Clone Name	rbags3d05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation fact...	771	0.0
2	ref|NM_186038.2| Oryza sativa (japonica cultivar-group), mRNA	246	8e-62
3	ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group...	246	8e-62
4	dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clon...	246	8e-62
5	dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clon...	246	8e-62
6	dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clon...	246	8e-62
7	dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA...	246	8e-62
8	gb|BT016181.1| Zea mays clone Contig14 mRNA sequence	151	3e-33
9	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	121	3e-24
10	dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic D...	121	3e-24
11	gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence	119	1e-23
12	emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elong...	105	2e-19
13	gb|BT016424.1| Zea mays clone Contig257 mRNA sequence	78	4e-11
14	gb|BT016185.1| Zea mays clone Contig18 mRNA sequence	78	4e-11
15	gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence	74	6e-10
16	gb|AY480020.1| Capsicum annuum putative elongation factor 1B alp...	74	6e-10
17	gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated...	70	1e-08
18	gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulate...	70	1e-08
19	gb|AY103717.1| Zea mays PCO098989 mRNA sequence	68	4e-08
20	gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongatio...	62	2e-06
21	gb|DQ191626.1| Solanum tuberosum unknown mRNA	62	2e-06
22	dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongatio...	62	2e-06
23	emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5...	62	2e-06
24	gb|AY111648.1| Zea mays CL2935_1 mRNA sequence	60	9e-06
25	ref|NM_121956.2| Arabidopsis thaliana translation elongation fac...	58	4e-05
26	emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongatio...	58	4e-05
27	gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1...	58	4e-05
28	gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1...	58	4e-05
29	emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Co...	58	4e-05
30	emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Co...	58	4e-05
31	emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Co...	58	4e-05
32	emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Co...	58	4e-05
33	emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Co...	58	4e-05
34	gb|AY909456.1| Siniperca chuatsi clone C279 translation elongati...	58	4e-05
35	gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete s...	58	4e-05
36	gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1	58	4e-05
37	ref|NM_127367.1| Arabidopsis thaliana translation elongation fac...	56	1e-04
38	emb|BX071583.1|CNS09REB Single read from an extremity of a full-...	56	1e-04
39	emb|BX071358.1|CNS09R82 Single read from an extremity of a full-...	56	1e-04
40	emb|BX071357.1|CNS09R81 Single read from an extremity of a full-...	56	1e-04
41	emb|BX068711.1|CNS09P6J Single read from an extremity of a full-...	56	1e-04
42	emb|BX068710.1|CNS09P6I Single read from an extremity of a full-...	56	1e-04
43	emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-...	56	1e-04
44	emb|BX063619.1|CNS09L93 Single read from an extremity of a full-...	56	1e-04
45	emb|BX063618.1|CNS09L92 Single read from an extremity of a full-...	56	1e-04
46	emb|BX063276.1|CNS09KZK Single read from an extremity of a full-...	56	1e-04
47	emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-...	56	1e-04
48	emb|BX053674.1|CNS09DKU Single read from an extremity of a full-...	56	1e-04
49	emb|BX053673.1|CNS09DKT Single read from an extremity of a full-...	56	1e-04
50	emb|BX052417.1|CNS09CLX Single read from an extremity of a full-...	56	1e-04
51	emb|BX052416.1|CNS09CLW Single read from an extremity of a full-...	56	1e-04
52	emb|BX052150.1|CNS09CEI Single read from an extremity of a full-...	56	1e-04
53	emb|BX052149.1|CNS09CEH Single read from an extremity of a full-...	56	1e-04
54	emb|BX052078.1|CNS09CCI Single read from an extremity of a full-...	56	1e-04
55	emb|BX052058.1|CNS09CBY Single read from an extremity of a full-...	56	1e-04
56	emb|BX047220.1|CNS098LK Single read from an extremity of a full-...	56	1e-04
57	emb|BX047219.1|CNS098LJ Single read from an extremity of a full-...	56	1e-04
58	emb|BX046233.1|CNS097U5 Single read from an extremity of a full-...	56	1e-04
59	emb|BX046232.1|CNS097U4 Single read from an extremity of a full-...	56	1e-04
60	emb|BX042348.1|CNS094U8 Single read from an extremity of a full-...	56	1e-04
61	emb|BX042347.1|CNS094U7 Single read from an extremity of a full-...	56	1e-04
62	emb|BX041605.1|CNS0949L Single read from an extremity of a full-...	56	1e-04
63	emb|BX041604.1|CNS0949K Single read from an extremity of a full-...	56	1e-04
64	emb|BX041307.1|CNS0941B Single read from an extremity of a full-...	56	1e-04
65	emb|BX039708.1|CNS092SW Single read from an extremity of a full-...	56	1e-04
66	emb|BX039707.1|CNS092SV Single read from an extremity of a full-...	56	1e-04
67	emb|BX037290.1|CNS090XQ Single read from an extremity of a full-...	56	1e-04
68	emb|BX036523.1|CNS090CF Single read from an extremity of a full-...	56	1e-04
69	emb|BX036522.1|CNS090CE Single read from an extremity of a full-...	56	1e-04
70	emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-...	56	1e-04
71	emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-...	56	1e-04
72	emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-...	56	1e-04
73	emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-...	56	1e-04
74	emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-...	56	1e-04
75	emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-...	56	1e-04
76	emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-...	56	1e-04
77	emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-...	56	1e-04
78	emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-...	56	1e-04
79	emb|BX032179.1|CNS08WZR Single read from an extremity of a full-...	56	1e-04
80	emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-...	56	1e-04
81	emb|BX032163.1|CNS08WZB Single read from an extremity of a full-...	56	1e-04
82	emb|BX029545.1|CNS08UYL Single read from an extremity of a full-...	56	1e-04
83	emb|BX029544.1|CNS08UYK Single read from an extremity of a full-...	56	1e-04
84	emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-...	56	1e-04
85	emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-...	56	1e-04
86	emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-...	56	1e-04
87	emb|BX027135.1|CNS08T3N Single read from an extremity of a full-...	56	1e-04
88	emb|BX027134.1|CNS08T3M Single read from an extremity of a full-...	56	1e-04
89	emb|BX026630.1|CNS08SPM Single read from an extremity of a full-...	56	1e-04
90	emb|BX026629.1|CNS08SPL Single read from an extremity of a full-...	56	1e-04
91	emb|BX026387.1|CNS08SIV Single read from an extremity of a full-...	56	1e-04
92	emb|BX026386.1|CNS08SIU Single read from an extremity of a full-...	56	1e-04
93	emb|BX025444.1|CNS08RSO Single read from an extremity of a full-...	56	1e-04
94	emb|BX025443.1|CNS08RSN Single read from an extremity of a full-...	56	1e-04
95	emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-...	56	1e-04
96	emb|BX024401.1|CNS08QZP Single read from an extremity of a full-...	56	1e-04
97	emb|BX024400.1|CNS08QZO Single read from an extremity of a full-...	56	1e-04
98	emb|BX023680.1|CNS08QFO Single read from an extremity of a full-...	56	1e-04
99	emb|BX023679.1|CNS08QFN Single read from an extremity of a full-...	56	1e-04
100	emb|BX019648.1|CNS08NBO Single read from an extremity of a full-...	56	1e-04
101	emb|BX019647.1|CNS08NBN Single read from an extremity of a full-...	56	1e-04
102	emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-...	56	1e-04
103	emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-...	56	1e-04
104	emb|BX018057.1|CNS08M3H Single read from an extremity of a full-...	56	1e-04
105	emb|BX018056.1|CNS08M3G Single read from an extremity of a full-...	56	1e-04
106	emb|BX016732.1|CNS08L2O Single read from an extremity of a full-...	56	1e-04
107	emb|BX016731.1|CNS08L2N Single read from an extremity of a full-...	56	1e-04
108	emb|BX016339.1|CNS08KRR Single read from an extremity of a full-...	56	1e-04
109	emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-...	56	1e-04
110	emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-...	56	1e-04
111	emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-...	56	1e-04
112	emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-...	56	1e-04
113	emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-...	56	1e-04
114	emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-...	56	1e-04
115	emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-...	56	1e-04
116	emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-...	56	1e-04
117	emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-...	56	1e-04
118	emb|BX010493.1|CNS08G9D Single read from an extremity of a full-...	56	1e-04
119	emb|BX010492.1|CNS08G9C Single read from an extremity of a full-...	56	1e-04
120	emb|BX010211.1|CNS08G1J Single read from an extremity of a full-...	56	1e-04
121	emb|BX010113.1|CNS08FYT Single read from an extremity of a full-...	56	1e-04
122	emb|BX010112.1|CNS08FYS Single read from an extremity of a full-...	56	1e-04
123	emb|BX009646.1|CNS08FLU Single read from an extremity of a full-...	56	1e-04
124	emb|BX008302.1|CNS08EKI Single read from an extremity of a full-...	56	1e-04
125	emb|BX008301.1|CNS08EKH Single read from an extremity of a full-...	56	1e-04
126	gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map...	56	1e-04
127	gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma...	56	1e-04
128	gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1...	56	1e-04
129	gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1...	56	1e-04
130	emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
131	emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
132	emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
133	gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete s...	56	1e-04
134	ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448 ...	56	1e-04
135	gb|DQ191662.1| Solanum tuberosum elongation factor-like protein ...	54	6e-04
136	emb|BX037291.1|CNS090XR Single read from an extremity of a full-...	54	6e-04
137	emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation fa...	54	6e-04
138	gb|AY103716.1| Zea mays PCO118532 mRNA sequence	54	6e-04
139	ref|NM_102762.2| Arabidopsis thaliana translation elongation fac...	52	0.002
140	ref|XM_479153.1| Oryza sativa (japonica cultivar-group), mRNA	52	0.002
141	ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group...	52	0.002
142	gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi...	52	0.002
143	emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Co...	52	0.002
144	emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Co...	52	0.002
145	emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Co...	52	0.002
146	gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F1...	52	0.002
147	dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D...	52	0.002
148	dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongat...	52	0.002
149	dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
150	dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
151	dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
152	dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mR...	52	0.002
153	ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4...	50	0.009
154	ref|XM_654277.1| Aspergillus nidulans FGSC A4 hypothetical prote...	50	0.009
155	ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD...	50	0.009
156	emb|BX927114.16| Zebrafish DNA sequence from clone DKEY-1C7 in l...	50	0.009
157	emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chr...	50	0.009
158	emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor ...	50	0.009
159	gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA...	50	0.009
160	emb|BX883049.1| Rattus norvegicus chromosome 20, major histocomp...	50	0.009
161	dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534	50	0.009
162	emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library	50	0.009
163	emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library	50	0.009
164	emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library	50	0.009
165	emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library	50	0.009
166	emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library	50	0.009
167	emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library	50	0.009
168	emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library	50	0.009
169	emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library	50	0.009
