatgttgcgaccaccagtgaccatgacgacggcgccggtgt 473

                           
Query: 408 caaacttgatgaagtc 423
           | ||||||||||||||
Sbjct: 472 cgaacttgatgaagtc 457



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 180 gctcctcaatgatggtgagcttgatacccttgcccttggg 219
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658

---

>emb|CR712301.2|CNS0GCK9 Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 496 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 451

---

>emb|CR720218.2|CNS0GIO0 Tetraodon nigroviridis full-length cDNA
          Length = 845

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 471 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 426

---

>emb|CR720216.2|CNS0GINY Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR722715.2|CNS0GKLD Tetraodon nigroviridis full-length cDNA
          Length = 848

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431

---

>emb|CR721883.2|CNS0GJY9 Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR720853.2|CNS0GJ5N Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 383 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 338

---

>emb|CR720472.2|CNS0GIV2 Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR719441.2|CNS0GI2F Tetraodon nigroviridis full-length cDNA
          Length = 848

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431

---

>emb|CR719306.2|CNS0GHYO Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR717405.2|CNS0GGHV Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 452

---

>emb|CR717315.2|CNS0GGFD Tetraodon nigroviridis full-length cDNA
          Length = 587

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430

---

>emb|CR716926.2|CNS0GG4N Tetraodon nigroviridis full-length cDNA
          Length = 574

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 462 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 417

---

>emb|CR711409.2|CNS0GBVH Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR714124.2|CNS0GDYW Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR714283.2|CNS0GE3B Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR712945.2|CNS0GD25 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430

---

>emb|CR713157.2|CNS0GD81 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430

---

>emb|CR710675.2|CNS0GBB3 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR710088.2|CNS0GAUS Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430

---

>emb|CR708708.2|CNS0G9SG Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR707417.2|CNS0G8SL Tetraodon nigroviridis full-length cDNA
          Length = 920

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 551 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 506

---

>emb|CR706939.2|CNS0G8FB Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430

---

>emb|CR704562.2|CNS0G6LA Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR704014.2|CNS0G662 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR703820.2|CNS0G60O Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR703584.2|CNS0G5U4 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR703489.2|CNS0G5RH Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR702840.2|CNS0G59G Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR702635.2|CNS0G53R Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR702209.2|CNS0G4RX Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR702145.2|CNS0G4Q5 Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 496 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 451

---

>emb|CR700232.2|CNS0G390 Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR697958.2|CNS0G1HU Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR697195.2|CNS0G0WN Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR697018.2|CNS0G0RQ Tetraodon nigroviridis full-length cDNA
          Length = 828

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 474 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 429

---

>emb|CR696565.2|CNS0G0F5 Tetraodon nigroviridis full-length cDNA
          Length = 846

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR696312.2|CNS0G084 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR694977.2|CNS0FZ71 Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR694101.2|CNS0FYIP Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR693396.2|CNS0FXZ4 Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR691738.2|CNS0FWP2 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR688407.2|CNS0FU4J Tetraodon nigroviridis full-length cDNA
          Length = 848

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430

---

>emb|CR689769.2|CNS0FV6D Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR687727.2|CNS0FTLN Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453

---

>emb|CR686869.2|CNS0FSXT Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 496 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 451

---

>emb|CR685258.2|CNS0FRP2 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR685076.2|CNS0FRK0 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR684709.2|CNS0FR9T Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 452

---

>emb|CR684226.2|CNS0FQWE Tetraodon nigroviridis full-length cDNA
          Length = 872

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR683325.2|CNS0FQ7D Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR682942.2|CNS0FPWQ Tetraodon nigroviridis full-length cDNA
          Length = 763

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 391 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 346

---

>emb|CR682258.2|CNS0FPDQ Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR681455.2|CNS0FORF Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR681050.2|CNS0FOG6 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR680145.2|CNS0FNR1 Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR676429.2|CNS0FKW9 Tetraodon nigroviridis full-length cDNA
          Length = 609

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR675710.2|CNS0FKCK Tetraodon nigroviridis full-length cDNA
          Length = 835

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431

---

>emb|CR673595.2|CNS0FIPT Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR670866.2|CNS0FGM0 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR669893.2|CNS0FFUZ Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR669083.2|CNS0FF8H Tetraodon nigroviridis full-length cDNA
          Length = 831

