ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3d07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC132083.3| Mus musculus BAC clone RP24-540G23 from chromosom... 48 0.031
2emb|CR751236.6| Zebrafish DNA sequence from clone DKEY-27M6 in l... 48 0.031
3gb|AC161462.5| Gallus gallus BAC clone CH261-174G12 from chromos... 48 0.031
4ref|XM_648428.1| Entamoeba histolytica HM-1:IMSS myotubularin (8... 44 0.49
5gb|AC004932.4| Homo sapiens PAC clone RP5-943F2 from 7, complete... 44 0.49
6emb|BX005126.10| Zebrafish DNA sequence from clone CH211-129O9 i... 44 0.49
7dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113 44 0.49
8emb|BX547938.9| Zebrafish DNA sequence from clone DKEY-85K8 in l... 44 0.49
9emb|AL121809.6|CNS01DSK Human chromosome 14 DNA sequence BAC C-3... 44 0.49
10emb|CR391904.14| Zebrafish DNA sequence from clone DKEY-165J6 in... 42 1.9
11gb|AC002454.1| Homo sapiens BAC clone GS1-552A1 from 7, complete... 42 1.9
12gb|AC146789.30| Medicago truncatula clone mth2-71h24, complete s... 42 1.9
13emb|Z80232.1|HS463A9 Human DNA sequence from clone RP3-463A9 on ... 42 1.9
14emb|AL590623.16| Human DNA sequence from clone RP11-96F8 on chro... 42 1.9
15emb|AL450384.34| Human DNA sequence from clone RP11-383B4 on chr... 42 1.9
16emb|AL139041.17| Human DNA sequence from clone RP11-408O19 on ch... 42 1.9
17emb|AL137881.12| Human DNA sequence from clone RP11-40A8 on chro... 42 1.9
18emb|AL133216.10| Human DNA sequence from clone RP11-291L22 on ch... 42 1.9
19ref|NG_000880.1| Homo sapiens arylsulfatase E pseudogene (ARSEP)... 42 1.9
20gb|AC151799.2| Pan troglodytes BAC clone RP43-44D10 from chromos... 42 1.9
21gb|AC011293.5|AC011293 Homo sapiens BAC clone RP11-75F5 from Y, ... 42 1.9
22gb|AC118282.4| Homo sapiens BAC clone RP11-1281K21 from 4, compl... 42 1.9
23gb|AC119751.3| Homo sapiens BAC clone RP11-241F15 from 4, comple... 42 1.9
24gb|AC002086.1|AC002086 Human PAC clone RP3-525N14 from Xq23, com... 42 1.9
25gb|AC002992.1|AC002992 Homo sapiens chromosome Y, clone 203M13, ... 42 1.9
26emb|BX005375.9| Zebrafish DNA sequence from clone CH211-207N2 in... 42 1.9
27emb|AL935294.6| Zebrafish DNA sequence from clone CH211-239I4, c... 42 1.9
28emb|AL772342.12| Mouse DNA sequence from clone RP23-105D19 on ch... 42 1.9
29gb|AC110222.9| Mus musculus chromosome 3, clone RP24-211P23, com... 40 7.6
30ref|XM_631115.1| Dictyostelium discoideum hypothetical protein (... 40 7.6
31ref|XM_514859.1| PREDICTED: Pan troglodytes T-cell lymphoma inva... 40 7.6
32ref|XM_531420.1| PREDICTED: Pan troglodytes T-cell lymphoma inva... 40 7.6
33gb|AC132583.3| Mus musculus BAC clone RP24-339P17 from chromosom... 40 7.6
34gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence 40 7.6
35gb|AC104642.11| Trypanosoma brucei chromosome 3 clone RPCI93-27C... 40 7.6
36gb|AC154882.11| Mus musculus chromosome 3, clone RP24-187P10, co... 40 7.6
37gb|AC102999.7| Rattus norvegicus 7 BAC CH230-33J22 (Children's H... 40 7.6
38ref|XM_458553.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 7.6
39ref|XM_322233.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.6
40ref|XM_951568.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.6
41gb|AC112081.8| Rattus norvegicus 7 BAC CH230-192B8 (Children's H... 40 7.6
42gb|AC118606.13| Mus musculus chromosome 5, clone RP24-69F9, comp... 40 7.6
43gb|DP000012.1| Macropus eugenii target 1 genomic scaffold 40 7.6
44gb|AF530594.1| Petunia integrifolia subsp. inflata putative nitr... 40 7.6
45gb|AC175749.2| Pan troglodytes BAC clone CH251-1124N9 from chrom... 40 7.6
46gb|AC144861.3| Mus musculus BAC clone RP23-63D4 from chromosome ... 40 7.6
47gb|AC125098.4| Mus musculus BAC clone RP24-195M13 from chromosom... 40 7.6
48gb|AC124579.3| Mus musculus BAC clone RP23-86P2 from chromosome ... 40 7.6
49emb|BX897727.17| Zebrafish DNA sequence from clone DKEY-90A13 in... 40 7.6
50gb|AC124708.2| Mus musculus BAC clone RP24-79O16 from 6, complet... 40 7.6
51gb|AC004986.2| Homo sapiens PAC clone RP5-1166A24 from 7, comple... 40 7.6
52gb|AC142287.1| Pan troglodytes BAC clone RP43-169H12 from 7, com... 40 7.6
53gb|AC146788.13| Medicago truncatula clone mth2-11a6, complete se... 40 7.6
54gb|AC162370.4| Mus musculus chromosome 7, clone RP23-32F4, compl... 40 7.6
55gb|AC139525.3| Medicago truncatula clone mth2-26o22, complete se... 40 7.6
56gb|AF254982.4| Homo sapiens chromosome 21 clone CTD-2503J9 map p... 40 7.6