170	gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA...	50	0.009
171	ref|NM_111256.2| Arabidopsis thaliana unknown protein AT3G03850 ...	48	0.036
172	ref|XM_467833.1| Oryza sativa (japonica cultivar-group), mRNA	48	0.036
173	ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM011...	48	0.036
174	gb|BT010920.1| Arabidopsis thaliana At3g03850 mRNA, complete cds	48	0.036
175	gb|AC009540.6|ATAC009540 Arabidopsis thaliana chromosome III BAC...	48	0.036
176	emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-...	48	0.036
177	emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-...	48	0.036
178	emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta	48	0.036
179	gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Can...	48	0.036
180	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	48	0.036
181	emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Co...	48	0.036
182	gb|AC172304.2| Gallus gallus BAC clone CH261-75C12 from chromoso...	48	0.036
183	dbj|AP004774.3| Oryza sativa (japonica cultivar-group) genomic D...	48	0.036
184	dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic D...	48	0.036
185	dbj|AK072544.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.036
186	gb|AC132123.3| Mus musculus BAC clone RP24-79F8 from 1, complete...	48	0.036
187	gb|AC151789.1| Ornithorhynchus anatinus chromosome UNK clone OAB...	46	0.14
188	gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translati...	46	0.14
189	gb|AC115868.12| Mus musculus chromosome 7, clone RP24-329F21, co...	46	0.14
190	gb|AC134886.5| Oryza sativa chromosome 3 BAC OSJNBa0002D18 genom...	46	0.14
191	gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's H...	46	0.14
192	gb|AC116595.4| Mus musculus BAC clone RP24-127G9 from chromosome...	46	0.14
193	gb|AC141927.3| Mus musculus BAC clone RP23-237F16 from chromosom...	46	0.14
194	gb|BC046042.1| Danio rerio eukaryotic translation elongation fac...	46	0.14
195	ref|XM_606509.2| PREDICTED: Bos taurus similar to Proprotein con...	46	0.14
196	gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosom...	46	0.14
197	gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosom...	46	0.14
198	gb|AC068006.10| Mus musculus chromosome 7, clone RP23-6I17, comp...	46	0.14
199	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	46	0.14
200	gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome...	46	0.14
201	emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in...	46	0.14
202	gb|AC117214.3| Mus musculus BAC clone RP23-307B15 from chromosom...	46	0.14
203	gb|AY444796.1| Pisum sativum translational elongation factor 1 s...	46	0.14
204	gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, compl...	46	0.14
205	ref|XM_722910.1| Plasmodium yoelii yoelii str. 17XNL hypothetica...	46	0.14
206	gb|AC107662.9| Mus musculus chromosome 9, clone RP23-99B22, comp...	46	0.14
207	ref|XM_541276.2| PREDICTED: Canis familiaris similar to Proprote...	46	0.14
208	gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNIN...	46	0.14
209	emb|BX029538.1|CNS08UYE Single read from an extremity of a full-...	46	0.14
210	emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 b...	46	0.14
211	emb|AJ237772.1|OLA237772 Oryzias latipes mRNA for elongation fac...	46	0.14
212	ref|NM_031593.1| Rattus norvegicus synaptic vesicle glycoprotein...	46	0.14
213	dbj|AK132167.1| Mus musculus 17 days embryo head cDNA, RIKEN ful...	46	0.14
214	gb|AE010144.1| Pyrococcus furiosus DSM 3638, section 19 of 173 o...	46	0.14
215	ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation fa...	46	0.14
216	ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation fa...	46	0.14
217	gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, com...	46	0.14
218	gb|AC160560.2| Mus musculus BAC clone RP23-357O18 from chromosom...	46	0.14
219	gb|AC123704.21| Mus musculus chromosome 15, clone RP23-351F24, c...	46	0.14
220	gb|AC008339.2|AC008339 Drosophila melanogaster, chromosome 2R, r...	46	0.14
221	gb|AC009255.4|AC009255 Drosophila melanogaster, chromosome 2R, r...	46	0.14
222	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.14
223	ref|NM_199949.2| Danio rerio eukaryotic translation elongation f...	46	0.14
224	dbj|AK073405.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.14
225	emb|BX936364.6| Zebrafish DNA sequence from clone CH211-247G11 i...	46	0.14
226	dbj|AK059914.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.14
227	gb|AC007121.1|AC007121 Drosophila melanogaster, chromosome 2R, r...	46	0.14
228	gb|AE003784.5| Drosophila melanogaster chromosome 2R, section 5 ...	46	0.14
229	gb|AC152961.2| Mus musculus 6 BAC RP23-4H14 (Roswell Park Cancer...	46	0.14
230	gb|AF060174.1|AF060174 Rattus norvegicus synaptic vesicle protei...	46	0.14
231	emb|BX908786.9| Zebrafish DNA sequence from clone CH211-13O8 in ...	46	0.14
232	gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complet...	46	0.14
233	gb|BC096865.1| Danio rerio cold inducible RNA binding protein, m...	46	0.14
234	gb|BC071464.1| Danio rerio eukaryotic translation elongation fac...	46	0.14
235	gb|AC159106.2| Mus musculus chromosome 14 clone RP23-244I11, com...	46	0.14
236	gb|L47221.1|PHVEIF Phaseolus vulgaris eukaryotic initiation fact...	46	0.14
237	gb|M36626.1|RATSIMPA1 Rat simple sequence DNA, clone 5	46	0.14
238	gb|L36094.1|RICENDP Oryza sativa unknown ORF mRNA, complete cds	46	0.14
239	dbj|D83727.1| Oryza sativa (japonica cultivar-group) mRNA for el...	46	0.14
240	dbj|D83726.1| Oryza sativa (japonica cultivar-group) gene for el...	46	0.14
241	ref|XM_633465.1| Dictyostelium discoideum hypothetical protein (...	44	0.56
242	gb|AC151754.1| Ornithorhynchus anatinus chromosome UNK clone OAB...	44	0.56
243	ref|XM_641752.1| Dictyostelium discoideum hypothetical protein (...	44	0.56
244	ref|XM_638843.1| Dictyostelium discoideum hypothetical protein (...	44	0.56
245	ref|XM_635517.1| Dictyostelium discoideum hypothetical protein (...	44	0.56
246	ref|XM_630066.1| Dictyostelium discoideum peptidase A22 family p...	44	0.56
247	ref|XM_629777.1| Dictyostelium discoideum hypothetical protein (...	44	0.56
248	ref|XM_510590.1| PREDICTED: Pan troglodytes semaphorin 4B (LOC45...	44	0.56
249	gb|AC145810.3| Oryza sativa (japonica cultivar-group) chromosome...	44	0.56
250	gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome ...	44	0.56
251	ref|XM_583669.2| PREDICTED: Bos taurus similar to Chromodomain-h...	44	0.56
252	gb|BC051781.1| Danio rerio zgc:56258, mRNA (cDNA clone MGC:56258...	44	0.56
253	gb|AY578881.1| Drosophila mojavensis microsatellite DMOJ5200 seq...	44	0.56
254	ref|XM_710746.1| Candida albicans SC5314 DNA helicase (CaO19_103...	44	0.56
255	ref|XM_710695.1| Candida albicans SC5314 DNA helicase (CaO19_285...	44	0.56
256	ref|NM_198925.1| Homo sapiens sema domain, immunoglobulin domain...	44	0.56
257	ref|NM_020210.2| Homo sapiens sema domain, immunoglobulin domain...	44	0.56
258	gb|AC114539.8| Mus musculus chromosome 19, clone RP23-62I23, com...	44	0.56
259	gb|AC109151.9| Mus musculus chromosome 1, clone RP24-530O9, comp...	44	0.56
260	gb|AC069279.6| Homo sapiens BAC clone CTD-2031I8 from 7, complet...	44	0.56
261	gb|AC140113.3| Homo sapiens PAC clone RP1-85D24 from Y, complete...	44	0.56
262	emb|CR855569.2| Xenopus tropicalis finished cDNA, clone TEgg051c23	44	0.56
263	ref|XM_859022.1| PREDICTED: Canis familiaris similar to chromodo...	44	0.56
264	ref|XM_859000.1| PREDICTED: Canis familiaris similar to chromodo...	44	0.56
265	ref|XM_532624.2| PREDICTED: Canis familiaris similar to chromodo...	44	0.56
266	ref|XM_532345.2| PREDICTED: Canis familiaris similar to eukaryot...	44	0.56
267	ref|XM_851661.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.56
268	ref|XM_851616.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.56
269	ref|XM_851583.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.56
270	ref|XM_851537.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.56
271	ref|XM_851498.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.56
272	ref|XM_851462.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.56
273	ref|XM_449830.1| Candida glabrata CBS138 hypothetical protein (C...	44	0.56
274	gb|AY445887.1| Homo sapiens semaphorin 4b precursor (SEMA4B) mRN...	44	0.56
275	emb|Z66494.1|CEC34C6 Caenorhabditis elegans Cosmid C34C6, comple...	44	0.56
276	gb|AC102783.10| Mus musculus chromosome 14, clone RP23-390K3, co...	44	0.56
277	emb|CR702813.2|CNS0G58P Tetraodon nigroviridis full-length cDNA	44	0.56
278	emb|CR683168.2|CNS0FQ30 Tetraodon nigroviridis full-length cDNA	44	0.56
279	gb|AY358392.1| Homo sapiens clone DNA67962 semaphorin C (UNQ749)...	44	0.56
280	ref|XM_660250.1| Cryptosporidium hominis TU502 hypothetical prot...	44	0.56
281	gb|AC138130.9| Medicago truncatula clone mth2-31d24, complete se...	44	0.56
282	emb|AL353136.21| Human DNA sequence from clone RP11-133K18 on ch...	44	0.56
283	gb|AY321330.1| Rattus norvegicus Ac2-067 mRNA, complete cds	44	0.56
284	gb|AC158931.4| Mus musculus chromosome 1, clone RP23-3H19, compl...	44	0.56
285	emb|AL772233.6| Mouse DNA sequence from clone RP23-432I13 on chr...	44	0.56
286	emb|CR380959.1| Candida glabrata strain CBS138 chromosome M comp...	44	0.56
287	emb|BX883042.1| Rattus norvegicus chromosome 20, major histocomp...	44	0.56
288	emb|AJ291984.1|PFL291984 Platichthys flesus partial mRNA for tra...	44	0.56
289	emb|AL645962.22| Mouse DNA sequence from clone RP23-217L7 on chr...	44	0.56
290	emb|CR318597.4| Zebrafish DNA sequence from clone CH211-151L13 i...	44	0.56
291	emb|AJ720872.1| Gallus gallus mRNA for hypothetical protein, clo...	44	0.56
292	ref|NM_200321.1| Danio rerio zgc:56258 (zgc:56258), mRNA	44	0.56
293	gb|DQ027015.1| Chlamydomonas reinhardtii MCD1 (MCD1) mRNA, compl...	44	0.56
294	gb|AC120734.5| Rattus norvegicus BAC CH230-220D1 (Children's Ho...	44	0.56
295	gb|AC010048.5| Drosophila melanogaster 3L BAC RP98-5B23 (Roswell...	44	0.56
296	gb|AC147010.31| Medicago truncatula clone mth2-145p5, complete s...	44	0.56
297	gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21...	44	0.56
298	ref|NM_176231.1| Drosophila melanogaster Multiple C2 domain and ...	44	0.56
299	ref|NM_132665.1| Drosophila melanogaster CG15753-RA (CG15753), mRNA	44	0.56
300	gb|AY071153.1| Drosophila melanogaster RE18318 full length cDNA	44	0.56
301	ref|XM_692481.1| PREDICTED: Danio rerio similar to DIX domain co...	44	0.56
302	ref|XM_701303.1| PREDICTED: Danio rerio similar to TRDN protein ...	44	0.56
303	gb|AC099028.1| Drosophila melanogaster, chromosome 2R, region 55...	44	0.56
304	gb|AC099016.1| Drosophila melanogaster, chromosome 2R, region 56...	44	0.56
305	dbj|AB169897.1| Macaca fascicularis brain cDNA, clone: QtrA-1025...	44	0.56
306	dbj|AB168220.1| Macaca fascicularis testis cDNA clone: QtsA-1060...	44	0.56
307	emb|CR389753.1| Gallus gallus finished cDNA, clone ChEST475d8	44	0.56
308	emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23	44	0.56
309	gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	44	0.56
310	gb|AC010843.10|AC010843 Drosophila melanogaster, chromosome X, r...	44	0.56
311	emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7	44	0.56
312	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.56
313	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.56
314	gb|AC010995.11|AC010995 Drosophila melanogaster, chromosome X, r...	44	0.56
315	emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Co...	44	0.56
316	emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Co...	44	0.56
317	emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Co...	44	0.56
318	emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Co...	44	0.56
319	gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041...	44	0.56
320	emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14	44	0.56
321	gb|BC046015.1| Danio rerio, clone IMAGE:5601466, mRNA	44	0.56
322	ref|XM_574254.1| PREDICTED: Rattus norvegicus similar to RIKEN c...	44	0.56
323	gb|AC091167.19| Homo sapiens chromosome 15, clone RP11-697E2, co...	44	0.56
324	ref|XM_342043.2| PREDICTED: Rattus norvegicus similar to eukaryo...	44	0.56
325	gb|AF001098.1|AF001098 Cyprinus carpio elongation factor 1-beta ...	44	0.56
326	dbj|AK026108.1| Homo sapiens cDNA: FLJ22455 fis, clone HRC09777	44	0.56
327	dbj|AK111222.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.56
328	ref|NM_210904.1| Eremothecium gossypii AFR003Cp (AFR003C), mRNA	44	0.56
329	emb|BX901876.11| Zebrafish DNA sequence from clone CH211-140G2 i...	44	0.56
330	emb|BX927136.11| Zebrafish DNA sequence from clone DKEY-98O11 in...	44	0.56
331	gb|AE003535.3| Drosophila melanogaster chromosome 3L, section 50...	44	0.56
332	gb|AE003492.3| Drosophila melanogaster chromosome X, section 44 ...	44	0.56
333	gb|AE003798.3| Drosophila melanogaster chromosome 2R, section 52...	44	0.56