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431

---

>emb|CR663251.2|CNS0FAQH Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR659804.2|CNS0F82Q Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR659262.2|CNS0F7NO Tetraodon nigroviridis full-length cDNA
          Length = 872

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR658566.2|CNS0F74C Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR657212.2|CNS0F62Q Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR656191.2|CNS0F5AD Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR655155.2|CNS0F4HL Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR654105.2|CNS0F3OF Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR652992.2|CNS0F2TI Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>emb|CR651314.2|CNS0F1IW Tetraodon nigroviridis full-length cDNA
          Length = 609

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR647718.2|CNS0EYR0 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR646899.2|CNS0EY49 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR645541.2|CNS0EX2J Tetraodon nigroviridis full-length cDNA
          Length = 862

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR644913.2|CNS0EWL3 Tetraodon nigroviridis full-length cDNA
          Length = 609

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR642563.2|CNS0EURT Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR642362.2|CNS0EUM8 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR641651.2|CNS0EU2H Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR641329.2|CNS0ETTJ Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR641017.2|CNS0ETKV Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR639635.2|CNS0ESIH Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430

---

>emb|CR638530.2|CNS0ERNS Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR637949.2|CNS0ER7N Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR636021.2|CNS0EPQ3 Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452

---

>emb|CR634987.2|CNS0EOXD Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453

---

>emb|CR634338.2|CNS0EOFC Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||  || |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454

---

>gb|AY190741.1| Pagrus major 40S ribosomal protein S4 mRNA, partial cds
          Length = 703

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcgg 502
           |||||||||| ||||||||||||||||||||||||
Sbjct: 493 ccttgatgagggggtctgggtagcggatggtgcgg 459

---

>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA
          Length = 992

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 197 agcttgatacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtg 256
           ||||||| |||||||||||| || |||   ||  | |||||| |||||||||||||| ||
Sbjct: 849 agcttgacacccttgcccttaggcagggagatgtagggcttgttgcccttgccaatgatg 790

                                  
Query: 257 aacacgttgcccagacgggtggc 279
           |||||||||  || |||||||||
Sbjct: 789 aacacgttggtcaaacgggtggc 767

---

>emb|CR696954.2|CNS0G0PY Tetraodon nigroviridis full-length cDNA
          Length = 846

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggtgc 500
           ||||||  || |||||||||| ||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgc 432

---

>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript
           variant A (RpS4), mRNA
          Length = 983

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 197 agcttgatacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtg 256
           ||||||| |||||||||||| || |||   ||  | |||||| |||||||||||||| ||
Sbjct: 849 agcttgacacccttgcccttaggcagggagatgtagggcttgttgcccttgccaatgatg 790

                                  
Query: 257 aacacgttgcccagacgggtggc 279
           |||||||||  || |||||||||
Sbjct: 789 aacacgttggtcaaacgggtggc 767

---

>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript
           variant B (RpS4), mRNA
          Length = 969

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 197 agcttgatacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtg 256
           ||||||| |||||||||||| || |||   ||  | |||||| |||||||||||||| ||
Sbjct: 835 agcttgacacccttgcccttaggcagggagatgtagggcttgttgcccttgccaatgatg 776

                                  
Query: 257 aacacgttgcccagacgggtggc 279
           |||||||||  || |||||||||
Sbjct: 775 aacacgttggtcaaacgggtggc 753

---

>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 207761

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                          
Query: 197    agcttgatacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtg 256
              ||||||| |||||||||||| || |||   ||  | |||||| |||||||||||||| ||
Sbjct: 141968 agcttgacacccttgcccttaggcagggagatgtagggcttgttgcccttgccaatgatg 141909

                                     
Query: 257    aacacgttgcccagacgggtggc 279
              |||||||||  || |||||||||
Sbjct: 141908 aacacgttggtcaaacgggtggc 141886

---

>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete
              sequence
          Length = 272016

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                          
Query: 197    agcttgatacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtg 256
              ||||||| |||||||||||| || |||   ||  | |||||| |||||||||||||| ||
Sbjct: 169902 agcttgacacccttgcccttaggcagggagatgtagggcttgttgcccttgccaatgatg 169843

                                     
Query: 257    aacacgttgcccagacgggtggc 279
              |||||||||  || |||||||||
Sbjct: 169842 aacacgttggtcaaacgggtggc 169820