57gb|AE014823.1| Plasmodium falciparum 3D7 chromosome 14 section 8... 40 7.6
58emb|AL359012.7| Human DNA sequence from clone RP11-339I10 on chr... 40 7.6
59emb|AL356266.9| Human DNA sequence from clone RP11-347N5 on chro... 40 7.6
60emb|Z67753.1|OSCHLPLXX Odontella sinensis complete chloroplast g... 40 7.6
61emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 40 7.6
62emb|AL596167.1| Listeria innocua Clip11262 complete genome, segm... 40 7.6
63gb|AC116904.7| Homo sapiens chromosome 18, clone RP11-1112M8, co... 40 7.6
64gb|AC131888.1| Homo sapiens chromosome 16 clone RP11-626G3, comp... 40 7.6
65gb|BC070106.1| Homo sapiens cDNA clone IMAGE:30343207 40 7.6
66gb|AC158757.6| Mus musculus chromosome 5, clone RP23-64D3, compl... 40 7.6
67gb|AC099845.2| Homo sapiens chromosome 18, clone RP11-812D21, co... 40 7.6
68gb|AC010573.4| Drosophila melanogaster 3L BAC RP98-2M13 (Roswell... 40 7.6
69dbj|AK125748.1| Homo sapiens cDNA FLJ43760 fis, clone TESTI2048105 40 7.6
70ref|NM_003253.1| Homo sapiens T-cell lymphoma invasion and metas... 40 7.6
71gb|AC104703.3| Drosophila melanogaster 3L BAC RP98-35M1 (Roswell... 40 7.6
72dbj|AK093430.1| Homo sapiens cDNA FLJ36111 fis, clone TESTI2021999 40 7.6
73gb|AC009986.10| Homo sapiens chromosome 10 clone RP11-346D6, com... 40 7.6
74gb|AC026123.24| Homo sapiens 16 BAC RP11-174D5 (Roswell Park Can... 40 7.6
75gb|AC096571.1| Homo sapiens BAC clone RP11-395B18 from 4, comple... 40 7.6
76gb|AC097657.3| Homo sapiens BAC clone RP11-362J18 from 4, comple... 40 7.6
77gb|AC183493.1| Brassica oleracea Contig B, complete sequence 40 7.6
78dbj|AK147329.1| Mus musculus cDNA, RIKEN full-length enriched li... 40 7.6
79gb|AC020632.16| Homo sapiens 3 BAC RP11-333H9 (Roswell Park Canc... 40 7.6
80dbj|AK147579.1| Mus musculus cDNA, RIKEN full-length enriched li... 40 7.6
81gb|AC022880.10| Homo sapiens chromosome , clone RP11-436P7, comp... 40 7.6
82gb|AC090599.4| Homo sapiens chromosome 11, clone RP11-674E24, co... 40 7.6
83gb|AC090712.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 7.6
84gb|AC034199.6| Homo sapiens chromosome 5 clone CTB-114C7, comple... 40 7.6
85gb|AC009704.8| Homo sapiens chromosome 18, clone RP11-231E4, com... 40 7.6
86gb|AC069323.5|AC069323 Homo sapiens BAC clone RP11-1126J10 from ... 40 7.6
87ref|XM_395309.2| PREDICTED: Apis mellifera similar to DNop5 prot... 40 7.6
88dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
89gb|AC073599.16|AC073599 Mus musculus 7 BAC RP23-8M3 (Roswell Par... 40 7.6
90gb|AC137499.2| Homo sapiens chromosome 16 clone RP11-317D10, com... 40 7.6
91gb|AC124446.3| Mus musculus BAC clone RP24-201I19 from chromosom... 40 7.6
92gb|AC009134.6|AC009134 Homo sapiens chromosome 16 clone RP11-505... 40 7.6
93gb|AC112933.16| Mus musculus chromosome 5, clone RP24-418J2, com... 40 7.6
94emb|BX005073.7| Zebrafish DNA sequence from clone CH211-129N18, ... 40 7.6
95dbj|BS000111.1| Pan troglodytes chromosome 22 clone:PTB-093K04, ... 40 7.6
96emb|AL807769.8| Zebrafish DNA sequence from clone CH211-197G8, c... 40 7.6
97gb|AC007344.3|AC007344 Homo sapiens chromosome 16 clone RPCI-11_... 40 7.6
98gb|U91325.1|HSU91325 Human chromosome 16p13.11 BAC clone CIT987S... 40 7.6
99gb|AC145042.3| Macropus eugenii clone ME_KBa-289E24, complete se... 40 7.6
100emb|CR962124.2| Medicago truncatula chromosome 5 clone mth2-44c1... 40 7.6
101gb|AE003535.3| Drosophila melanogaster chromosome 3L, section 50... 40 7.6
102dbj|AP001710.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 7.6
103dbj|AK122490.1| Mus musculus mRNA for mKIAA1302 protein 40 7.6
104dbj|AP000247.2| Homo sapiens genomic DNA, chromosome 21q, clone:... 40 7.6
105gb|AC151349.2| Xenopus tropicalis clone ISB-39N3, complete sequence 40 7.6
106gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.6
107emb|BX000495.1|CNS08CDL Oryza sativa chromosome 12, . BAC OSJNBb... 40 7.6
108emb|AL845437.14| Zebrafish DNA sequence from clone DKEY-98J1 in ... 40 7.6
109ref|NM_080888.1| Rattus norvegicus BCL2/adenovirus E1B 19 kDa-in... 40 7.6
110gb|U16296.1|HSU16296 Human T-lymphoma invasion and metastasis in... 40 7.6
111dbj|AB077364.1| Rattus norvegicus NIP3L mRNA for nineteen kD int... 40 7.6
112gb|L11364.1|MUSTSINTR4 Mus musculus thymidylate synthase gene, i... 40 7.6
113dbj|AP000209.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 7.6