334	gb|BC110853.1| Homo sapiens sema domain, immunoglobulin domain (...	44	0.56
335	emb|CT030260.9| Mouse DNA sequence from clone RP23-462I24 on chr...	44	0.56
336	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	44	0.56
337	gb|AC004345.1|AC004345 Drosophila melanogaster DNA sequence (P1 ...	44	0.56
338	emb|CT033773.8| Mouse DNA sequence from clone RP23-176M23 on chr...	44	0.56
339	gb|AC000113.1|HSAC000113 Human PAC clone DJ302C05 from Xq23, com...	44	0.56
340	dbj|AP006357.1| Lotus japonicus genomic DNA, chromosome 4, clone...	44	0.56
341	gb|U66909.1|DDU66909 Dictyostelium discoideum ORF DG1003 gene, c...	44	0.56
342	gb|M32515.1|RATSIMPB Rat simple sequence DNA, clone 8	44	0.56
343	dbj|AB051532.1| Homo sapiens mRNA for KIAA1745 protein, partial cds	44	0.56
344	gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete...	42	2.2
345	ref|NM_106433.3| Arabidopsis thaliana translation initiation fac...	42	2.2
346	ref|NM_201048.1| Danio rerio zgc:55398 (zgc:55398), mRNA	42	2.2
347	ref|NM_101708.2| Arabidopsis thaliana 2-isopropylmalate synthase...	42	2.2
348	ref|NM_124665.2| Arabidopsis thaliana unknown protein AT5G52870 ...	42	2.2
349	ref|NM_202497.1| Arabidopsis thaliana ATP binding AT3G05220 tran...	42	2.2
350	ref|NM_111395.2| Arabidopsis thaliana ATP binding / metal ion bi...	42	2.2
351	ref|NM_105560.2| Arabidopsis thaliana unknown protein AT1G68870 ...	42	2.2
352	gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, ...	42	2.2
353	gb|AC119957.9| Mus musculus chromosome 17, clone RP24-466G23, co...	42	2.2
354	ref|XM_635149.1| Dictyostelium discoideum Ras nucleotide exchang...	42	2.2
355	ref|XM_635079.1| Dictyostelium discoideum hypothetical protein (...	42	2.2
356	ref|XM_520037.1| PREDICTED: Pan troglodytes similar to two AAA d...	42	2.2
357	gb|DQ215058.1| Taeniopygia guttata clone 0058P0035F11 nucleophos...	42	2.2
358	gb|DQ215055.1| Taeniopygia guttata clone 0058P0032E05 nucleophos...	42	2.2
359	ref|XM_465948.1| Oryza sativa (japonica cultivar-group), mRNA	42	2.2
360	ref|NM_184796.1| Oryza sativa (japonica cultivar-group), mRNA	42	2.2
361	ref|XM_517071.1| PREDICTED: Pan troglodytes similar to MAD4; Mad...	42	2.2
362	gb|AC170424.1| Rhesus Macaque BAC CH250-53N5 (Children's Hospit...	42	2.2
363	ref|XM_524853.1| PREDICTED: Pan troglodytes similar to Elongatio...	42	2.2
364	ref|NM_001015999.2| Xenopus tropicalis hypothetical protein LOC5...	42	2.2
365	ref|NM_001015967.2| Xenopus tropicalis hypothetical protein LOC5...	42	2.2
366	gb|BT019970.1| Homo sapiens MAX dimerization protein 4 mRNA, com...	42	2.2
367	gb|BT019969.1| Homo sapiens MAX dimerization protein 4 mRNA, com...	42	2.2
368	gb|BT019968.1| Synthetic construct Homo sapiens MAX dimerization...	42	2.2
369	gb|BT019967.1| Synthetic construct Homo sapiens MAX dimerization...	42	2.2
370	gb|AC102519.13| Mus musculus chromosome 18, clone RP24-560I9, co...	42	2.2
371	gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence	42	2.2
372	gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8...	42	2.2
373	gb|AY258720.1| Xiphophorus maculatus microsatellite Msb079 sequence	42	2.2
374	gb|BC078496.1| Xenopus laevis MGC85274 protein, mRNA (cDNA clone...	42	2.2
375	gb|AC008139.9| Drosophila melanogaster clone BACR28B01, complete...	42	2.2
376	ref|XM_864096.1| PREDICTED: Bos taurus similar to nucleophosmin ...	42	2.2
377	ref|XM_414267.1| PREDICTED: Gallus gallus similar to ring finger...	42	2.2
378	ref|XM_422194.1| PREDICTED: Gallus gallus similar to FAM31B prot...	42	2.2
379	ref|XM_363315.1| Magnaporthe grisea 70-15 hypothetical protein (...	42	2.2
380	ref|XM_461166.1| Debaryomyces hansenii CBS767 hypothetical prote...	42	2.2
381	gb|BT015000.1| Arabidopsis thaliana At1g68870 mRNA, complete cds	42	2.2
382	gb|AC129332.6| Mus musculus BAC clone RP23-91I19 from chromosome...	42	2.2
383	gb|BT014768.1| Arabidopsis thaliana At1g68870 gene, complete cds	42	2.2
384	gb|DQ440296.1| Aedes aegypti clone AET-374 elongation factor 1 b...	42	2.2
385	gb|AY600370.1| Danio rerio monocytic leukemia zinc finger protei...	42	2.2
386	gb|BT013598.1| Lycopersicon esculentum clone 132362R, mRNA sequence	42	2.2
387	gb|AY813798.1| Schistosoma japonicum SJCHGC09270 protein mRNA, c...	42	2.2
388	gb|AC167969.2| Mus musculus BAC clone RP24-446H24 from chromosom...	42	2.2
389	gb|BC021729.1| Homo sapiens similar to hypothetical protein FLJ2...	42	2.2
390	ref|NM_001001588.1| Danio rerio MYST histone acetyltransferase (...	42	2.2
391	gb|AC133451.14| Mus musculus chromosome 19, clone RP24-91H12, co...	42	2.2
392	ref|XM_988331.1| PREDICTED: Mus musculus hypothetical LOC640442 ...	42	2.2
393	ref|XM_917392.2| PREDICTED: Mus musculus similar to THO complex ...	42	2.2
394	ref|XM_001004174.1| PREDICTED: Mus musculus hypothetical LOC6404...	42	2.2
395	gb|AC148094.1| Mus musculus chromosome UNK clone RP24-497G1, com...	42	2.2
396	gb|AY480051.1| Homo sapiens plectin 11 mRNA, complete cds	42	2.2
397	gb|AY480050.1| Homo sapiens plectin 10 mRNA, complete cds	42	2.2
398	gb|AY480049.1| Homo sapiens plectin 8 mRNA, complete cds	42	2.2
399	gb|AY480048.1| Homo sapiens plectin 7 mRNA, complete cds	42	2.2
400	gb|AY480047.1| Homo sapiens plectin 6 mRNA, complete cds	42	2.2
401	gb|AY480046.1| Homo sapiens plectin 3 mRNA, complete cds	42	2.2
402	gb|AY480045.1| Homo sapiens plectin 2 mRNA, complete cds	42	2.2
403	gb|AY480044.1| Homo sapiens plectin 1 mRNA, complete cds	42	2.2
404	ref|XM_841569.1| Trypanosoma brucei TREU927 protein kinase (Tb92...	42	2.2
405	ref|XM_541885.2| PREDICTED: Canis familiaris similar to bassoon ...	42	2.2
406	emb|CR848420.2| Xenopus tropicalis finished cDNA, clone TNeu114n09	42	2.2
407	ref|XM_539860.2| PREDICTED: Canis familiaris similar to transien...	42	2.2
408	ref|XM_386944.1| Gibberella zeae PH-1 chromosome 4 hypothetical ...	42	2.2
409	ref|XM_539204.2| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
410	ref|XM_852242.1| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
411	ref|XM_852201.1| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
412	ref|XM_852160.1| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
413	ref|XM_852120.1| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
414	ref|XM_852074.1| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
415	ref|XM_852032.1| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
416	ref|XM_843706.1| PREDICTED: Canis familiaris similar to plectin ...	42	2.2
417	ref|XM_447627.1| Candida glabrata CBS138 hypothetical protein (C...	42	2.2
418	ref|XM_855682.1| PREDICTED: Canis familiaris similar to 1-acylgl...	42	2.2
419	ref|XM_855642.1| PREDICTED: Canis familiaris similar to 1-acylgl...	42	2.2
420	ref|XM_855613.1| PREDICTED: Canis familiaris similar to 1-acylgl...	42	2.2
421	ref|XM_532091.2| PREDICTED: Canis familiaris similar to 1-acylgl...	42	2.2
422	gb|AC127251.4| Mus musculus BAC clone RP24-482M10 from chromosom...	42	2.2
423	gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence	42	2.2
424	gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CI...	42	2.2
425	gb|AC009177.7|ATAC009177 Arabidopsis thaliana chromosome III BAC...	42	2.2
426	ref|XM_808589.1| Trypanosoma cruzi strain CL Brener mucin-associ...	42	2.2
427	gb|AY160092.1| Dictyostelium discoideum nucleotide exchange fact...	42	2.2
428	gb|AC122384.3| Mus musculus BAC clone RP24-63P8 from chromosome ...	42	2.2
429	ref|XM_815015.1| Trypanosoma cruzi strain CL Brener hypothetical...	42	2.2
430	ref|XM_815269.1| Trypanosoma cruzi strain CL Brener hypothetical...	42	2.2
431	ref|NM_000445.2| Homo sapiens plectin 1, intermediate filament b...	42	2.2
432	ref|NM_201378.1| Homo sapiens plectin 1, intermediate filament b...	42	2.2
433	ref|NM_201379.1| Homo sapiens plectin 1, intermediate filament b...	42	2.2
434	ref|NM_201380.2| Homo sapiens plectin 1, intermediate filament b...	42	2.2
435	ref|NM_201381.1| Homo sapiens plectin 1, intermediate filament b...	42	2.2
436	ref|NM_201383.1| Homo sapiens plectin 1, intermediate filament b...	42	2.2
437	ref|NM_201382.1| Homo sapiens plectin 1, intermediate filament b...	42	2.2
438	ref|NM_201384.1| Homo sapiens plectin 1, intermediate filament b...	42	2.2
439	emb|CR733792.2|CNS0GSZ3 Tetraodon nigroviridis full-length cDNA	42	2.2
440	emb|CR728524.2|CNS0GP2Q Tetraodon nigroviridis full-length cDNA	42	2.2
441	emb|CR720100.2|CNS0GIKQ Tetraodon nigroviridis full-length cDNA	42	2.2
442	emb|CR722642.2|CNS0GKJC Tetraodon nigroviridis full-length cDNA	42	2.2
443	emb|CR719902.2|CNS0GIF8 Tetraodon nigroviridis full-length cDNA	42	2.2
444	emb|CR703454.2|CNS0G5QI Tetraodon nigroviridis full-length cDNA	42	2.2
445	emb|CR701463.2|CNS0G477 Tetraodon nigroviridis full-length cDNA	42	2.2
446	emb|CR698877.2|CNS0G27D Tetraodon nigroviridis full-length cDNA	42	2.2
447	emb|CR691105.2|CNS0FW7H Tetraodon nigroviridis full-length cDNA	42	2.2
448	emb|CR688433.2|CNS0FU59 Tetraodon nigroviridis full-length cDNA	42	2.2
449	emb|CR687149.2|CNS0FT5L Tetraodon nigroviridis full-length cDNA	42	2.2
450	emb|CR687009.2|CNS0FT1P Tetraodon nigroviridis full-length cDNA	42	2.2
451	emb|CR686677.2|CNS0FSSH Tetraodon nigroviridis full-length cDNA	42	2.2
452	emb|CR685114.3|CNS0FRL2 Tetraodon nigroviridis full-length cDNA	42	2.2
453	emb|CR683419.2|CNS0FQ9Z Tetraodon nigroviridis full-length cDNA	42	2.2
454	emb|CR681006.2|CNS0FOEY Tetraodon nigroviridis full-length cDNA	42	2.2
455	emb|CR680575.2|CNS0FO2Z Tetraodon nigroviridis full-length cDNA	42	2.2
456	emb|CR680242.2|CNS0FNTQ Tetraodon nigroviridis full-length cDNA	42	2.2
457	emb|CR679939.2|CNS0FNLB Tetraodon nigroviridis full-length cDNA	42	2.2
458	emb|CR677929.1|CNS0FM1T Tetraodon nigroviridis full-length cDNA	42	2.2
459	emb|CR677980.2|CNS0FM38 Tetraodon nigroviridis full-length cDNA	42	2.2
460	emb|CR677281.2|CNS0FLJX Tetraodon nigroviridis full-length cDNA	42	2.2
461	emb|CR677181.2|CNS0FLH5 Tetraodon nigroviridis full-length cDNA	42	2.2
462	emb|CR676468.2|CNS0FKXC Tetraodon nigroviridis full-length cDNA	42	2.2
463	emb|CR676870.2|CNS0FL8I Tetraodon nigroviridis full-length cDNA	42	2.2
464	emb|CR674225.2|CNS0FJ7B Tetraodon nigroviridis full-length cDNA	42	2.2
465	emb|CR673965.2|CNS0FJ03 Tetraodon nigroviridis full-length cDNA	42	2.2
466	emb|CR673115.2|CNS0FICH Tetraodon nigroviridis full-length cDNA	42	2.2
467	emb|CR672809.2|CNS0FI3Z Tetraodon nigroviridis full-length cDNA	42	2.2
468	emb|CR672714.2|CNS0FI1C Tetraodon nigroviridis full-length cDNA	42	2.2
469	emb|CR672557.2|CNS0FHWZ Tetraodon nigroviridis full-length cDNA	42	2.2
470	emb|CR672233.2|CNS0FHNZ Tetraodon nigroviridis full-length cDNA	42	2.2
471	emb|CR671039.2|CNS0FGQT Tetraodon nigroviridis full-length cDNA	42	2.2
472	emb|CR671013.2|CNS0FGQ3 Tetraodon nigroviridis full-length cDNA	42	2.2
473	emb|CR671520.2|CNS0FH46 Tetraodon nigroviridis full-length cDNA	42	2.2
474	emb|CR670534.2|CNS0FGCS Tetraodon nigroviridis full-length cDNA	42	2.2
475	ref|XM_738935.1| Plasmodium chabaudi chabaudi hypothetical prote...	42	2.2
476	emb|CR668627.2|CNS0FEVT Tetraodon nigroviridis full-length cDNA	42	2.2
477	emb|CR668461.2|CNS0FER7 Tetraodon nigroviridis full-length cDNA	42	2.2
478	emb|CR668249.2|CNS0FELB Tetraodon nigroviridis full-length cDNA	42	2.2
479	emb|CR667660.2|CNS0FE4Y Tetraodon nigroviridis full-length cDNA	42	2.2
480	emb|CR666943.2|CNS0FDL1 Tetraodon nigroviridis full-length cDNA	42	2.2
481	emb|CR666424.2|CNS0FD6M Tetraodon nigroviridis full-length cDNA	42	2.2
482	emb|CR666052.2|CNS0FCWA Tetraodon nigroviridis full-length cDNA	42	2.2
483	emb|CR665436.2|CNS0FCF6 Tetraodon nigroviridis full-length cDNA	42	2.2
484	emb|CR664496.2|CNS0FBP2 Tetraodon nigroviridis full-length cDNA	42	2.2
485	emb|CR664813.2|CNS0FBXV Tetraodon nigroviridis full-length cDNA	42	2.2
486	emb|CR664774.2|CNS0FBWS Tetraodon nigroviridis full-length cDNA	42	2.2
487	emb|CR663967.2|CNS0FBAD Tetraodon nigroviridis full-length cDNA	42	2.2
488	emb|CR663903.2|CNS0FB8L Tetraodon nigroviridis full-length cDNA	42	2.2
489	emb|CR663679.2|CNS0FB2D Tetraodon nigroviridis full-length cDNA	42	2.2
490	emb|CR663217.2|CNS0FAPJ Tetraodon nigroviridis full-length cDNA	42	2.2
491	emb|CR662504.2|CNS0FA5Q Tetraodon nigroviridis full-length cDNA	42	2.2
492	emb|CR662807.2|CNS0FAE5 Tetraodon nigroviridis full-length cDNA	42	2.2
493	emb|CR661271.2|CNS0F97H Tetraodon nigroviridis full-length cDNA	42	2.2
494	emb|CR658047.2|CNS0F6PX Tetraodon nigroviridis full-length cDNA	42	2.2
495	emb|CR659461.2|CNS0F7T7 Tetraodon nigroviridis full-length cDNA	42	2.2
496	emb|CR659404.2|CNS0F7RM Tetraodon nigroviridis full-length cDNA	42	2.2
497	emb|CR658737.2|CNS0F793 Tetraodon nigroviridis full-length cDNA	42	2.2
498	emb|CR658693.2|CNS0F77V Tetraodon nigroviridis full-length cDNA	42	2.2
499	emb|CR657178.2|CNS0F61S Tetraodon nigroviridis full-length cDNA	42	2.2
500	emb|CR657080.2|CNS0F5Z2 Tetraodon nigroviridis full-length cDNA	42	2.2