---

>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4,
           complete cds
          Length = 870

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 197 agcttgatacccttgcccttggggaggctcatnnanggcttggtgcccttgccaatggtg 256
           ||||||| |||||||||||| || |||   ||  | |||||| |||||||||||||| ||
Sbjct: 749 agcttgacacccttgcccttaggcagggagatgtagggcttgttgcccttgccaatgatg 690

                                  
Query: 257 aacacgttgcccagacgggtggc 279
           |||||||||  || |||||||||
Sbjct: 689 aacacgttggtcaaacgggtggc 667

---

>gb|AY130367.1| Petromyzon marinus ribosomal protein S4-like mRNA, partial sequence
          Length = 715

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 439 ctccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||||||||||  | ||||||  || |||||||||| || || ||||||||||||||
Sbjct: 466 ctccaggtcgagctgcacggtgtcgttgaccttgatgaggggatcagggtagcggatggt 407

              
Query: 499 gcg 501
           |||
Sbjct: 406 gcg 404

---

>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14
          Length = 86121

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 54/61 (88%), Gaps = 1/61 (1%)
 Strand = Plus / Plus

                                                                         
Query: 307   gtggatggtctcaaaggttcccttatgcttctcc-ctgttcttgatcacaccaacacgcc 365
             |||||||||||||||| ||||||| || || | | | |||||||||||||||||||||||
Sbjct: 15623 gtggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaacacgcc 15682

              
Query: 366   c 366
             |
Sbjct: 15683 c 15683

---

>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02747.4) partial mRNA
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 180 gctcctcaatgatggtgagcttgatacccttgcccttggg 219
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658

---

>emb|CR671087.2|CNS0FGS5 Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 471 tgatgagtgggtctgggtagcggatggtgcgg 502
           ||||||| ||||||||||||||||||||||||
Sbjct: 485 tgatgagggggtctgggtagcggatggtgcgg 454

---

>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA,
           complete cds
          Length = 1024

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 180 gctcctcaatgatggtgagcttgatacccttgcccttggg 219
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727

---

>gb|BT018605.1| Zea mays clone EL01N0450E04.d mRNA sequence
          Length = 1698

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 383  gtcaccatgacgacgttgccgacgtcaaact 413
            ||||||||||| |||||||||||||||||||
Sbjct: 1356 gtcaccatgaccacgttgccgacgtcaaact 1326

---

>gb|DQ066214.1| Ixodes scapularis isolate ISUFL21 ribosomal protein S4 mRNA,
           complete cds
          Length = 789

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 441 ccaggtcgagcttgatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgc 500
           ||||||| | ||||| ||||||  |  |||||||||| ||||| ||||||||||||||||
Sbjct: 493 ccaggtccaccttgacggtgtcgttcaccttgatgagggggtccgggtagcggatggtgc 434

            
Query: 501 g 501
           |
Sbjct: 433 g 433

---

>ref|XM_521131.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S4, X
           isoform (LOC465710), mRNA
          Length = 863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 475 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 434

---

>gb|AY389947.1| Latimeria chalumnae ribosomal protein S4 mRNA, partial cds
          Length = 715

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| |||||||| || |||||||||||| ||||||
Sbjct: 437 ccttgatgagggggtctggataccggatggtgcgggcatcat 396

---

>gb|BC000472.2| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:8636 IMAGE:2961540), complete cds
          Length = 889

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 474 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 433

---

>gb|BC007308.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           IMAGE:3352599), partial cds
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 406 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 365

---

>gb|BC000236.1| Homo sapiens translin-associated factor X, mRNA (cDNA clone
            IMAGE:3351964), **** WARNING: chimeric clone ****
          Length = 2323

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 468  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 1891 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 1850

---

>ref|NM_001007.3| Homo sapiens ribosomal protein S4, X-linked (RPS4X), mRNA
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 562 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 521

---

>gb|BC100904.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:119099 IMAGE:40003601), complete cds
          Length = 792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425

---

>gb|BC100903.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:119098 IMAGE:40003600), complete cds
          Length = 792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425

---

>emb|AL135749.3|HSN14 Homo sapiens chromosome X sequence from BAC CEPHB197N14 region
             PHKA1-DXS227 map Xq13, complete sequence
          Length = 156655