>gb|AC132083.3| Mus musculus BAC clone RP24-540G23 from chromosome 5, complete sequence
          Length = 158764

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 522    ctttccagagcaatacaatgaaat 545
              ||||||||||||||||||||||||
Sbjct: 102570 ctttccagagcaatacaatgaaat 102593



to top

>emb|CR751236.6| Zebrafish DNA sequence from clone DKEY-27M6 in linkage group 23,
             complete sequence
          Length = 108342

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 525   tccagagcaatacaatgaaatgaaatggaatg 556
             ||||||||||| ||||||||||||||| ||||
Sbjct: 52695 tccagagcaatgcaatgaaatgaaatgcaatg 52664



to top

>gb|AC161462.5| Gallus gallus BAC clone CH261-174G12 from chromosome ul, complete
              sequence
          Length = 238858

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 294    agtttctaatttgtgtttttctttctta 321
              |||||||||||||||||||| |||||||
Sbjct: 131527 agtttctaatttgtgtttttttttctta 131554



to top

>ref|XM_648428.1| Entamoeba histolytica HM-1:IMSS myotubularin (80.t00027)  partial
            mRNA
          Length = 2790

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 484  ttttctccataaaactggtgcttgct 509
            ||||||||||||||||||| ||||||
Sbjct: 2754 ttttctccataaaactggtacttgct 2729



to top

>gb|AC004932.4| Homo sapiens PAC clone RP5-943F2 from 7, complete sequence
          Length = 151183

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 135   aagaaaaagaaatctcaacctc 156
             ||||||||||||||||||||||
Sbjct: 45355 aagaaaaagaaatctcaacctc 45376



to top

>emb|BX005126.10| Zebrafish DNA sequence from clone CH211-129O9 in linkage group 5,
              complete sequence
          Length = 160487

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 300    taatttgtgtttttctttctta 321
              ||||||||||||||||||||||
Sbjct: 156578 taatttgtgtttttctttctta 156557



to top

>dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113
          Length = 1841713

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 131     tgagaagaaaaagaaatctcaa 152
               ||||||||||||||||||||||
Sbjct: 1242119 tgagaagaaaaagaaatctcaa 1242098



to top

>emb|BX547938.9| Zebrafish DNA sequence from clone DKEY-85K8 in linkage group 5,
             complete sequence
          Length = 162785

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 300   taatttgtgtttttctttctta 321
             ||||||||||||||||||||||
Sbjct: 50337 taatttgtgtttttctttctta 50358



to top

>emb|AL121809.6|CNS01DSK Human chromosome 14 DNA sequence BAC C-3028N15 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 213442

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 293   tagtttctaatttgtgtttttctttc 318
             ||||||| ||||||||||||||||||
Sbjct: 65180 tagtttcaaatttgtgtttttctttc 65155



to top

>emb|CR391904.14| Zebrafish DNA sequence from clone DKEY-165J6 in linkage group 3,
             complete sequence
          Length = 147391

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 90    attgttgcagttccagtggcc 110
             |||||||||||||||||||||
Sbjct: 58499 attgttgcagttccagtggcc 58519



to top

>gb|AC002454.1| Homo sapiens BAC clone GS1-552A1 from 7, complete sequence
          Length = 172983

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 158    atctccatggaaggcaagtgg 178
              |||||||||||||||||||||
Sbjct: 171935 atctccatggaaggcaagtgg 171955



to top

>gb|AC146789.30| Medicago truncatula clone mth2-71h24, complete sequence
          Length = 127922

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 240   cgaggaaactgttttgccttcaata 264
             ||||||||| |||||||||||||||
Sbjct: 59888 cgaggaaaccgttttgccttcaata 59864



to top

>emb|Z80232.1|HS463A9 Human DNA sequence from clone RP3-463A9 on chromosome X Contains part
             of the COVA1 gene for cytosolic ovarian carcinoma antigen
             1, complete sequence
          Length = 101196

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 122   gcttacttctgagaagaaaaa 142
             |||||||||||||||||||||
Sbjct: 91366 gcttacttctgagaagaaaaa 91346



to top

>emb|AL590623.16| Human DNA sequence from clone RP11-96F8 on chromosome 10 Contains a
             N-acetylated alpha-linked acidic dipeptidase 2 (NAALAD2)
             pseudogene, complete sequence
          Length = 81908

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 533   aatacaatgaaatgaaatggaatgg 557
             ||||||||| |||||||||||||||
Sbjct: 17210 aatacaatggaatgaaatggaatgg 17186



to top

>emb|AL450384.34| Human DNA sequence from clone RP11-383B4 on chromosome 10 Contains the
             3' end of the CACNB2 gene for calcium channel
             voltage-dependent beta 2 subunit, the 5' end of a novel
             gene, a novel gene and the 3' end of a novel gene
             (LOC221078) (FLJ23743), complete sequence
          Length = 124571

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 533   aatacaatgaaatgaaatggaatgg 557
             |||| ||||||||||||||||||||
Sbjct: 48185 aatagaatgaaatgaaatggaatgg 48209



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 533   aatacaatgaaatgaaatggaatgg 557
             |||| ||||||||||||||||||||
Sbjct: 47823 aatagaatgaaatgaaatggaatgg 47847



to top

>emb|AL139041.17| Human DNA sequence from clone RP11-408O19 on chromosome 9p11.2-21
              Contains the 3' end of the gene for a novel protein similar
              to sorting nexin 7 (SNX7), the TSCOT gene for thymic
              stromal co-transporter, a pseudogene similar to Mus
              musculus major urinary proteins and a CpG island, complete
              sequence
          Length = 141659

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 193    cataaaagagaagatccaaag 213
              |||||||||||||||||||||
Sbjct: 120808 cataaaagagaagatccaaag 120788



to top

>emb|AL137881.12| Human DNA sequence from clone RP11-40A8 on chromosome 13 Contains a
             novel gene, the 3' end of the GUCY1B2 gene for guanylate
             cyclase 1 soluble beta 2 and  a CpG island, complete
             sequence
          Length = 143324