---

>dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation factor 1 beta', complete cds
          Length = 884

 Score =  771 bits (389), Expect = 0.0
 Identities = 471/498 (94%), Gaps = 6/498 (1%)
 Strand = Plus / Minus

                                                                       
Query: 144 accaatcccagtaccaagaatccagcagcaacaggtgagcggacaaagattctagatctt 203
           ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 704 accaatcccagtaccaagaatccagcagcaacaggtgggcgaacaaagattctagatctt 645

                                                                       
Query: 204 gttgaaggcaacgatgtcacacgactggacgtactcgnnnnnnnncgcctcgcagagcac 263
           |||||||||||||||||||||||||||||| ||||||        |||||| ||||||||
Sbjct: 644 gttgaaggcaacgatgtcacacgactggacatactcgttgatgggcgcctcacagagcac 585

                                                                       
Query: 264 ttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggag 323
           ||||||||| || ||||||||  |    ||||| || |||||||||||||||||||||||
Sbjct: 584 ttcctcaat-ag-gtgtcgacgca----aggtcgtcgatgatcgtcagcatgatctggag 531

                                                                       
Query: 324 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 383
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 530 cttcttgatgccataacccacaggcataagcttagatgcaccccaggtgagaccctccat 471

                                                                       
Query: 384 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 443
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 470 ttgaacactgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 411

                                                                       
Query: 444 gatgtccatgaggacagaggatttgccactttctttcttctttgcaggcttggcagcctc 503
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 gatgtccatgaggacggaggatttgccactttctttcttctttgcaggcttggcagcctc 351

                                                                       
Query: 504 acgctcagctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatc 563
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 350 acgctcagctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatc 291

                                                                       
Query: 564 atcatcatcttcatccttggaagcagcaggagcagctgcagcaggagccgatgatgcact 623
            |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 290 gtcatcatcttcatccttggaagcagcaggagcagctgcagcaggagccgaggatgcact 231

                             
Query: 624 caccccagaggcctggcc 641
           ||||||||||||||||||
Sbjct: 230 caccccagaggcctggcc 213



 Score =  212 bits (107), Expect = 1e-51
 Identities = 129/135 (95%), Gaps = 1/135 (0%)
 Strand = Plus / Minus

                                                                       
Query: 3   catgatagatgtttcgcc-ttacaaactgctcagcaattcaactatttaaaggtaacaga 61
           |||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||| 
Sbjct: 856 catgatagatgtttcgccattacaaaccgctcagcaattcaactatttaaaggtagcagg 797

                                                                       
Query: 62  cattcaagaccagggcttgactcaaaaacaaaaccagtagcatttctgtaagaggggtaa 121
           |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||
Sbjct: 796 cattcaagaccagggcatcactcaaaaacaaaaccagtagcatttctgtaagaggggtaa 737

                          
Query: 122 ctaaatgggacgaca 136
           |||||||||||||||
Sbjct: 736 ctaaatgggacgaca 722

---

>ref|NM_186038.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 998

 Score =  246 bits (124), Expect = 8e-62
 Identities = 249/290 (85%), Gaps = 3/290 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 343 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 402
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                                       
Query: 403 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 462
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 501

                                                                       
Query: 463 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 519
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 500 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 441

                                                             
Query: 520 ttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
           |||||||| |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 440 ttcttgtcttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 391

---

>ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group), P0453E03.111 mRNA
          Length = 1000

 Score =  246 bits (124), Expect = 8e-62
 Identities = 249/290 (85%), Gaps = 3/290 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 343 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 402
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                                       
Query: 403 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 462
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 503

                                                                       
Query: 463 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 519
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 502 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 443

                                                             
Query: 520 ttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
           |||||||| |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 442 ttcttgtcttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 393

---

>dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107E20, full
           insert sequence
          Length = 1028

 Score =  246 bits (124), Expect = 8e-62
 Identities = 249/290 (85%), Gaps = 3/290 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 683 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 624

                                                                       
Query: 343 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 402
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 623 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 564

                                                                       
Query: 403 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 462
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 563 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 504

                                                                       
Query: 463 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 519
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 503 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 444

                                                             
Query: 520 ttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
           |||||||| |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 443 ttcttgtcttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 394

---

>dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001M09, full
           insert sequence
          Length = 998

 Score =  246 bits (124), Expect = 8e-62
 Identities = 249/290 (85%), Gaps = 3/290 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 343 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 402
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                                       
Query: 403 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 462
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 501

                                                                       
Query: 463 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 519
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 500 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 441

                                                             
Query: 520 ttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
           |||||||| |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 440 ttcttgtcttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 391

---

>dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-B01, full
           insert sequence
          Length = 1000

 Score =  246 bits (124), Expect = 8e-62
 Identities = 249/290 (85%), Gaps = 3/290 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 343 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 402
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                                       
Query: 403 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 462
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 503

                                                                       
Query: 463 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 519
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 502 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 443

                                                             
Query: 520 ttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
           |||||||| |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 442 ttcttgtcttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 393

---

>dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta', complete cds
          Length = 956

 Score =  246 bits (124), Expect = 8e-62
 Identities = 249/290 (85%), Gaps = 3/290 (1%)
 Strand = Plus / Minus

                                                                       
Query: 283 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
           |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 641 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 582

                                                                       
Query: 343 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 402
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 581 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 522

                                                                       
Query: 403 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 462
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 521 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 462

                                                                       
Query: 463 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 519
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 461 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 402

                                                             
Query: 520 ttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
           |||||||| |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 401 ttcttgtcttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 352

---

>gb|BT016181.1| Zea mays clone Contig14 mRNA sequence
          Length = 1084

 Score =  151 bits (76), Expect = 3e-33
 Identities = 209/252 (82%), Gaps = 6/252 (2%)
 Strand = Plus / Minus

                                                                       
Query: 324 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 383
           |||||||||||| || || |||||||  ||||| ||||| ||||| || |||||||||||
Sbjct: 628 cttcttgatgccgtatccaacaggcacaagctttgatgctccccaagtcagaccctccat 569

                                                                       
Query: 384 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 443
            || |||| ||||||||||||||||| ||||||||| |||||||||||||||||||| ||
Sbjct: 568 ctggacactgcggacagcctcctccagcttcttcatatcagtctcatcgtcccatggttt 509

                                                                       
Query: 444 gatgtccatgaggacagaggatttgccactttctttcttctttgca---ggcttggcagc 500
            |  ||||| ||||| |||||||| |||||||||||||| || | |   | |||||||||
Sbjct: 508 tacatccataaggacggaggatttaccactttctttctttttagaagaggccttggcagc 449

                                                                       
Query: 501 ctc---acgctcagctgctgctttcttgtcctcctcggtctcatcgccgaacagatccat 557
             |   ||||||| | ||||| |||||||||||||| || ||||| || || ||||| | 
Sbjct: 448 ggcagcacgctcatcagctgccttcttgtcctcctcagtttcatcaccaaaaagatcaag 389

                       
Query: 558 gtcatcatcatc 569
           ||||||||||||
Sbjct: 388 gtcatcatcatc 377

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  121 bits (61), Expect = 3e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                            
Query: 359      atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 418
                |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 27890071 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 27890012

                                                                 
Query: 419      tgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggattt 467
                | |||||||| ||||||||||| ||||  ||||  |||||||| |||||
Sbjct: 27890011 tatcagtctcgtcgtcccatggtttgacatccaacaggacagatgattt 27889963



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 88/102 (86%), Gaps = 3/102 (2%)
 Strand = Plus / Minus

                                                                            
Query: 471      actttctttcttctttgcagg---cttggcagcctcacgctcagctgctgctttcttgtc 527
                ||||||||||||||||| ||    ||||| |||  |||||||| ||||||||||||||||
Sbjct: 27889823 actttctttcttctttgaagaggccttggaagctgcacgctcatctgctgctttcttgtc 27889764

                                                          
Query: 528      ctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
                 |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 27889763 ttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 27889722



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                            
Query: 283      acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
                |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 27890238 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 27890179

                       
Query: 343      acaggca 349
                |||||||
Sbjct: 27890178 acaggca 27890172



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 416      tcatgtcagtctcatcgtcccatggcttga 445
                ||||||||||||||||||||||||| ||||
Sbjct: 25261256 tcatgtcagtctcatcgtcccatggtttga 25261285



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 465      tttgccactttctttcttct 484
                ||||||||||||||||||||
Sbjct: 18633489 tttgccactttctttcttct 18633470

---

>dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E03
          Length = 159980

 Score =  121 bits (61), Expect = 3e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                         
Query: 359   atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 418
             |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 53429 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 53370

                                                              
Query: 419   tgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggattt 467
             | |||||||| ||||||||||| ||||  ||||  |||||||| |||||
Sbjct: 53369 tatcagtctcgtcgtcccatggtttgacatccaacaggacagatgattt 53321



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 88/102 (86%), Gaps = 3/102 (2%)
 Strand = Plus / Minus

                                                                         
Query: 471   actttctttcttctttgcagg---cttggcagcctcacgctcagctgctgctttcttgtc 527
             ||||||||||||||||| ||    ||||| |||  |||||||| ||||||||||||||||
Sbjct: 53181 actttctttcttctttgaagaggccttggaagctgcacgctcatctgctgctttcttgtc 53122

                                                       
Query: 528   ctcctcggtctcatcgccgaacagatccatgtcatcatcatc 569
              |||||||||||||| || || ||||||| ||||||||||||
Sbjct: 53121 ttcctcggtctcatcaccaaaaagatccaggtcatcatcatc 53080



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                         
Query: 283   acagacacgaggtcatcaatgatcgtcagcatgatctggagcttcttgatgccataaccc 342
             |||||||| | ||||||||  || |||| ||||||||| | ||||||||| || ||||||
Sbjct: 53596 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 53537

                    
Query: 343   acaggca 349
             |||||||
Sbjct: 53536 acaggca 53530

---

>gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence
          Length = 951

 Score =  119 bits (60), Expect = 1e-23
 Identities = 205/252 (81%), Gaps = 6/252 (2%)
 Strand = Plus / Minus

                                                                       
Query: 324 cttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 383
           |||||||||||| || || ||||| |  ||||| ||||| ||||| || |||||||||||
Sbjct: 615 cttcttgatgccgtatccaacagggacaagctttgatgctccccaagtcagaccctccat 556