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 468   ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
             |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 87756 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 87797

---

>emb|CR601794.1| full-length cDNA clone CS0DI031YB06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423

---

>emb|CR623958.1| full-length cDNA clone CS0DE004YB10 of Placenta of Homo sapiens
            (human)
          Length = 1896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 468  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 1544 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 1503

---

>emb|CR620411.1| full-length cDNA clone CS0DE011YG15 of Placenta of Homo sapiens
           (human)
          Length = 1386

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423

---

>dbj|AK097914.1| Homo sapiens cDNA FLJ40595 fis, clone THYMU2010705, highly similar to
            40S RIBOSOMAL PROTEIN S4, X ISOFORM
          Length = 2747

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 468  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 2363 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 2322

---

>emb|CR597791.1| full-length cDNA clone CS0DI068YM24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 848

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423

---

>emb|CR595707.1| full-length cDNA clone CL0BB017ZH01 of Neuroblastoma of Homo
           sapiens (human)
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423

---

>emb|CR456735.1| Homo sapiens full open reading frame cDNA clone RZPDo834G036D for
           gene RPS4X, ribosomal protein S4, X-linked; complete
           cds, incl. stopcodon
          Length = 792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425

---

>dbj|AK222479.1| Homo sapiens mRNA for ribosomal protein S4, X-linked X isoform
           variant, clone: adKA01615
          Length = 900

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 491 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 450

---

>gb|BC071662.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:87857 IMAGE:5505465), complete cds
          Length = 905

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 503 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 462

---

>gb|AF041428.1|AF041428 Homo sapiens ribosomal protein s4 X isoform gene, complete cds
          Length = 8542

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 468  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 5195 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 5154

---

>gb|M58458.1|HUMRPS4X Human ribosomal protein S4 (RPS4X) isoform mRNA, complete cds
          Length = 888

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 501 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 460

---

>gb|M22146.1|HUMSCAR Human scar protein mRNA, complete cds
          Length = 864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 471 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 430

---

>dbj|AB024285.1| Macaca fuscata mRNA for ribosomal protein S4X (RPS4X), complete cds
          Length = 853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425

---

>dbj|D50104.1| Macaca fuscata mRNA for ribosomal protein S4, partial cds
          Length = 581

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 409 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 368

---

>dbj|AB015610.1| Chlorocebus aethiops mRNA for ribosomal protein S4X, complete cds
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 509
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 489 ccttgatgaggggatcagggtagcggatggtgcgggcatcat 448

---

>gb|AC024780.1| Caenorhabditis elegans cosmid Y43B11AR, complete sequence
          Length = 15768

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 477   gtgggtctgggtagcggatggtgcg 501
             |||||||||||||||||||||||||
Sbjct: 13485 gtgggtctgggtagcggatggtgcg 13509

---

>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA
          Length = 783

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 191 atggtgagcttgatacccttgcccttggg 219
           |||| ||||||||||||||||||||||||
Sbjct: 743 atggagagcttgatacccttgcccttggg 715

---

>ref|NM_068702.2| Caenorhabditis elegans Ribosomal Protein, Small subunit family
           member (rps-4) (rps-4) mRNA, complete cds
          Length = 845

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 477 gtgggtctgggtagcggatggtgcg 501
           |||||||||||||||||||||||||
Sbjct: 477 gtgggtctgggtagcggatggtgcg 453

---

>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds
          Length = 852

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 191 atggtgagcttgatacccttgcccttggg 219
           |||| ||||||||||||||||||||||||
Sbjct: 745 atggagagcttgatacccttgcccttggg 717

---

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 191     atggtgagcttgatacccttgcccttggg 219
               |||| ||||||||||||||||||||||||
Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919

---

>gb|BC047994.1| Mus musculus RIKEN cDNA 1110033J19 gene, mRNA (cDNA clone MGC:59460
           IMAGE:6518866), complete cds
          Length = 935

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 503 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 462

---

>gb|AC126683.4| Mus musculus BAC clone RP23-62G15 from 6, complete sequence
          Length = 167297

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 457  ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
            ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 3544 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 3503

---

>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA,
           isoform A (LOC583495), partial mRNA
          Length = 285

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 257 aacacgttgcccagacgggtggca 280
           ||||||||||||||||||||||||
Sbjct: 179 aacacgttgcccagacgggtggca 156