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 307   tgtttttctttcttacatgca 327
             |||||||||||||||||||||
Sbjct: 41617 tgtttttctttcttacatgca 41637



to top

>emb|AL133216.10| Human DNA sequence from clone RP11-291L22 on chromosome 10 Contains the
              3' end of a gene for a novel protein similar to
              17-beta-hydroxysteroid dehydrogenase type 7 (HSD17B7), the
              gene for a novel protein similar to CDC10 cell division
              cycle 10, homolog (S. cerevisiae) (CDC10), a novel gene, a
              novel gene containing FLJ14186, a capicua homolog
              (Drosophila) (CIC) pseudogene and a CpG island, complete
              sequence
          Length = 166835

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 538    aatgaaatgaaatggaatggt 558
              |||||||||||||||||||||
Sbjct: 161372 aatgaaatgaaatggaatggt 161392



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 538    aatgaaatgaaatggaatgg 557
              ||||||||||||||||||||
Sbjct: 132035 aatgaaatgaaatggaatgg 132054



to top

>ref|NG_000880.1| Homo sapiens arylsulfatase E pseudogene (ARSEP) on chromosome Y
          Length = 15462

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 504   cttgctggtgaatggcatctt 524
             |||||||||||||||||||||
Sbjct: 14935 cttgctggtgaatggcatctt 14915



to top

>gb|AC151799.2| Pan troglodytes BAC clone RP43-44D10 from chromosome 7, complete
             sequence
          Length = 183888

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 158   atctccatggaaggcaagtgg 178
             |||||||||||||||||||||
Sbjct: 22630 atctccatggaaggcaagtgg 22610



to top

>gb|AC011293.5|AC011293 Homo sapiens BAC clone RP11-75F5 from Y, complete sequence
          Length = 159722

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 537   caatgaaatgaaatggaatgg 557
             |||||||||||||||||||||
Sbjct: 16960 caatgaaatgaaatggaatgg 16980



to top

>gb|AC118282.4| Homo sapiens BAC clone RP11-1281K21 from 4, complete sequence
          Length = 208765

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 533   aatacaatgaaatgaaatggaatgg 557
             ||||||||| |||||||||||||||
Sbjct: 60115 aatacaatggaatgaaatggaatgg 60091



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 533   aatacaatgaaatgaaatggaatgg 557
             ||||||||| |||||||||||||||
Sbjct: 52288 aatacaatggaatgaaatggaatgg 52264



to top

>gb|AC119751.3| Homo sapiens BAC clone RP11-241F15 from 4, complete sequence
          Length = 171176

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 533    aatacaatgaaatgaaatggaatgg 557
              ||||||||| |||||||||||||||
Sbjct: 167651 aatacaatggaatgaaatggaatgg 167675



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 533    aatacaatgaaatgaaatggaatgg 557
              ||||||||| |||||||||||||||
Sbjct: 160193 aatacaatggaatgaaatggaatgg 160217



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 538    aatgaaatgaaatggaatgg 557
              ||||||||||||||||||||
Sbjct: 163560 aatgaaatgaaatggaatgg 163579



to top

>gb|AC002086.1|AC002086 Human PAC clone RP3-525N14 from Xq23, complete sequence
          Length = 112686

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 295    gtttctaatttgtgtttttct 315
              |||||||||||||||||||||
Sbjct: 111376 gtttctaatttgtgtttttct 111356



to top

>gb|AC002992.1|AC002992 Homo sapiens chromosome Y, clone 203M13, complete sequence
          Length = 154848

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 504   cttgctggtgaatggcatctt 524
             |||||||||||||||||||||
Sbjct: 43802 cttgctggtgaatggcatctt 43782



to top

>emb|BX005375.9| Zebrafish DNA sequence from clone CH211-207N2 in linkage group 17,
             complete sequence
          Length = 214178

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 297   ttctaatttgtgtttttctttctta 321
             ||||||||||||||||||| |||||
Sbjct: 26578 ttctaatttgtgtttttctatctta 26602



to top

>emb|AL935294.6| Zebrafish DNA sequence from clone CH211-239I4, complete sequence
          Length = 168302

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 78    actgaatgaatgattgttgca 98
             |||||||||||||||||||||
Sbjct: 16968 actgaatgaatgattgttgca 16988



to top

>emb|AL772342.12| Mouse DNA sequence from clone RP23-105D19 on chromosome 2, complete
              sequence
          Length = 206806

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 34     aaagagcatgtaaagtttcct 54
              |||||||||||||||||||||
Sbjct: 154621 aaagagcatgtaaagtttcct 154601



to top

>gb|AC110222.9| Mus musculus chromosome 3, clone RP24-211P23, complete sequence
          Length = 179958

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 301    aatttgtgtttttctttctt 320
              ||||||||||||||||||||
Sbjct: 175116 aatttgtgtttttctttctt 175135



to top

>ref|XM_631115.1| Dictyostelium discoideum hypothetical protein (DDB0188426), partial
           mRNA
          Length = 774

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 302 atttgtgtttttctttctta 321
           ||||||||||||||||||||
Sbjct: 447 atttgtgtttttctttctta 428



to top

>ref|XM_514859.1| PREDICTED: Pan troglodytes T-cell lymphoma invasion and metastasis
           1 (LOC458503), mRNA
          Length = 4297

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 482 gcttttctccataaaactggtgct 505
           |||||||||||||||||| |||||
Sbjct: 52  gcttttctccataaaactcgtgct 29



to top

>ref|XM_531420.1| PREDICTED: Pan troglodytes T-cell lymphoma invasion and metastasis
           1 (LOC473949), mRNA
          Length = 3901