                                                                       
Query: 384 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 443
            || |||| | ||||||||||||||| ||||||||| |||||||||||||||||||| ||
Sbjct: 555 ctggacactggggacagcctcctccagcttcttcatatcagtctcatcgtcccatggttt 496

                                                                       
Query: 444 gatgtccatgaggacagaggatttgccactttctttcttctttgca---ggcttggcagc 500
            |  ||||| ||| | |||||||| ||||| |||||||| || | |   | |||||||||
Sbjct: 495 tacatccataaggccggaggatttcccactctctttctttttagaagaggccttggcagc 436

                                                                       
Query: 501 ctc---acgctcagctgctgctttcttgtcctcctcggtctcatcgccgaacagatccat 557
             |   ||||||| | ||||| |||||||||||||| || ||||| || || ||||| | 
Sbjct: 435 ggcagcacgctcatcagctgccttcttgtcctcctcagtttcatcaccaaaaagatcaag 376

                       
Query: 558 gtcatcatcatc 569
           ||||||||||||
Sbjct: 375 gtcatcatcatc 364

---

>emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elongation factor 1 beta
           (eEF1Bbeta 25 gene)
          Length = 1000

 Score =  105 bits (53), Expect = 2e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 268 tcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagcttc 327
           ||||| |||||||| ||||| || |||||||||||||| |||| ||| ||||||||||||
Sbjct: 701 tcaatcagagtgtcaacagagacaaggtcatcaatgatggtcatcataatctggagcttc 642

                                                    
Query: 328 ttgatgccataacccacaggcatgagcttagatgcacccca 368
           ||||||||||| || || ||||||||||| || ||||||||
Sbjct: 641 ttgatgccatatccaactggcatgagcttggaagcacccca 601



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 196 tagatcttgttgaaggcaacgatgtcaca 224
           ||||| |||||||||||||| ||||||||
Sbjct: 773 tagattttgttgaaggcaacaatgtcaca 745

---

>gb|BT016424.1| Zea mays clone Contig257 mRNA sequence
          Length = 1064

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 144/179 (80%)
 Strand = Plus / Minus

                                                                       
Query: 265 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 324
           ||||||||||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 723 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 664

                                                                       
Query: 325 ttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccatt 384
           |||||||| ||||| || || || |  ||||| ||||| ||||||   || || ||||| 
Sbjct: 663 ttcttgataccatatccaactgggacaagcttggatgcgccccagagcagcccttccatc 604

                                                                      
Query: 385 tgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 443
           || ||||  |  ||||| ||||| | |||   |||||||||||||||||||||||||||
Sbjct: 603 tggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcccatggctt 545

---

>gb|BT016185.1| Zea mays clone Contig18 mRNA sequence
          Length = 1070

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 144/179 (80%)
 Strand = Plus / Minus

                                                                       
Query: 265 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 324
           ||||||||||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 751 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 692

                                                                       
Query: 325 ttcttgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccatt 384
           |||||||| ||||| || || || |  ||||| ||||| ||||||   || || ||||| 
Sbjct: 691 ttcttgataccatatccaactgggacaagcttggatgcgccccagagcagcccttccatc 632

                                                                      
Query: 385 tgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 443
           || ||||  |  ||||| ||||| | |||   |||||||||||||||||||||||||||
Sbjct: 631 tggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcccatggctt 573



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 195 ctagatcttgttgaaggcaacgatgtc 221
           ||||||||||||||||||||| |||||
Sbjct: 821 ctagatcttgttgaaggcaactatgtc 795

---

>gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence
          Length = 459

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           ||||| ||| |||||||||||||   |||||||||| |||||||| ||||||||||| | 
Sbjct: 308 aacactgcgaacagcctcctccagtctcttcatgtcggtctcatcatcccatggcttaac 249

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| |||||||| || ||||| |||||
Sbjct: 248 atccatgagcacagaggactttccactctcttt 216



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || || ||||| || || |||||||| ||||||||||||||||
Sbjct: 177 ctgcagctttcttttcttcttctgtctcgtcaccaaacagatcaatgtcatcatcatcat 118

            
Query: 572 c 572
           |
Sbjct: 117 c 117

---

>gb|AY480020.1| Capsicum annuum putative elongation factor 1B alpha-subunit mRNA,
           partial sequence
          Length = 728

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 180/227 (79%), Gaps = 3/227 (1%)
 Strand = Plus / Minus

                                                                       
Query: 355 ttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttc 414
           |||||||| ||||||   ||||| ||||| | ||||| ||| ||||||||||| |  |||
Sbjct: 577 ttagatgctccccagagaagaccttccatctcaacactgcgaacagcctcctcaagtttc 518

                                                                       
Query: 415 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 474
           ||||||||||| || || ||||| ||||| | |||||| || ||||| || || ||||| 
Sbjct: 517 ttcatgtcagtttcgtcatcccaaggcttaacgtccataagaacagatgactttccactc 458

                                                                       
Query: 475 tctttcttctttgca---ggcttggcagcctcacgctcagctgctgctttcttgtcctcc 531
           ||||||||||| | |   | ||| |||||||| |   |  ||||||| ||||| ||||||
Sbjct: 457 tctttcttcttggtagatgccttagcagcctcccttgcttctgctgccttcttttcctcc 398

                                                          
Query: 532 tcggtctcatcgccgaacagatccatgtcatcatcatcatcttcatc 578
           || ||||| || || || ||||| ||||||||||| ||||| |||||
Sbjct: 397 tccgtctcttctccaaagagatcaatgtcatcatcgtcatcatcatc 351

---

>gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated protein
           DDTFR10-like mRNA, complete cds
          Length = 928

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 415 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 474
           ||||| ||||||||||| |||||||||||||  |||||||| || ||||| ||||||  |
Sbjct: 541 ttcatatcagtctcatcatcccatggcttgacatccatgagaactgaggacttgccagat 482

                      
Query: 475 tctttcttctt 485
           |||||||||||
Sbjct: 481 tctttcttctt 471

---

>gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulated protein DDTFR10
           (DDTFR10) mRNA, complete cds
          Length = 988

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 415 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 474
           ||||| || |||||||| |||||||||||||  |||||||| |||||||| ||||||  |
Sbjct: 523 ttcatatcggtctcatcatcccatggcttgacatccatgagaacagaggacttgccagat 464

                      
Query: 475 tctttcttctt 485
           |||||||||||
Sbjct: 463 tctttcttctt 453

---

>gb|AY103717.1| Zea mays PCO098989 mRNA sequence
          Length = 1312

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 265 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 324
           ||||||||||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 917 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 858

                         
Query: 325 ttcttgatgccata 338
           |||||||| |||||
Sbjct: 857 ttcttgataccata 844



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 417 catgtcagtctcatcgtcccatggctt 443
           |||||||||||||||||||||||||||
Sbjct: 765 catgtcagtctcatcgtcccatggctt 739



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 195 ctagatcttgttgaaggcaacgatgtc 221
           ||||||||||||||||||||| |||||
Sbjct: 987 ctagatcttgttgaaggcaactatgtc 961

---

>gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongation factor 1B
           alpha-subunit0like mRNA, complete cds
          Length = 957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 438
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 545 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 486

                                                          
Query: 439 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 485
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 485 ggcttaacgtccataagaacggatgactttccactctctttcttctt 439

---

>gb|DQ191626.1| Solanum tuberosum unknown mRNA
          Length = 1088

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 438
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 529 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 470

                                                          
Query: 439 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 485
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 469 ggcttaacgtccataagaacggatgactttccactctctttcttctt 423

---

>dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongation factor, complete
           cds
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 396 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgag 455
           |||||||||||| |  |||| |||||| |||||||| |||||||| ||||  ||||  ||
Sbjct: 538 gacagcctcctcaagtttctgcatgtccgtctcatcatcccatggtttgacatccaatag 479

                                      
Query: 456 gacagaggatttgccactttctttctt 482
            ||||| ||||| ||||||||||||||
Sbjct: 478 aacagaagattttccactttctttctt 452

---

>emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5, COMPLETE SEQUENCE
          Length = 210708

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 397    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 443
              |||||||| |||| |||||||||||| |||||||| |||||||||||
Sbjct: 171387 acagcctcttccagcttcttcatgtctgtctcatcatcccatggctt 171433



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 397    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 443
              ||||| || |||| ||||||||| || |||||||| |||||||||||
Sbjct: 158087 acagcttcttccagcttcttcatatctgtctcatcatcccatggctt 158133



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 295    tcatcaatgatcgtcagcatgatctggagcttcttgat 332
              |||||||| || |||| ||||||||| |||||||||||
Sbjct: 171154 tcatcaataatggtcaacatgatctgcagcttcttgat 171191

---

>gb|AY111648.1| Zea mays CL2935_1 mRNA sequence
          Length = 1119

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 265 tcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 324
           ||||| ||||||||||| ||||| || |||||||| |  || |||| |||||| || |||
Sbjct: 391 tcctcgatgagagtgtcaacagagacaaggtcatcgacaatggtcatcatgatttgcagc 450

                         
Query: 325 ttcttgatgccata 338
           ||||||||||||||
Sbjct: 451 ttcttgatgccata 464



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 417 catgtcagtctcatcgtcccatggctt 443
           |||||||||||||||||||||||||||
Sbjct: 543 catgtcagtctcatcgtcccatggctt 569

---

>ref|NM_121956.2| Arabidopsis thaliana translation elongation factor AT5G19510 mRNA,
           complete cds
          Length = 945

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 557 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 498

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 497 atccatgagcacagaagactttccactctcttt 465



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 426 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 367

            
Query: 572 c 572
           |
Sbjct: 366 c 366

---

>emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongation factor 1B alpha-subunit
           (eEF1Balpha2 gene)
          Length = 680

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 485 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 426

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 425 atccatgagcacagaagactttccactctcttt 393



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 354 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 295

            
Query: 572 c 572
           |
Sbjct: 294 c 294

---

>gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 706

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 483 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 424

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 423 atccatgagcacagaagactttccactctcttt 391



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 352 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 293

            
Query: 572 c 572
           |
Sbjct: 292 c 292

---

>gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 881

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 522 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 463

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 462 atccatgagcacagaagactttccactctcttt 430



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 391 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 332

            
Query: 572 c 572
           |
Sbjct: 331 c 331

---

>emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB73ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 820

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 453 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 394

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 393 atccatgagtacagaagactttccactctcttt 361



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 322 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 263

            
Query: 572 c 572
           |
Sbjct: 262 c 262

---

>emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZA05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 481

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 480 atccatgagcacagaagactttccactctcttt 448



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 409 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 350

            
Query: 572 c 572
           |
Sbjct: 349 c 349

---

>emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 498 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 439

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 438 atccatgagcacagaagactttccactctcttt 406



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 367 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 308

            
Query: 572 c 572
           |
Sbjct: 307 c 307

---

>emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH19ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 868

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 481

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 480 atccatgagcacagaagactttccactctcttt 448



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 409 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 350

            
Query: 572 c 572
           |
Sbjct: 349 c 349

---

>emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZF03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 712

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 369 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttcac 310

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 309 atccatgagcacagaagactttccactctcttt 277



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 238 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 179

            
Query: 572 c 572
           |
Sbjct: 178 c 178

---

>gb|AY909456.1| Siniperca chuatsi clone C279 translation elongation factor eEF-1
           delta mRNA, partial cds
          Length = 391

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 315 gatctggagcttcttgatgccataacccacagg 347
           ||||||||||||||||||||| |||||||||||
Sbjct: 191 gatctggagcttcttgatgccgtaacccacagg 159

---

>gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete sequence
          Length = 849

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 387 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 497 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 438

                                            
Query: 447 gtccatgaggacagaggatttgccactttcttt 479
            |||||||| ||||| || || ||||| |||||
Sbjct: 437 atccatgagcacagaagactttccactctcttt 405



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 366 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 307

            
Query: 572 c 572
           |
Sbjct: 306 c 306

---

>gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1
          Length = 35369

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                        
Query: 512  ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
            |||| |||||||| || || |||||||| || || || ||||||||||||||||||||||
Sbjct: 6679 ctgcagctttcttttcttcttcggtctcgtcaccaaagagatccatgtcatcatcatcat 6738

             
Query: 572  c 572
            |
Sbjct: 6739 c 6739



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                        
Query: 387  aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
            |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 6435 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 6494

                           
Query: 447  gtccatgaggacaga 461
             |||||||| |||||
Sbjct: 6495 atccatgagcacaga 6509

---

>ref|NM_127367.1| Arabidopsis thaliana translation elongation factor AT2G18110 mRNA,
           complete cds
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 775 atcttgttgaaggcaacaatgtcaca 750

---

>emb|BX071583.1|CNS09REB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 366 cttcatgtcggtttcatcgtcccatggcttgatgtc 401

---

>emb|BX071358.1|CNS09R82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 490 cttcatgtcggtttcatcgtcccatggcttgatgtc 525

---

>emb|BX071357.1|CNS09R81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 776 cttcatgtcggtttcatcgtcccatggcttgatgtc 741

---

>emb|BX068711.1|CNS09P6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 529

---

>emb|BX068710.1|CNS09P6I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746

---

>emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 775 cttcatgtcggtttcatcgtcccatggcttgatgtc 740