---

>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal
           protein S4e mRNA, complete cds
          Length = 792

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 233 ggcttggtgcccttgccaatggtgaacacgtt 264
           ||||||||||||||||||||| |||| |||||
Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 454 gatggtgtcnntggccttgatgagtgggtctgggtagcggat 495
           |||||||||  || |||||||||| ||||| |||||||||||
Sbjct: 480 gatggtgtcattgaccttgatgagagggtcagggtagcggat 439

---

>dbj|AK132160.1| Mus musculus 17 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3300002H24 product:Similar to ribosomal
           protein S4, X-linked, full insert sequence
          Length = 944

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 532 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 491

---

>dbj|AK012382.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700046B19 product:RIBOSOMAL
           PROTEIN S4X homolog [Cercopithecus aethiops], full
           insert sequence
          Length = 918

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 531 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 490

---

>dbj|AK004068.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110033J19 product:Similar to
           ribosomal protein S4, X-linked, full insert sequence
          Length = 944

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 532 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 491

---

>gb|BC028445.1| Mus musculus, clone IMAGE:963029, mRNA
          Length = 707

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 434 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 475

---

>gb|AC142274.3| Mus musculus BAC clone RP23-251M14 from 6, complete sequence
          Length = 179732

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 457    ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
              ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 150352 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 150311

---

>ref|NM_025405.2| Mus musculus RIKEN cDNA 1110033J19 gene (1110033J19Rik), mRNA
          Length = 935

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 457 ggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||  || |||||||||| ||||| ||||||||||||||
Sbjct: 503 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 462

---

>gb|AY224232.1|AY224229S4 Pongo pygmaeus ribosomal protein S4 (RPS4Y) gene, exon 5
          Length = 172

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 468 ccttgatgagtgggtctgggtagcggatggt 498
           |||||||||| || |||||||||||||||||
Sbjct: 106 ccttgatgagaggatctgggtagcggatggt 76

---

>ref|XM_591678.2| PREDICTED: Bos taurus ribosomal protein S4, X-linked (RPS4X), mRNA
          Length = 899

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                       
Query: 410 aacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggcc 469
           ||||||||||| |||  |||||||  ||||||||| || | ||  ||||||||  |  ||
Sbjct: 538 aacttgatgaaatcagtaatcttgccggtctccagatcaatctgaatggtgtcattcacc 479

                                           
Query: 470 ttgatgagtgggtctgggtagcggatggtgcg 501
           |||||||| || || ||||| |||||||||||
Sbjct: 478 ttgatgaggggatcagggtaacggatggtgcg 447

---

>ref|XM_537399.2| PREDICTED: Canis familiaris similar to 40S ribosomal protein S4, X
           isoform (LOC480276), mRNA
          Length = 854

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 468 ccttgatgagtgggtctgggtagcggatggtgcg 501
           |||||||||| || ||||| ||||||||||||||
Sbjct: 485 ccttgatgaggggatctggatagcggatggtgcg 452

---

>emb|BX067601.1|CNS09OBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 235 cttggtgcccttgccaatggtgaacacgtt 264
           |||||||| |||||| ||||||||||||||
Sbjct: 282 cttggtgctcttgccgatggtgaacacgtt 311

---

>emb|BX067600.1|CNS09OBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 235 cttggtgcccttgccaatggtgaacacgtt 264
           |||||||| |||||| ||||||||||||||
Sbjct: 712 cttggtgctcttgccgatggtgaacacgtt 683

---

>ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S4, X isoform (LOC574997), mRNA
          Length = 825

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 243 ccttgccaatggtgaacacgttgcccagacgggtggca 280
           ||||||| |||  |||||||||||| ||||||||||||
Sbjct: 733 ccttgccgatgacgaacacgttgccaagacgggtggca 696

---

>gb|AC008087.11| Homo sapiens chromosome 17, clone RP5-1127L24, complete sequence
          Length = 104726

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                               
Query: 468   ccttgatgagtgggtctgggtagcggatggtgcg 501
             |||||||||| ||||| |||||||||||||||||
Sbjct: 33580 ccttgatgag-gggtcagggtagcggatggtgcg 33612

---

>gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gene, partial cds
          Length = 416