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 482 gcttttctccataaaactggtgct 505
           |||||||||||||||||| |||||
Sbjct: 52  gcttttctccataaaactcgtgct 29



to top

>gb|AC132583.3| Mus musculus BAC clone RP24-339P17 from chromosome 3, complete
            sequence
          Length = 153573

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 301  aatttgtgtttttctttctt 320
            ||||||||||||||||||||
Sbjct: 4621 aatttgtgtttttctttctt 4640



to top

>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence
          Length = 1653225

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 538    aatgaaatgaaatggaatgg 557
              ||||||||||||||||||||
Sbjct: 782800 aatgaaatgaaatggaatgg 782819



to top

>gb|AC104642.11| Trypanosoma brucei chromosome 3 clone RPCI93-27C5, complete sequence
          Length = 126762

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 91748 aatgaaatgaaatggaatgg 91767



to top

>gb|AC154882.11| Mus musculus chromosome 3, clone RP24-187P10, complete sequence
          Length = 175586

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 301    aatttgtgtttttctttctt 320
              ||||||||||||||||||||
Sbjct: 109961 aatttgtgtttttctttctt 109942



to top

>gb|AC102999.7| Rattus norvegicus 7 BAC CH230-33J22 (Children's Hospital Oakland
           Research Institute) complete sequence
          Length = 209654

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 528 agagcaatacaatgaaatga 547
           ||||||||||||||||||||
Sbjct: 708 agagcaatacaatgaaatga 689



to top

>ref|XM_458553.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0D02651g)
            partial mRNA
          Length = 5430

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 535  tacaatgaaatgaaatggaa 554
            ||||||||||||||||||||
Sbjct: 2824 tacaatgaaatgaaatggaa 2843



to top

>ref|XM_322233.1| Neurospora crassa OR74A hypothetical protein (NCU00148.1) partial
            mRNA
          Length = 1101

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 147  tctcaacctccatctccatg 166
            ||||||||||||||||||||
Sbjct: 1075 tctcaacctccatctccatg 1056



to top

>ref|XM_951568.1| Neurospora crassa OR74A hypothetical protein (NCU00148.1) partial
            mRNA
          Length = 1101

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 147  tctcaacctccatctccatg 166
            ||||||||||||||||||||
Sbjct: 1075 tctcaacctccatctccatg 1056



to top

>gb|AC112081.8| Rattus norvegicus 7 BAC CH230-192B8 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 150311

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 528    agagcaatacaatgaaatga 547
              ||||||||||||||||||||
Sbjct: 149019 agagcaatacaatgaaatga 149000



to top

>gb|AC118606.13| Mus musculus chromosome 5, clone RP24-69F9, complete sequence
          Length = 208384

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 281    agcaaaacactctagtttct 300
              ||||||||||||||||||||
Sbjct: 112856 agcaaaacactctagtttct 112875



to top

>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 448     tcaatgaaatgtcaggtttc 467
               ||||||||||||||||||||
Sbjct: 1632095 tcaatgaaatgtcaggtttc 1632076



to top

>gb|AF530594.1| Petunia integrifolia subsp. inflata putative nitrate-induced NOI
            protein (S1-G261) gene, complete cds
          Length = 3077

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 536  acaatgaaatgaaatggaatggtg 559
            ||||||||| ||||||||||||||
Sbjct: 1096 acaatgaaaggaaatggaatggtg 1073



to top

>gb|AC175749.2| Pan troglodytes BAC clone CH251-1124N9 from chromosome y, complete
            sequence
          Length = 176979

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 538  aatgaaatgaaatggaatgg 557
            ||||||||||||||||||||
Sbjct: 5967 aatgaaatgaaatggaatgg 5986



to top

>gb|AC144861.3| Mus musculus BAC clone RP23-63D4 from chromosome 18, complete sequence
          Length = 176312

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 536    acaatgaaatgaaatggaat 555
              ||||||||||||||||||||
Sbjct: 121900 acaatgaaatgaaatggaat 121881



to top

>gb|AC125098.4| Mus musculus BAC clone RP24-195M13 from chromosome 16, complete
             sequence
          Length = 182685

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 232   aaggtcaccgaggaaactgt 251
             ||||||||||||||||||||
Sbjct: 37915 aaggtcaccgaggaaactgt 37934



to top

>gb|AC124579.3| Mus musculus BAC clone RP23-86P2 from chromosome 13, complete sequence
          Length = 167801

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 498    ctggtgcttgctggtgaatg 517
              ||||||||||||||||||||
Sbjct: 150037 ctggtgcttgctggtgaatg 150056



to top

>emb|BX897727.17| Zebrafish DNA sequence from clone DKEY-90A13 in linkage group 23,
              complete sequence
          Length = 236277

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 532    caatacaatgaaatgaaatg 551
              ||||||||||||||||||||
Sbjct: 160264 caatacaatgaaatgaaatg 160245



to top

>gb|AC124708.2| Mus musculus BAC clone RP24-79O16 from 6, complete sequence
          Length = 171638

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 310    ttttctttcttacatgcact 329
              ||||||||||||||||||||
Sbjct: 109152 ttttctttcttacatgcact 109133



to top

>gb|AC004986.2| Homo sapiens PAC clone RP5-1166A24 from 7, complete sequence
          Length = 125290

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   aaaagagaagatccaaagat 215
             ||||||||||||||||||||
Sbjct: 22166 aaaagagaagatccaaagat 22147



to top

>gb|AC142287.1| Pan troglodytes BAC clone RP43-169H12 from 7, complete sequence
          Length = 134577

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 196   aaaagagaagatccaaagat 215
             ||||||||||||||||||||
Sbjct: 99323 aaaagagaagatccaaagat 99342



to top

>gb|AC146788.13| Medicago truncatula clone mth2-11a6, complete sequence
          Length = 116349