---

>emb|BX063619.1|CNS09L93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 301 cttcatgtcggtttcatcgtcccatggcttgatgtc 336

---

>emb|BX063618.1|CNS09L92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 85  cttcatgtcggtttcatcgtcccatggcttgatgtc 50

---

>emb|BX063276.1|CNS09KZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 363 cttcatgtcggtttcatcgtcccatggcttgatgtc 398

---

>emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX053674.1|CNS09DKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX053673.1|CNS09DKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX052417.1|CNS09CLX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 352 cttcatgtcggtttcatcgtcccatggcttgatgtc 387

---

>emb|BX052416.1|CNS09CLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 760 cttcatgtcggtttcatcgtcccatggcttgatgtc 725

---

>emb|BX052150.1|CNS09CEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 323 cttcatgtcggtttcatcgtcccatggcttgatgtc 358

---

>emb|BX052149.1|CNS09CEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 736 cttcatgtcggtttcatcgtcccatggcttgatgtc 701

---

>emb|BX052078.1|CNS09CCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 498 cttcatgtcggtttcatcgtcccatggcttgatgtc 533

---

>emb|BX052058.1|CNS09CBY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 813 cttcatgtcggtttcatcgtcccatggcttgatgtc 778

---

>emb|BX047220.1|CNS098LK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 140 cttcatgtcggtttcatcgtcccatggcttgatgtc 175

---

>emb|BX047219.1|CNS098LJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 743 cttcatgtcggtttcatcgtcccatggcttgatgtc 708

---

>emb|BX046233.1|CNS097U5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 615 cttcatgtcggtttcatcgtcccatggcttgatgtc 650

---

>emb|BX046232.1|CNS097U4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 786 cttcatgtcggtttcatcgtcccatggcttgatgtc 751

---

>emb|BX042348.1|CNS094U8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 598 cttcatgtcggtttcatcgtcccatggcttgatgtc 633

---

>emb|BX042347.1|CNS094U7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 521 cttcatgtcggtttcatcgtcccatggcttgatgtc 486

---

>emb|BX041605.1|CNS0949L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 245 cttcatgtcggtttcatcgtcccatggcttgatgtc 280

---

>emb|BX041604.1|CNS0949K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX041307.1|CNS0941B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 572

---

>emb|BX039708.1|CNS092SW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 258 cttcatgtcggtttcatcgtcccatggcttgatgtc 293

---

>emb|BX039707.1|CNS092SV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 279 cttcatgtcggtttcatcgtcccatggcttgatgtc 244

---

>emb|BX037290.1|CNS090XQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX036523.1|CNS090CF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 112

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 9   cttcatgtcggtttcatcgtcccatggcttgatgtc 44

---

>emb|BX036522.1|CNS090CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 102

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 61  cttcatgtcggtttcatcgtcccatggcttgatgtc 26

---

>emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 459

---

>emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 479 cttcatgtcggtttcatcgtcccatggcttgatgtc 514

---

>emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562

---

>emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 594 cttcatgtcggtttcatcgtcccatggcttgatgtc 629

---

>emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 469 cttcatgtcggtttcatcgtcccatggcttgatgtc 504

---

>emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 752 cttcatgtcggtttcatcgtcccatggcttgatgtc 717

---

>emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|BX032179.1|CNS08WZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 599 cttcatgtcggtttcatcgtcccatggcttgatgtc 634

---

>emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 586 cttcatgtcggtttcatcgtcccatggcttgatgtc 551

---

>emb|BX032163.1|CNS08WZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 555 cttcatgtcggtttcatcgtcccatggcttgatgtc 590

---

>emb|BX029545.1|CNS08UYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 550 cttcatgtcggtttcatcgtcccatggcttgatgtc 585

---

>emb|BX029544.1|CNS08UYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746

---

>emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 81  cttcatgtcggtttcatcgtcccatggcttgatgtc 116

---

>emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 309 cttcatgtcggtttcatcgtcccatggcttgatgtc 344

---

>emb|BX027135.1|CNS08T3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638

---

>emb|BX027134.1|CNS08T3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX026630.1|CNS08SPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 600 cttcatgtcggtttcatcgtcccatggcttgatgtc 635

---

>emb|BX026629.1|CNS08SPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX026387.1|CNS08SIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|BX026386.1|CNS08SIU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 445 cttcatgtcggtttcatcgtcccatggcttgatgtc 410

---

>emb|BX025444.1|CNS08RSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 500 cttcatgtcggtttcatcgtcccatggcttgatgtc 535

---

>emb|BX025443.1|CNS08RSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753

---

>emb|BX024401.1|CNS08QZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640

---

>emb|BX024400.1|CNS08QZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 780 cttcatgtcggtttcatcgtcccatggcttgatgtc 745

---

>emb|BX023680.1|CNS08QFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562

---

>emb|BX023679.1|CNS08QFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 806 cttcatgtcggtttcatcgtcccatggcttgatgtc 771

---

>emb|BX019648.1|CNS08NBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 380 cttcatgtcggtttcatcgtcccatggcttgatgtc 415

---

>emb|BX019647.1|CNS08NBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 797 cttcatgtcggtttcatcgtcccatggcttgatgtc 762

---

>emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753

---

>emb|BX018057.1|CNS08M3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 437 cttcatgtcggtttcatcgtcccatggcttgatgtc 472

---

>emb|BX018056.1|CNS08M3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 288 cttcatgtcggtttcatcgtcccatggcttgatgtc 253

---

>emb|BX016732.1|CNS08L2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 618 cttcatgtcggtttcatcgtcccatggcttgatgtc 653

---

>emb|BX016731.1|CNS08L2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 624 cttcatgtcggtttcatcgtcccatggcttgatgtc 589

---

>emb|BX016339.1|CNS08KRR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 518 cttcatgtcggtttcatcgtcccatggcttgatgtc 553

---

>emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743

---

>emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 298 cttcatgtcggtttcatcgtcccatggcttgatgtc 333

---

>emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759

---

>emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 264 cttcatgtcggtttcatcgtcccatggcttgatgtc 299

---

>emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 655 cttcatgtcggtttcatcgtcccatggcttgatgtc 620

---

>emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 787 cttcatgtcggtttcatcgtcccatggcttgatgtc 752

---

>emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 606 cttcatgtcggtttcatcgtcccatggcttgatgtc 641

---

>emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX010493.1|CNS08G9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638

---

>emb|BX010492.1|CNS08G9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579

---

>emb|BX010211.1|CNS08G1J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743

---

>emb|BX010113.1|CNS08FYT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640

---

>emb|BX010112.1|CNS08FYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579

---

>emb|BX009646.1|CNS08FLU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 727 cttcatgtcggtttcatcgtcccatggcttgatgtc 692

---

>emb|BX008302.1|CNS08EKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 496 cttcatgtcggtttcatcgtcccatggcttgatgtc 531

---

>emb|BX008301.1|CNS08EKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759

---

>gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map PhyB, complete
             sequence
          Length = 57550

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 397   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
             ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 54608 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 54663



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 199   atcttgttgaaggcaacgatgtcaca 224
             ||||||||||||||||| ||||||||
Sbjct: 54410 atcttgttgaaggcaacaatgtcaca 54435

---

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
            sequence
          Length = 88149

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 397  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 2484 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 2539



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 199  atcttgttgaaggcaacgatgtcaca 224
            ||||||||||||||||| ||||||||
Sbjct: 2286 atcttgttgaaggcaacaatgtcaca 2311

---

>gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110)
           mRNA, complete cds
          Length = 805

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 494 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 439



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 692 atcttgttgaaggcaacaatgtcaca 667

---

>gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110;
           F8D23.11) mRNA, complete cds
          Length = 928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 575 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 520



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 773 atcttgttgaaggcaacaatgtcaca 748

---

>emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 920

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 564 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 509



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 762 atcttgttgaaggcaacaatgtcaca 737

---

>emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH52ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 544 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 489



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 742 atcttgttgaaggcaacaatgtcaca 717

---

>emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 523 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 468

---

>gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete sequence
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 775 atcttgttgaaggcaacaatgtcaca 750

---

>ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448
           (ENSANGG00000010959), partial mRNA
          Length = 717

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || |||||||||||||||||||||||
Sbjct: 507 cttcatgtcggtttcatcgtcccatggcttgatgtc 472

---

>gb|DQ191662.1| Solanum tuberosum elongation factor-like protein mRNA, complete cds
          Length = 903

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 438
           ||||| |||||||| || ||| |||||||||  |||||||| || || ||||| ||||| 
Sbjct: 552 tccatctgaacaccacgaacaacctcctccagtttcttcatatcggtttcatcatcccaa 493

                                                          
Query: 439 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 485
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 492 ggcttaacgtccataagaacggatgactttccactctctttcttctt 446

---

>emb|BX037291.1|CNS090XR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 743

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 415 ttcatgtcagtctcatcgtcccatggcttgatgtc 449
           |||||||| || |||||||||||||||||||||||
Sbjct: 608 ttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation factor 1 beta
          Length = 1996

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 397  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 451
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 1632 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatcca 1578



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 199  atcttgttgaaggcaacgatgtcaca 224
            ||||||||||||||||| ||||||||
Sbjct: 1830 atcttgttgaaggcaacaatgtcaca 1805

---

>gb|AY103716.1| Zea mays PCO118532 mRNA sequence
          Length = 1237

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 503 cacgctcagctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcat 562
           |||||||| | ||||| |||||||||||||| || ||||| || || ||||| | |||||
Sbjct: 436 cacgctcatcagctgccttcttgtcctcctcagtttcatcaccaaaaagatcaaggtcat 377

                  
Query: 563 catcatc 569
           |||||||
Sbjct: 376 catcatc 370

---

>ref|NM_102762.2| Arabidopsis thaliana translation elongation factor AT1G30230 mRNA,
           complete cds
          Length = 1028

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 568 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 519



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 766 atcttgttgaaggcaacaatgtcaca 741



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 517 gctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcatcttca 576
           |||||||| ||||| |||||||| || ||||| || || |  ||||||||||| ||||||
Sbjct: 442 gctttcttttcctcttcggtctcctctccgaaaaggtcaacatcatcatcatcttcttca 383

             
Query: 577 tc 578
           ||
Sbjct: 382 tc 381

---

>ref|XM_479153.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 416 tcatgtcagtctcatcgtcccatggcttga 445
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 194 tctagatcttgttgaaggcaacgatgtc 221
           |||||||||||||||| ||||| |||||
Sbjct: 798 tctagatcttgttgaacgcaacaatgtc 771

---

>ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group), P0616D06.117 mRNA
          Length = 1363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 416 tcatgtcagtctcatcgtcccatggcttga 445
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 194 tctagatcttgttgaaggcaacgatgtc 221
           |||||||||||||||| ||||| |||||
Sbjct: 793 tctagatcttgttgaacgcaacaatgtc 766

---

>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 379   tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 438
             ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 11090 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 11149

                           
Query: 439   ggcttgatgtccat 452
             ||||| | ||||||
Sbjct: 11150 ggcttaacgtccat 11163



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 264   ttcctcaatgagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctg 320
             |||||||||||| || || ||||| || |||||||| ||||| || |||||||||||
Sbjct: 10878 ttcctcaatgagggtatccacagagacaaggtcatcgatgatggtaagcatgatctg 10934

---

>emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 728

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 353 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 304



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 551 atcttgttgaaggcaacaatgtcaca 526



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 517 gctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcatcttca 576
           |||||||| ||||| |||||||| || ||||| || || |  ||||||||||| ||||||
Sbjct: 227 gctttcttttcctcttcggtctcctctccgaaaaggtcaacatcatcatcatcttcttca 168

             
Query: 577 tc 578
           ||
Sbjct: 167 tc 166

---

>emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 908

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 546 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 497



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 744 atcttgttgaaggcaacaatgtcaca 719



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 517 gctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcatcttca 576
           |||||||| ||||| |||||||| || ||||| || || |  ||||||||||| ||||||
Sbjct: 420 gctttcttttcctcttcggtctcctctccgaaaaggtcaacatcatcatcatcttcttca 361

             
Query: 577 tc 578
           ||
Sbjct: 360 tc 359

---

>emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH89ZB09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 559 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 510



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 757 atcttgttgaaggcaacaatgtcaca 732



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 517 gctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcatcttca 576
           |||||||| ||||| |||||||| || ||||| || || |  ||||||||||| ||||||
Sbjct: 433 gctttcttttcctcttcggtctcctctccgaaaaggtcaacatcatcatcatcttcttca 374

             
Query: 577 tc 578
           ||
Sbjct: 373 tc 372

---

>gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F12P21 genomic sequence, complete
             sequence
          Length = 55095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 397   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 446
             ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 19386 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 19337



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 199   atcttgttgaaggcaacgatgtcaca 224
             ||||||||||||||||| ||||||||
Sbjct: 19584 atcttgttgaaggcaacaatgtcaca 19559



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                         
Query: 517   gctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcatcttca 576
             |||||||| ||||| |||||||| || ||||| || || |  ||||||||||| ||||||
Sbjct: 19170 gctttcttttcctcttcggtctcctctccgaaaaggtcaacatcatcatcatcttcttca 19111