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 25  ggttcgcaaatcaacaaacatcaggc 50
           |||||||||||| |||||||||||||
Sbjct: 88  ggttcgcaaatcgacaaacatcaggc 113

---

>gb|AC084630.1|CBRG45E13 Caenorhabditis briggsae cosmid G45E13, complete sequence
          Length = 39246

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 477   gtgggtctgggtagcggatggt 498
             ||||||||||||||||||||||
Sbjct: 29254 gtgggtctgggtagcggatggt 29275

---

>gb|AF429978.1| Spodoptera frugiperda ribosomal protein S4 mRNA, complete cds
          Length = 936

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 473 atgagtgggtctgggtagcggatggt 498
           ||||||||||| ||||||||||||||
Sbjct: 491 atgagtgggtcggggtagcggatggt 466

---

>gb|AC027455.22| Homo sapiens chromosome 17, clone RP11-411G7, complete sequence
          Length = 145410

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                               
Query: 468   ccttgatgagtgggtctgggtagcggatggtgcg 501
             |||||||||| ||||| |||||||||||||||||
Sbjct: 80084 ccttgatgag-gggtcagggtagcggatggtgcg 80116

---

>dbj|D50109.1| Equus caballus mRNA for ribosomal protein S4, partial cds
          Length = 581

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 455 atggtgtcnntggccttgatgagtgggtctgggtagcggatggt 498
           ||||||||  || |||||||||| || || ||||||||||||||
Sbjct: 422 atggtgtcattgaccttgatgagaggatcagggtagcggatggt 379

---

>dbj|D50107.1| Bos taurus mRNA for ribosomal protein S4, partial cds
          Length = 581

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                       
Query: 410 aacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcnntggcc 469
           ||||||||||| |||  |||||||  ||||||||| || | ||  ||||||||  |  ||
Sbjct: 467 aacttgatgaaatcagtaatcttgccggtctccagatcaatctgaatggtgtcattcacc 408

                                           
Query: 470 ttgatgagtgggtctgggtagcggatggtgcg 501
           |||||||| || || ||||| |||||||||||
Sbjct: 407 ttgatgaggggatcagggtaacggatggtgcg 376

---

>gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic small ribosomal
           subunit S4 mRNA sequence
          Length = 960

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| ||||||| ||| ||||||||||   ||||||||||||
Sbjct: 729 cttggtggccttgccgatgatgaacacgttagtcagacgggtggc 685

---

>gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribosomal subunit S4
           mRNA sequence
          Length = 755

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 444 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 400

---

>gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein S4 mRNA, complete
           cds
          Length = 789

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 699 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 655

---

>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 191 atggtgagcttgatacccttgcccttggg 219
           |||| |||||||| |||||||||||||||
Sbjct: 674 atggagagcttgacacccttgcccttggg 646

---

>ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small ribosomal subunit S4
           (Afu3g06840) partial mRNA
          Length = 786

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 191 atggtgagcttgatacccttgcccttggg 219
           ||||||||||| | |||||||||||||||
Sbjct: 740 atggtgagcttaacacccttgcccttggg 712

---

>emb|AM048930.1| Mycetophagus quadripustulatus mRNA for ribosomal protein S4e (rpS4e
           gene)
          Length = 786

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 479 gggtctgggtagcggatggtgcggccatc 507
           ||||||||||| ||||||||||| |||||
Sbjct: 455 gggtctgggtaacggatggtgcgtccatc 427

---

>emb|CR938551.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YI07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 747

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 721 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 677

---

>emb|CR938407.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YA05AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 806

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 720 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 676

---

>emb|CR938406.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YA05BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 605

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 296 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 340

---

>emb|CR938380.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB03AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 808

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 722 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 678

---

>emb|CR938366.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB15AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 810

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 235 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 279
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 723 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 679

---

>gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete sequence
          Length = 124792

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 335    ttctccctgttcttgatcaca 355
              |||||||||||||||||||||
Sbjct: 120862 ttctccctgttcttgatcaca 120842

---

>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 199    cttgatacccttgcccttggggagg 223
              ||||| |||||||||||||||||||
Sbjct: 775952 cttgacacccttgcccttggggagg 775976

---

>gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:92076 IMAGE:7046733), complete cds
          Length = 888

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 45/54 (83%)
 Strand = Plus / Minus