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   agtttctaatttgtgttttt 313
             ||||||||||||||||||||
Sbjct: 32121 agtttctaatttgtgttttt 32140



to top

>gb|AC162370.4| Mus musculus chromosome 7, clone RP23-32F4, complete sequence
          Length = 225308

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 301    aatttgtgtttttctttctt 320
              ||||||||||||||||||||
Sbjct: 116846 aatttgtgtttttctttctt 116865



to top

>gb|AC139525.3| Medicago truncatula clone mth2-26o22, complete sequence
          Length = 103039

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 294   agtttctaatttgtgttttt 313
             ||||||||||||||||||||
Sbjct: 87624 agtttctaatttgtgttttt 87605



to top

>gb|AF254982.4| Homo sapiens chromosome 21 clone CTD-2503J9 map p11-q21.1, complete
              sequence
          Length = 211345

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 530    agcaatacaatgaaatgaaatggaatgg 557
              ||||||| |||| |||||||||||||||
Sbjct: 155670 agcaatagaatggaatgaaatggaatgg 155697



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 540    tgaaatgaaatggaatggtg 559
              ||||||||||||||||||||
Sbjct: 111192 tgaaatgaaatggaatggtg 111211



to top

>gb|AE014823.1| Plasmodium falciparum 3D7 chromosome 14 section 8 of 13 of the complete
             sequence
          Length = 249943

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    acctttatttgctaactgaa 83
             ||||||||||||||||||||
Sbjct: 73267 acctttatttgctaactgaa 73286



to top

>emb|AL359012.7| Human DNA sequence from clone RP11-339I10 on chromosome 13 Contains ESTs,
              STSs and GSSs, complete sequence
          Length = 176446

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 484    ttttctccataaaactggtg 503
              ||||||||||||||||||||
Sbjct: 167156 ttttctccataaaactggtg 167175



to top

>emb|AL356266.9| Human DNA sequence from clone RP11-347N5 on chromosome 13 Contains a
             ribosomal protein L39 (RPL39) pseudogene and the 3' end of
             a novel gene, complete sequence
          Length = 105247

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 459   tcaggtttctacttctacat 478
             ||||||||||||||||||||
Sbjct: 36872 tcaggtttctacttctacat 36853



to top

>emb|Z67753.1|OSCHLPLXX Odontella sinensis complete chloroplast genome
          Length = 119704

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 55    aaaagagaaacctttatttgctaa 78
             |||||| |||||||||||||||||
Sbjct: 81369 aaaagaaaaacctttatttgctaa 81346



to top

>emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS767 of Debaryomyces
              hansenii
          Length = 1602771

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 535    tacaatgaaatgaaatggaa 554
              ||||||||||||||||||||
Sbjct: 171457 tacaatgaaatgaaatggaa 171438



to top

>emb|AL596167.1| Listeria innocua Clip11262 complete genome, segment 5/12
          Length = 253050

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 490   ccataaaactggtgcttgct 509
             ||||||||||||||||||||
Sbjct: 22625 ccataaaactggtgcttgct 22606



to top

>gb|AC116904.7| Homo sapiens chromosome 18, clone RP11-1112M8, complete sequence
          Length = 164394

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    agaaaaagaaatctcaacct 155
              ||||||||||||||||||||
Sbjct: 156645 agaaaaagaaatctcaacct 156626



to top

>gb|AC131888.1| Homo sapiens chromosome 16 clone RP11-626G3, complete sequence
          Length = 162957

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    tttatttgctaactgaatgaatga 90
             |||||| |||||||||||||||||
Sbjct: 74231 tttattggctaactgaatgaatga 74208



to top

>gb|BC070106.1| Homo sapiens cDNA clone IMAGE:30343207
          Length = 3729

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 135  aagaaaaagaaatctcaacc 154
            ||||||||||||||||||||
Sbjct: 1339 aagaaaaagaaatctcaacc 1320



to top

>gb|AC158757.6| Mus musculus chromosome 5, clone RP23-64D3, complete sequence
          Length = 247058

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 96    gcagttccagtggccacctt 115
             ||||||||||||||||||||
Sbjct: 89035 gcagttccagtggccacctt 89054



to top

>gb|AC099845.2| Homo sapiens chromosome 18, clone RP11-812D21, complete sequence
          Length = 189559

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   aatttgtgtttttctttctt 320
             ||||||||||||||||||||
Sbjct: 29467 aatttgtgtttttctttctt 29486



to top

>gb|AC010573.4| Drosophila melanogaster 3L BAC RP98-2M13 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 181927

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 28343 aatgaaatgaaatggaatgg 28362



to top

>dbj|AK125748.1| Homo sapiens cDNA FLJ43760 fis, clone TESTI2048105
          Length = 2123

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcaggtttctacttctacat 478
           ||||||||||||||||||||
Sbjct: 413 tcaggtttctacttctacat 432



to top

>ref|NM_003253.1| Homo sapiens T-cell lymphoma invasion and metastasis 1 (TIAM1),
           mRNA
          Length = 5521

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 482 gcttttctccataaaactggtgct 505
           |||||||||||||||||| |||||
Sbjct: 525 gcttttctccataaaactcgtgct 502



to top

>gb|AC104703.3| Drosophila melanogaster 3L BAC RP98-35M1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 185404

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 15242 aatgaaatgaaatggaatgg 15223



to top

>dbj|AK093430.1| Homo sapiens cDNA FLJ36111 fis, clone TESTI2021999
          Length = 1780

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 459 tcaggtttctacttctacat 478
           ||||||||||||||||||||
Sbjct: 429 tcaggtttctacttctacat 448



to top

>gb|AC009986.10| Homo sapiens chromosome 10 clone RP11-346D6, complete sequence
          Length = 181733

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 194    ataaaagagaagatccaaagatgt 217
              |||||||||||||| |||||||||
Sbjct: 118084 ataaaagagaagattcaaagatgt 118107



to top

>gb|AC026123.24| Homo sapiens 16 BAC RP11-174D5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 170088