               
Query: 577   tc 578
             ||
Sbjct: 19110 tc 19109

---

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0616D06
          Length = 153800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 416   tcatgtcagtctcatcgtcccatggcttga 445
             ||||||||||||||||||||||||| ||||
Sbjct: 77927 tcatgtcagtctcatcgtcccatggtttga 77956

---

>dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongation factor 1 beta',
           complete cds
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtcca 451
           |||||||||||| ||||||||||| ||||||| |||||
Sbjct: 520 cttcatgtcagtttcatcgtcccagggcttgacgtcca 483

---

>dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023109L04, full
           insert sequence
          Length = 1364

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 416 tcatgtcagtctcatcgtcccatggcttga 445
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 194 tctagatcttgttgaaggcaacgatgtc 221
           |||||||||||||||| ||||| |||||
Sbjct: 793 tctagatcttgttgaacgcaacaatgtc 766

---

>dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C03, full
           insert sequence
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 416 tcatgtcagtctcatcgtcccatggcttga 445
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 194 tctagatcttgttgaaggcaacgatgtc 221
           |||||||||||||||| ||||| |||||
Sbjct: 798 tctagatcttgttgaacgcaacaatgtc 771

---

>dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-G07, full
           insert sequence
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 416 tcatgtcagtctcatcgtcccatggcttga 445
           ||||||||||||||||||||||||| ||||
Sbjct: 193 tcatgtcagtctcatcgtcccatggtttga 164



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 194 tctagatcttgttgaaggcaacgatgtc 221
           |||||||||||||||| ||||| |||||
Sbjct: 415 tctagatcttgttgaacgcaacaatgtc 388

---

>dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta, complete cds
          Length = 1420

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 416 tcatgtcagtctcatcgtcccatggcttga 445
           ||||||||||||||||||||||||| ||||
Sbjct: 556 tcatgtcagtctcatcgtcccatggtttga 527



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 194 tctagatcttgttgaaggcaacgatgtc 221
           |||||||||||||||| ||||| |||||
Sbjct: 778 tctagatcttgttgaacgcaacaatgtc 751

---

>ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4 (novel KRAB box
            containing C2H2 type zinc finger protein) (LOC465235),
            mRNA
          Length = 3627

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 417  catgtcagtctcatcgtcccatggcttga 445
            ||||||||||||||||||||| |||||||
Sbjct: 3492 catgtcagtctcatcgtcccaaggcttga 3464

---

>ref|XM_654277.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN1765.2), mRNA
          Length = 660

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 585 agcagcaggagcagctgcagcaggagccg 613
           ||||||||||||||| |||||||||||||
Sbjct: 162 agcagcaggagcagcagcagcaggagccg 134

---

>ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD19), mRNA
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 417  catgtcagtctcatcgtcccatggcttga 445
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204

---

>emb|BX927114.16| Zebrafish DNA sequence from clone DKEY-1C7 in linkage group 1, complete
              sequence
          Length = 170755

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 559    tcatcatcatcatcttcatccttgg 583
              |||||||||||||||||||||||||
Sbjct: 117583 tcatcatcatcatcttcatccttgg 117559

---

>emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chromosome 9 Contains the 5'
              end of the gene for coiled-coil protein (BICD2) (KIAA0699),
              a novel gene, a eukaryotic translation elongation factor 1
              delta (guanine nucleotide exchange protein) (EEF1D)
              pseudogene, the gene for a novel KRAB box-containing C2H2
              type zinc finger protein, a novel gene, a pseudogene
              similar to part of sorting nexin associated golgi protein 1
              (SNAG1), a novel pseudogene, a melanoma antigen pseudogene
              and three CpG islands, complete sequence
          Length = 182280

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 417    catgtcagtctcatcgtcccatggcttga 445
              ||||||||||||||||||||| |||||||
Sbjct: 106674 catgtcagtctcatcgtcccaaggcttga 106702

---

>emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor 1-beta
          Length = 1069

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 396 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgag 455
           |||||| ||||| | |||||||||||| || ||||| ||||||||||| |  ||||  | 
Sbjct: 581 gacagcttcctcaagcttcttcatgtctgtttcatcatcccatggcttcacatccaacaa 522

                                                        
Query: 456 gacagaggatttgccactttctttcttctttgcaggcttggcagc 500
           ||| || || |||||   |||||||||||| |||||||| |||||
Sbjct: 521 gaccgatgacttgcccgattctttcttcttagcaggcttagcagc 477

---

>gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:27029
            IMAGE:4837806), complete cds
          Length = 2351

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 417  catgtcagtctcatcgtcccatggcttga 445
            ||||||||||||||||||||| |||||||
Sbjct: 1366 catgtcagtctcatcgtcccaaggcttga 1394

---

>emb|BX883049.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
             assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
             RT1n haplotype; segment 8/11
          Length = 349476

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 579   cttggaagcagcaggagcagctgcagcag 607
             |||||| ||||||||||||||||||||||
Sbjct: 77461 cttggaggcagcaggagcagctgcagcag 77489

---

>dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534
          Length = 1899

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 417  catgtcagtctcatcgtcccatggcttga 445
            ||||||||||||||||||||| |||||||
Sbjct: 994  catgtcagtctcatcgtcccaaggcttga 1022

---

>emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 348 catgtcggtctcatcgtcccatggcttga 320

---

>emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504

---

>emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 405 catgtcggtctcatcgtcccatggcttga 377

---

>emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 584 catgtcggtctcatcgtcccatggcttga 556

---

>emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 82  catgtcggtctcatcgtcccatggcttga 54

---

>emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 551 catgtcggtctcatcgtcccatggcttga 523

---

>emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504

---

>emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 417 catgtcagtctcatcgtcccatggcttga 445
           |||||| ||||||||||||||||||||||
Sbjct: 548 catgtcggtctcatcgtcccatggcttga 520

---

>gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:47831
            IMAGE:5733799), complete cds
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 417  catgtcagtctcatcgtcccatggcttga 445
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204

---

>ref|NM_111256.2| Arabidopsis thaliana unknown protein AT3G03850 mRNA, complete cds
          Length = 472

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 561 atcatcatcatcttcatccttgga 584
           ||||||||||||||||||||||||
Sbjct: 295 atcatcatcatcttcatccttgga 272

---

>ref|XM_467833.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1763

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 552 atccatgtcatcatcatcatcttc 575
           ||||||||||||||||||||||||
Sbjct: 673 atccatgtcatcatcatcatcttc 650

---

>ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM01189.1) partial mRNA
          Length = 678

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| |||||||| ||||| |||||||||||
Sbjct: 465 cttcatgtcggtctcatcatcccagggcttgatgtc 430

---

>gb|BT010920.1| Arabidopsis thaliana At3g03850 mRNA, complete cds
          Length = 633

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 561 atcatcatcatcttcatccttgga 584
           ||||||||||||||||||||||||
Sbjct: 371 atcatcatcatcttcatccttgga 348

---

>gb|AC009540.6|ATAC009540 Arabidopsis thaliana chromosome III BAC F20H23 genomic sequence,
             complete sequence
          Length = 101410

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 561   atcatcatcatcttcatccttgga 584
             ||||||||||||||||||||||||
Sbjct: 33540 atcatcatcatcttcatccttgga 33563

---

>emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 591 cttcatgtcggtttcatcgtcccatgccttgatgtc 626

---

>emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 414 cttcatgtcagtctcatcgtcccatggcttgatgtc 449
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 611 cttcatgtcggtttcatcgtcccatgccttgatgtc 576

---

>emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta
          Length = 900

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 411 cttcttcatgtcagtctcatcgtcccatggcttgat 446
           ||||||||||||||||||||| ||||| || |||||
Sbjct: 525 cttcttcatgtcagtctcatcatcccacggtttgat 490



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 737 atcttgttgaaggcaacaatgtcaca 712

---

>gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 183896

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 87   aaacaaaaccagtagcatttctgt 110
            ||||||||||||||||||||||||
Sbjct: 7442 aaacaaaaccagtagcatttctgt 7465

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 552      atccatgtcatcatcatcatcttc 575
                ||||||||||||||||||||||||
Sbjct: 31644721 atccatgtcatcatcatcatcttc 31644744



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 558      gtcatcatcatcatcttcatc 578
                |||||||||||||||||||||
Sbjct: 18514781 gtcatcatcatcatcttcatc 18514761

---

>emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH68ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 558

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 397 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 452
           ||||| ||||| | |||||||||||| || ||||| ||||| |||||||| |||||
Sbjct: 201 acagcttcctctagcttcttcatgtccgtttcatcatcccacggcttgatatccat 146



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 199 atcttgttgaaggcaacgatgtcaca 224
           ||||||||||||||||| ||||||||
Sbjct: 399 atcttgttgaaggcaacaatgtcaca 374

---

>gb|AC172304.2| Gallus gallus BAC clone CH261-75C12 from chromosome ul, complete sequence
          Length = 227366

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 582    ggaagcagcaggagcagctgcagc 605
              ||||||||||||||||||||||||
Sbjct: 184837 ggaagcagcaggagcagctgcagc 184814

---

>dbj|AP004774.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0431B06
          Length = 154796

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 552    atccatgtcatcatcatcatcttc 575
              ||||||||||||||||||||||||
Sbjct: 135281 atccatgtcatcatcatcatcttc 135304

---

>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1288_G09
          Length = 109672

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 552   atccatgtcatcatcatcatcttc 575
             ||||||||||||||||||||||||
Sbjct: 24508 atccatgtcatcatcatcatcttc 24531

---

>dbj|AK072544.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132N16, full
           insert sequence
          Length = 1762

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 552 atccatgtcatcatcatcatcttc 575
           ||||||||||||||||||||||||
Sbjct: 673 atccatgtcatcatcatcatcttc 650

---

>gb|AC132123.3| Mus musculus BAC clone RP24-79F8 from 1, complete sequence
          Length = 214923

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 585   agcagcaggagcagctgcagcaggagcc 612
             ||||||||||||||| ||||||||||||
Sbjct: 80854 agcagcaggagcagcagcagcaggagcc 80881

---

>gb|AC151789.1| Ornithorhynchus anatinus chromosome UNK clone OABb-148A1, complete
             sequence
          Length = 125903

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 552   atccatgtcatcatcatcatcttcatc 578
             ||||||||||||||||||||| |||||
Sbjct: 34113 atccatgtcatcatcatcatcatcatc 34139

---

>gb|AY398339.1| Danio rerio clone RK121A4C07 eukaryotic translation elongation
           factor 1 beta 2 (EEF1B2) mRNA, complete cds
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 315 gatctggagcttcttgatgccataacccacaggca 349
           |||||| ||||||||||||||||| || |||||||
Sbjct: 850 gatctgcagcttcttgatgccatagccaacaggca 816

---

>gb|AC115868.12| Mus musculus chromosome 7, clone RP24-329F21, complete sequence
          Length = 181717

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 585   agcagcaggagcagctgcagcaggagc 611
             ||||||||||||||| |||||||||||
Sbjct: 22494 agcagcaggagcagcagcagcaggagc 22468

---

>gb|AC134886.5| Oryza sativa chromosome 3 BAC OSJNBa0002D18 genomic sequence, complete
              sequence
          Length = 145714

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                          
Query: 512    ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
              ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 114193 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 114252

                     
Query: 572    cttcatc 578
              |||||||
Sbjct: 114253 cttcatc 114259

---

>gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 230137

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 585  agcagcaggagcagctgcagcaggagc 611
            ||||||||||||||| |||||||||||
Sbjct: 9884 agcagcaggagcagcagcagcaggagc 9858



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 585  agcagcaggagcagctgcagcaggagc 611
            ||||||||||||||| |||||||||||
Sbjct: 8957 agcagcaggagcagcagcagcaggagc 8931

---

>gb|AC116595.4| Mus musculus BAC clone RP24-127G9 from chromosome 18, complete sequence
          Length = 158788

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 585   agcagcaggagcagctgcagcaggagc 611
             ||||||||||||||| |||||||||||
Sbjct: 89945 agcagcaggagcagcagcagcaggagc 89971



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 585   agcagcaggagcagctgcagcaggagc 611
             ||||||||||||||| |||||||||||
Sbjct: 89876 agcagcaggagcagcagcagcaggagc 89902

---

>gb|AC141927.3| Mus musculus BAC clone RP23-237F16 from chromosome 6, complete sequence
          Length = 186452

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 585    agcagcaggagcagctgcagcaggagc 611
              ||||||||||||||| |||||||||||
Sbjct: 184486 agcagcaggagcagcagcagcaggagc 184460



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 585    agcagcaggagcagctgcagcaggagc 611
              ||||||||||||||| |||||||||||
Sbjct: 184408 agcagcaggagcagcagcagcaggagc 184382



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 585    agcagcaggagcagctgcagcaggagc 611
              ||||||||||||||| |||||||||||
Sbjct: 184330 agcagcaggagcagcagcagcaggagc 184304



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 587    cagcaggagcagctgcagcaggagc 611
              ||||||||||||| |||||||||||
Sbjct: 184367 cagcaggagcagcagcagcaggagc 184343