                                                                 
Query: 454 gatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcggccatc 507
           |||||||||  || ||||||| || || || ||||| |||||||||||| ||||
Sbjct: 487 gatggtgtcgttgaccttgatcagaggatcagggtaacggatggtgcgggcatc 434

---

>ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1), mRNA
          Length = 2945

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 247  gccaatggtgaacacgttgc 266
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789

---

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 196     gagcttgatacccttgcccttggg 219
               |||||||| |||||||||||||||
Sbjct: 1677741 gagcttgacacccttgcccttggg 1677718



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                       
Query: 380     ccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgtt 435
               ||||| |||||||||||||| |||   ||||||||||||  |||||| || |||||
Sbjct: 1677506 ccagtaaccatgacgacgtttccgggctcaaacttgatgtggtcaacgattttgtt 1677451

---

>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence
          Length = 197827

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   cttcctctgctcctcaatga 191
             ||||||||||||||||||||
Sbjct: 23788 cttcctctgctcctcaatga 23769

---

>gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence
          Length = 160031

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   tccctcttcctctgctcctc 186
             ||||||||||||||||||||
Sbjct: 75373 tccctcttcctctgctcctc 75392

---

>gb|AF359361.3| Gibberella zeae strain GZ3639 trichothecene gene cluster, complete
             sequence
          Length = 57840

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 355   accaacacgcccagtgttgc 374
             ||||||||||||||||||||
Sbjct: 18319 accaacacgcccagtgttgc 18300

---

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     ggttccaggaacatagttct 86
              ||||||||||||||||||||
Sbjct: 192051 ggttccaggaacatagttct 192032

---

>ref|XM_383708.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03532.1)
           partial mRNA
          Length = 1338

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 355 accaacacgcccagtgttgc 374
           ||||||||||||||||||||
Sbjct: 574 accaacacgcccagtgttgc 593

---

>ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNA06200) partial mRNA
          Length = 840

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 196 gagcttgatacccttgcccttggg 219
           |||||||| |||||||||||||||
Sbjct: 738 gagcttgacacccttgcccttggg 715



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 380 ccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgtt 435
           ||||| |||||||||||||| |||   ||||||||||||  |||||| || |||||
Sbjct: 554 ccagtaaccatgacgacgtttccgggctcaaacttgatgtggtcaacgattttgtt 499

---

>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence
          Length = 156239

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   ctcttcctctgctcctcaat 189
             ||||||||||||||||||||
Sbjct: 47354 ctcttcctctgctcctcaat 47335

---

>ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (rps4x), mRNA
          Length = 888

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 45/54 (83%)
 Strand = Plus / Minus

                                                                 
Query: 454 gatggtgtcnntggccttgatgagtgggtctgggtagcggatggtgcggccatc 507
           |||||||||  || ||||||| || || || ||||| |||||||||||| ||||
Sbjct: 487 gatggtgtcgttgaccttgatcagaggatcagggtaacggatggtgcgggcatc 434

---

>gb|AY231807.1| Drosophila yakuba clone yak-em_RpS4 mRNA sequence
          Length = 450

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 485 gggtagcggatggtgcggcc 504
           ||||||||||||||||||||
Sbjct: 449 gggtagcggatggtgcggcc 430

---

>gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRNA (cDNA clone
           MGC:34152 IMAGE:5198480), complete cds
          Length = 1554

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 133 gaatcaggccttggcagcagcctg 156
           |||||||||||||||||| |||||
Sbjct: 421 gaatcaggccttggcagccgcctg 398

---

>emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227D1 on chromosome X Contains
             part of the IL1RAPL2 gene for interleukin 1 receptor
             accessory protein-like 2, complete sequence
          Length = 33667

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 319   aaaggttcccttatgcttct 338
             ||||||||||||||||||||
Sbjct: 13597 aaaggttcccttatgcttct 13578


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,107,868
Number of Sequences: 3902068
Number of extensions: 4107868
Number of successful extensions: 85772
Number of sequences better than 10.0: 280
Number of HSP's better than 10.0 without gapping: 278
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 85093
Number of HSP's gapped (non-prelim): 645
length of query: 514
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 491
effective length of database: 17,143,297,704
effective search space: 8417359172664
effective search space used: 8417359172664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---