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 137    gaaaaagaaatctcaacctc 156
              ||||||||||||||||||||
Sbjct: 135510 gaaaaagaaatctcaacctc 135491



to top

>gb|AC096571.1| Homo sapiens BAC clone RP11-395B18 from 4, complete sequence
          Length = 93638

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 62   aaacctttatttgctaactgaatgaatg 89
            |||| |||||||| ||||||||||||||
Sbjct: 3356 aaacatttatttgttaactgaatgaatg 3383



to top

>gb|AC097657.3| Homo sapiens BAC clone RP11-362J18 from 4, complete sequence
          Length = 159934

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    aaaagagaaacctttatttg 74
             ||||||||||||||||||||
Sbjct: 50110 aaaagagaaacctttatttg 50129



to top

>gb|AC183493.1| Brassica oleracea Contig B, complete sequence
          Length = 284024

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 229   gagaaggtcaccgaggaaac 248
             ||||||||||||||||||||
Sbjct: 24283 gagaaggtcaccgaggaaac 24302



to top

>dbj|AK147329.1| Mus musculus cDNA, RIKEN full-length enriched library,
            clone:M5C1014A21 product:odd Oz/ten-m homolog 4
            (Drosophila), full insert sequence
          Length = 10634

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  aatttgtgtttttctttctt 320
            ||||||||||||||||||||
Sbjct: 8903 aatttgtgtttttctttctt 8884



to top

>gb|AC020632.16| Homo sapiens 3 BAC RP11-333H9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 162029

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 68    ttatttgctaactgaatgaatgattgtt 95
             ||||||| ||||||||||||||| ||||
Sbjct: 53075 ttatttggtaactgaatgaatgaatgtt 53048



to top

>dbj|AK147579.1| Mus musculus cDNA, RIKEN full-length enriched library,
            clone:M5C1082H18 product:odd Oz/ten-m homolog 4
            (Drosophila), full insert sequence
          Length = 10933

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  aatttgtgtttttctttctt 320
            ||||||||||||||||||||
Sbjct: 9202 aatttgtgtttttctttctt 9183



to top

>gb|AC022880.10| Homo sapiens chromosome , clone RP11-436P7, complete sequence
          Length = 166306

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     ttatttgctaactgaatgaa 87
              ||||||||||||||||||||
Sbjct: 106356 ttatttgctaactgaatgaa 106337



to top

>gb|AC090599.4| Homo sapiens chromosome 11, clone RP11-674E24, complete sequence
          Length = 165287

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 536   acaatgaaatgaaatggaat 555
             ||||||||||||||||||||
Sbjct: 26429 acaatgaaatgaaatggaat 26448



to top

>gb|AC090712.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-230F22, complete
              sequence
          Length = 138973

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 310    ttttctttcttacatgcact 329
              ||||||||||||||||||||
Sbjct: 107074 ttttctttcttacatgcact 107093



to top

>gb|AC034199.6| Homo sapiens chromosome 5 clone CTB-114C7, complete sequence
          Length = 122880

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 84048 aatgaaatgaaatggaatgg 84029



to top

>gb|AC009704.8| Homo sapiens chromosome 18, clone RP11-231E4, complete sequence
          Length = 178691

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   agaaaaagaaatctcaacct 155
             ||||||||||||||||||||
Sbjct: 73017 agaaaaagaaatctcaacct 73036



to top

>gb|AC069323.5|AC069323 Homo sapiens BAC clone RP11-1126J10 from Y, complete sequence
          Length = 39401

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 34750 aatgaaatgaaatggaatgg 34731



to top

>ref|XM_395309.2| PREDICTED: Apis mellifera similar to DNop5 protein (LOC411842), mRNA
          Length = 1541

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 133  agaagaaaaagaaatctcaa 152
            ||||||||||||||||||||
Sbjct: 1513 agaagaaaaagaaatctcaa 1532



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 538     aatgaaatgaaatggaatgg 557
               ||||||||||||||||||||
Sbjct: 1156660 aatgaaatgaaatggaatgg 1156679



to top

>gb|AC073599.16|AC073599 Mus musculus 7 BAC RP23-8M3 (Roswell Park Cancer Institute Mouse BAC
            Library) complete sequence
          Length = 226256

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 301  aatttgtgtttttctttctt 320
            ||||||||||||||||||||
Sbjct: 1015 aatttgtgtttttctttctt 1034



to top

>gb|AC137499.2| Homo sapiens chromosome 16 clone RP11-317D10, complete sequence
          Length = 159831

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 24379 aatgaaatgaaatggaatgg 24398



to top

>gb|AC124446.3| Mus musculus BAC clone RP24-201I19 from chromosome 13, complete
             sequence
          Length = 168981

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 498   ctggtgcttgctggtgaatg 517
             ||||||||||||||||||||
Sbjct: 48578 ctggtgcttgctggtgaatg 48597



to top

>gb|AC009134.6|AC009134 Homo sapiens chromosome 16 clone RP11-505I1, complete sequence
          Length = 193236

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 531   gcaatacaatgaaatgaaatggaa 554
             ||||| ||||||||||||||||||
Sbjct: 93659 gcaatgcaatgaaatgaaatggaa 93636



to top

>gb|AC112933.16| Mus musculus chromosome 5, clone RP24-418J2, complete sequence
          Length = 172244

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 96     gcagttccagtggccacctt 115
              ||||||||||||||||||||
Sbjct: 120120 gcagttccagtggccacctt 120139



to top

>emb|BX005073.7| Zebrafish DNA sequence from clone CH211-129N18, complete sequence
          Length = 185849

