>gb|AY591266.1| Digitalis lutea subsp. lutea 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal
RNA gene, and internal transcribed spacer 2, complete
sequence; and 26S ribosomal RNA gene, partial sequence
Length = 715
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 115 caagcaagcatggtgatctaaa 94
>gb|AY591265.1| Digitalis lutea subsp. australis 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal
RNA gene, and internal transcribed spacer 2, complete
sequence; and 26S ribosomal RNA gene, partial sequence
Length = 715
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 115 caagcaagcatggtgatctaaa 94
>gb|AY591263.1| Digitalis atlantica 18S ribosomal RNA gene, partial sequence;
internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence;
and 26S ribosomal RNA gene, partial sequence
Length = 715
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 115 caagcaagcatggtgatctaaa 94
>gb|AY591261.1| Digitalis grandiflora 18S ribosomal RNA gene, partial sequence;
internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence;
and 26S ribosomal RNA gene, partial sequence
Length = 716
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 115 caagcaagcatggtgatctaaa 94
>gb|AY591259.1| Digitalis mariana subsp. mariana 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal
RNA gene, and internal transcribed spacer 2, complete
sequence; and 26S ribosomal RNA gene, partial sequence
Length = 718
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 116 caagcaagcatggtgatctaaa 95
>gb|AY591258.1| Digitalis purpurea subsp. toletana 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal
RNA gene, and internal transcribed spacer 2, complete
sequence; and 26S ribosomal RNA gene, partial sequence
Length = 718
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 116 caagcaagcatggtgatctaaa 95
>gb|AY591257.1| Digitalis purpurea subsp. purpurea 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal
RNA gene, and internal transcribed spacer 2, complete
sequence; and 26S ribosomal RNA gene, partial sequence
Length = 717
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 116 caagcaagcatggtgatctaaa 95
>gb|AY591256.1| Digitalis thapsi 18S ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and
internal transcribed spacer 2, complete sequence; and
26S ribosomal RNA gene, partial sequence
Length = 718
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 116 caagcaagcatggtgatctaaa 95
>gb|AY492102.1| Digitalis purpurea 18S ribosomal RNA gene, partial sequence;
internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence;
and 26S ribosomal RNA gene, partial sequence
Length = 646
Score = 36.2 bits (18), Expect = 4.6
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 15 caagcaaccatggtgatctaaa 36
||||||| ||||||||||||||
Sbjct: 142 caagcaagcatggtgatctaaa 121
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 257,629
Number of Sequences: 3902068
Number of extensions: 257629
Number of successful extensions: 73214
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73195
Number of HSP's gapped (non-prelim): 19
length of query: 41
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 21
effective length of database: 17,155,003,908
effective search space: 360255082068
effective search space used: 360255082068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)