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  tctaatttgtgtttttcttt 317
            ||||||||||||||||||||
Sbjct: 7395 tctaatttgtgtttttcttt 7376



to top

>dbj|BS000111.1| Pan troglodytes chromosome 22 clone:PTB-093K04, map 22, complete
             sequences
          Length = 184428

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 482   gcttttctccataaaactggtgct 505
             |||||||||||||||||| |||||
Sbjct: 86241 gcttttctccataaaactcgtgct 86264



to top

>emb|AL807769.8| Zebrafish DNA sequence from clone CH211-197G8, complete sequence
          Length = 188344

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 532    caatacaatgaaatgaaatg 551
              ||||||||||||||||||||
Sbjct: 121577 caatacaatgaaatgaaatg 121558



to top

>gb|AC007344.3|AC007344 Homo sapiens chromosome 16 clone RPCI-11_466G2, complete sequence
          Length = 180827

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 137   gaaaaagaaatctcaacctc 156
             ||||||||||||||||||||
Sbjct: 31096 gaaaaagaaatctcaacctc 31077



to top

>gb|U91325.1|HSU91325 Human chromosome 16p13.11 BAC clone CIT987SK-731F11 complete sequence
          Length = 135046

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 531   gcaatacaatgaaatgaaatggaa 554
             ||||| ||||||||||||||||||
Sbjct: 39000 gcaatgcaatgaaatgaaatggaa 39023



to top

>gb|AC145042.3| Macropus eugenii clone ME_KBa-289E24, complete sequence
          Length = 161181

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 448    tcaatgaaatgtcaggtttc 467
              ||||||||||||||||||||
Sbjct: 155076 tcaatgaaatgtcaggtttc 155057



to top

>emb|CR962124.2| Medicago truncatula chromosome 5 clone mth2-44c15, COMPLETE SEQUENCE
          Length = 136068

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 538    aatgaaatgaaatggaatgg 557
              ||||||||||||||||||||
Sbjct: 133228 aatgaaatgaaatggaatgg 133247



to top

>gb|AE003535.3| Drosophila melanogaster chromosome 3L, section 50 of 83 of the complete
             sequence
          Length = 278708

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 10940 aatgaaatgaaatggaatgg 10959



to top

>dbj|AP001710.1| Homo sapiens genomic DNA, chromosome 21q, section 54/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 482    gcttttctccataaaactggtgct 505
              |||||||||||||||||| |||||
Sbjct: 248944 gcttttctccataaaactcgtgct 248967



to top

>dbj|AK122490.1| Mus musculus mRNA for mKIAA1302 protein
          Length = 5583

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 301  aatttgtgtttttctttctt 320
            ||||||||||||||||||||
Sbjct: 3832 aatttgtgtttttctttctt 3813



to top

>dbj|AP000247.2| Homo sapiens genomic DNA, chromosome 21q, clone:RP5-871G18, complete
              sequence
          Length = 113919

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 482    gcttttctccataaaactggtgct 505
              |||||||||||||||||| |||||
Sbjct: 103490 gcttttctccataaaactcgtgct 103513



to top

>gb|AC151349.2| Xenopus tropicalis clone ISB-39N3, complete sequence
          Length = 100129

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 306   gtgtttttctttcttacatg 325
             ||||||||||||||||||||
Sbjct: 71127 gtgtttttctttcttacatg 71108



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 538     aatgaaatgaaatggaatgg 557
               ||||||||||||||||||||
Sbjct: 1156660 aatgaaatgaaatggaatgg 1156679



to top

>emb|BX000495.1|CNS08CDL Oryza sativa chromosome 12, . BAC OSJNBb0119L20 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 126974

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 538   aatgaaatgaaatggaatgg 557
             ||||||||||||||||||||
Sbjct: 95643 aatgaaatgaaatggaatgg 95662



to top

>emb|AL845437.14| Zebrafish DNA sequence from clone DKEY-98J1 in linkage group 23, complete
              sequence
          Length = 239084

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    atctcaacctccatctccat 165
              ||||||||||||||||||||
Sbjct: 232279 atctcaacctccatctccat 232298



to top

>ref|NM_080888.1| Rattus norvegicus BCL2/adenovirus E1B 19 kDa-interacting protein
            3-like (Bnip3l), mRNA
          Length = 3219

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 511  gtgaatggcatctttccaga 530
            ||||||||||||||||||||
Sbjct: 1733 gtgaatggcatctttccaga 1714



to top

>gb|U16296.1|HSU16296 Human T-lymphoma invasion and metastasis inducing TIAM1 protein
           (TIAM1) mRNA, complete cds
          Length = 5521

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 482 gcttttctccataaaactggtgct 505
           |||||||||||||||||| |||||
Sbjct: 525 gcttttctccataaaactcgtgct 502



to top

>dbj|AB077364.1| Rattus norvegicus NIP3L mRNA for nineteen kD interacting protein-3
            like, complete cds
          Length = 3219

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 511  gtgaatggcatctttccaga 530
            ||||||||||||||||||||
Sbjct: 1733 gtgaatggcatctttccaga 1714



to top

>gb|L11364.1|MUSTSINTR4 Mus musculus thymidylate synthase gene, intron 4
          Length = 673

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 96  gcagttccagtggccacctt 115
           ||||||||||||||||||||
Sbjct: 79  gcagttccagtggccacctt 60



to top

>dbj|AP000209.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             f43D11-119B8, segment 7/12, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 482   gcttttctccataaaactggtgct 505
             |||||||||||||||||| |||||
Sbjct: 22932 gcttttctccataaaactcgtgct 22955


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,203,614
Number of Sequences: 3902068
Number of extensions: 8203614
Number of successful extensions: 203855
Number of sequences better than 10.0: 113
Number of HSP's better than 10.0 without gapping: 113
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 202841
Number of HSP's gapped (non-prelim): 1012
length of query: 561
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 538
effective length of database: 17,143,297,704
effective search space: 9223094164752
effective search space used: 9223094164752
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top