---

>gb|BC046042.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:56277 IMAGE:5602371), complete cds
          Length = 806

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 315 gatctggagcttcttgatgccataacccacaggca 349
           |||||| ||||||||||||||||| || |||||||
Sbjct: 633 gatctgcagcttcttgatgccatagccaacaggca 599

---

>ref|XM_606509.2| PREDICTED: Bos taurus similar to Proprotein convertase
            subtilisin/kexin type 5 precursor (Proprotein convertase
            PC5) (Subtilisin/kexin-like protease PC5) (PC6)
            (Subtilisin-like proprotein convertase 6) (SPC6)
            (LOC528098), mRNA
          Length = 3129

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 556  atgtcatcatcatcatcttcatc 578
            |||||||||||||||||||||||
Sbjct: 3017 atgtcatcatcatcatcttcatc 2995

---

>gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosome Y, complete sequence
          Length = 147674

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 80    gactcaaaaacaaaaccagtagc 102
             |||||||||||||||||||||||
Sbjct: 97310 gactcaaaaacaaaaccagtagc 97332

---

>gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosome Y, complete sequence
          Length = 172606

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 80     gactcaaaaacaaaaccagtagc 102
              |||||||||||||||||||||||
Sbjct: 145559 gactcaaaaacaaaaccagtagc 145537

---

>gb|AC068006.10| Mus musculus chromosome 7, clone RP23-6I17, complete sequence
          Length = 203141

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 559    tcatcatcatcatcttcatccttggaagcagcaggagcagctgcagc 605
              |||||||||||||| ||||| || | |||||||| |||||| |||||
Sbjct: 150935 tcatcatcatcatcatcatcattagcagcagcagcagcagcagcagc 150981

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                            
Query: 512      ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
                ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 16470140 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 16470081

                       
Query: 572      cttcatc 578
                |||||||
Sbjct: 16470080 cttcatc 16470074



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 558      gtcatcatcatcatcttcatc 578
                |||||||||||||||||||||
Sbjct: 22096467 gtcatcatcatcatcttcatc 22096487



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 553      tccatgtcatcatcatcatc 572
                ||||||||||||||||||||
Sbjct: 26454950 tccatgtcatcatcatcatc 26454931

---

>gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome Y, complete sequence
          Length = 143481

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 80    gactcaaaaacaaaaccagtagc 102
             |||||||||||||||||||||||
Sbjct: 38840 gactcaaaaacaaaaccagtagc 38862

---

>emb|CT009620.9| Zebrafish DNA sequence from clone CH73-187F10 in linkage group 6,
             complete sequence
          Length = 95528

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 315   gatctggagcttcttgatgccataacccacaggca 349
             |||||| ||||||||||||||||| || |||||||
Sbjct: 89778 gatctgcagcttcttgatgccatagccaacaggca 89812

---

>gb|AC117214.3| Mus musculus BAC clone RP23-307B15 from chromosome 9, complete sequence
          Length = 219833

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                 
Query: 559    tcatcatcatcatcttcatccttggaagcagcaggagcagctgcagcagga 609
              |||||||||||||| ||||| |  | |||||||| |||||| |||||||||
Sbjct: 142325 tcatcatcatcatcatcatcatcagcagcagcagcagcagcagcagcagga 142275

---

>gb|AY444796.1| Pisum sativum translational elongation factor 1 subunit Bbeta
           (eEF1Bbeta) mRNA, complete cds
          Length = 709

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 411 cttcttcatgtcagtctcatcgtccca 437
           ||||||||||||||| |||||||||||
Sbjct: 493 cttcttcatgtcagtttcatcgtccca 467

---

>gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, complete sequence
          Length = 172114

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 585 agcagcaggagcagctgcagcaggagc 611
           ||||||||||||||| |||||||||||
Sbjct: 267 agcagcaggagcagcagcagcaggagc 293



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 585 agcagcaggagcagctgcagcaggagc 611
           ||||||||||||||| |||||||||||
Sbjct: 198 agcagcaggagcagcagcagcaggagc 224

---

>ref|XM_722910.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00959)
            partial mRNA
          Length = 15222

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 552  atccatgtcatcatcatcatcttcatc 578
            ||||||||||||||||||||| |||||
Sbjct: 8664 atccatgtcatcatcatcatcatcatc 8638



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 559  tcatcatcatcatcttcatc 578
            ||||||||||||||||||||
Sbjct: 8651 tcatcatcatcatcttcatc 8632

---

>gb|AC107662.9| Mus musculus chromosome 9, clone RP23-99B22, complete sequence
          Length = 233476

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 585   agcagcaggagcagctgcagcaggagc 611
             ||||||||||||||| |||||||||||
Sbjct: 26514 agcagcaggagcagcagcagcaggagc 26488

---

>ref|XM_541276.2| PREDICTED: Canis familiaris similar to Proprotein convertase
            subtilisin/kexin type 5 precursor (Proprotein convertase
            PC5) (Subtilisin/kexin-like protease PC5) (PC6)
            (Subtilisin-like proprotein convertase 6) (SPC6)
            (LOC484160), mRNA
          Length = 5920

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 556  atgtcatcatcatcatcttcatc 578
            |||||||||||||||||||||||
Sbjct: 5540 atgtcatcatcatcatcttcatc 5518

---

>gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNING: chimeric clone
           ****
          Length = 996

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 461
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 695 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 636

                  
Query: 462 ggatttg 468
           |||||||
Sbjct: 635 ggatttg 629

---

>emb|BX029538.1|CNS08UYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 414 cttcatgtcagtctcatcgtcccatggcttg 444
           ||||||||| || ||||||||||||||||||
Sbjct: 604 cttcatgtcggtttcatcgtcccatggcttg 634

---

>emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 bp, chromosome 7
          Length = 281000

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 559   tcatcatcatcatcttcatccttggaagcagcaggagcagctgcagc 605
             |||||||||||||| ||||| || | |||||||| |||||| |||||
Sbjct: 71945 tcatcatcatcatcatcatcattagcagcagcagcagcagcagcagc 71899

---

>emb|AJ237772.1|OLA237772 Oryzias latipes mRNA for elongation factor 1 beta, partial
          Length = 283

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 314 tgatctggagcttcttgatgccataacccac 344
           ||||||| |||||||||||||| ||||||||
Sbjct: 148 tgatctgcagcttcttgatgccgtaacccac 118

---

>ref|NM_031593.1| Rattus norvegicus synaptic vesicle glycoprotein 2c (Sv2c), mRNA
          Length = 2622

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 558 gtcatcatcatcatcttcatcct 580
           |||||||||||||||||||||||
Sbjct: 394 gtcatcatcatcatcttcatcct 372

---

>dbj|AK132167.1| Mus musculus 17 days embryo head cDNA, RIKEN full-length enriched
            library, clone:3321401J18 product:hypothetical protein,
            full insert sequence
          Length = 5500

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 585  agcagcaggagcagctgcagcaggagc 611
            ||||||||||||||| |||||||||||
Sbjct: 3032 agcagcaggagcagcagcagcaggagc 3058

---

>gb|AE010144.1| Pyrococcus furiosus DSM 3638, section 19 of 173 of the complete
            genome
          Length = 10062

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 589  gcaggagcagctgcagcaggagc 611
            |||||||||||||||||||||||
Sbjct: 2467 gcaggagcagctgcagcaggagc 2489

---

>ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
           (EF-1-delta), transcript variant 2 (LOC565501), mRNA
          Length = 753

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 461
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 576 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 517

                  
Query: 462 ggatttg 468
           |||||||
Sbjct: 516 ggatttg 510

---

>ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
            (EF-1-delta), transcript variant 1 (LOC565501), mRNA
          Length = 1479

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 402  ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 461
            |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 1196 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 1137

                   
Query: 462  ggatttg 468
            |||||||
Sbjct: 1136 ggatttg 1130

---

>gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, complete sequence
          Length = 185347

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 559   tcatcatcatcatcttcatccttggaagcagcaggagcagctgcagc 605
             |||||||||||||| ||||| || | |||||||| |||||| |||||
Sbjct: 19828 tcatcatcatcatcatcatcattagcagcagcagcagcagcagcagc 19874

---

>gb|AC160560.2| Mus musculus BAC clone RP23-357O18 from chromosome 9, complete sequence
          Length = 213978

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 585    agcagcaggagcagctgcagcaggagc 611
              ||||||||||||||| |||||||||||
Sbjct: 196800 agcagcaggagcagcagcagcaggagc 196774

---

>gb|AC123704.21| Mus musculus chromosome 15, clone RP23-351F24, complete sequence
          Length = 202330

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 556   atgtcatcatcatcatcttcatc 578
             |||||||||||||||||||||||
Sbjct: 92089 atgtcatcatcatcatcttcatc 92111

---

>gb|AC008339.2|AC008339 Drosophila melanogaster, chromosome 2R, region 42A-42A, BAC clone
             BACR13P06, complete sequence
          Length = 180699

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 559   tcatcatcatcatcttcatccttggaagcag 589
             |||||||||||||| ||||| ||||||||||
Sbjct: 91603 tcatcatcatcatcatcatcattggaagcag 91633

---

>gb|AC009255.4|AC009255 Drosophila melanogaster, chromosome 2R, region 42A-42A, BAC clone
              BACR39E09, complete sequence
          Length = 163990

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 559    tcatcatcatcatcttcatccttggaagcag 589
              |||||||||||||| ||||| ||||||||||
Sbjct: 135428 tcatcatcatcatcatcatcattggaagcag 135458

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                            
Query: 512      ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
                ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 16463773 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 16463714

                       
Query: 572      cttcatc 578
                |||||||
Sbjct: 16463713 cttcatc 16463707



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 558      gtcatcatcatcatcttcatc 578
                |||||||||||||||||||||
Sbjct: 22089496 gtcatcatcatcatcttcatc 22089516



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 553      tccatgtcatcatcatcatc 572
                ||||||||||||||||||||
Sbjct: 26546259 tccatgtcatcatcatcatc 26546240

---

>ref|NM_199949.2| Danio rerio eukaryotic translation elongation factor 1 beta 2
           (eef1b2), mRNA
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 315 gatctggagcttcttgatgccataacccacaggca 349
           |||||| ||||||||||||||||| || |||||||
Sbjct: 850 gatctgcagcttcttgatgccatagccaacaggca 816

---

>dbj|AK073405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042N03, full
           insert sequence
          Length = 933

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 448 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 389

                  
Query: 572 cttcatc 578
           |||||||
Sbjct: 388 cttcatc 382

---

>emb|BX936364.6| Zebrafish DNA sequence from clone CH211-247G11 in linkage group 18,
             complete sequence
          Length = 146733

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 559   tcatcatcatcatcttcatccttggaa 585
             |||||||||||||| ||||||||||||
Sbjct: 61382 tcatcatcatcatcatcatccttggaa 61356

---

>dbj|AK059914.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-E04, full
           insert sequence
          Length = 972

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 479 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 420

                  
Query: 572 cttcatc 578
           |||||||
Sbjct: 419 cttcatc 413

---

>gb|AC007121.1|AC007121 Drosophila melanogaster, chromosome 2R, region 42A8-42A16, P1 clones
             DS06954 and DS05325, complete sequence
          Length = 135182

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 559   tcatcatcatcatcttcatccttggaagcag 589
             |||||||||||||| ||||| ||||||||||
Sbjct: 53339 tcatcatcatcatcatcatcattggaagcag 53309

---

>gb|AE003784.5| Drosophila melanogaster chromosome 2R, section 5 of 73 of the complete
              sequence
          Length = 305162

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 559    tcatcatcatcatcttcatccttggaagcag 589
              |||||||||||||| ||||| ||||||||||
Sbjct: 154090 tcatcatcatcatcatcatcattggaagcag 154120

---

>gb|AC152961.2| Mus musculus 6 BAC RP23-4H14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 227467

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 585    agcagcaggagcagctgcagcaggagc 611
              ||||||||||||||| |||||||||||
Sbjct: 166306 agcagcaggagcagcagcagcaggagc 166332



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 585    agcagcaggagcagctgcagcaggagc 611
              ||||||||||||||| |||||||||||
Sbjct: 166228 agcagcaggagcagcagcagcaggagc 166254



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 585    agcagcaggagcagctgcagcaggagc 611
              ||||||||||||||| |||||||||||
Sbjct: 166150 agcagcaggagcagcagcagcaggagc 166176



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 587    cagcaggagcagctgcagcaggagc 611
              ||||||||||||| |||||||||||
Sbjct: 166269 cagcaggagcagcagcagcaggagc 166293

---

>gb|AF060174.1|AF060174 Rattus norvegicus synaptic vesicle protein 2C (SV2C) mRNA, complete
           cds
          Length = 2622

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 558 gtcatcatcatcatcttcatcct 580
           |||||||||||||||||||||||
Sbjct: 394 gtcatcatcatcatcttcatcct 372

---

>emb|BX908786.9| Zebrafish DNA sequence from clone CH211-13O8 in linkage group 3,
             complete sequence
          Length = 121030

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 559   tcatcatcatcatcttcatcctt 581
             |||||||||||||||||||||||
Sbjct: 64784 tcatcatcatcatcttcatcctt 64806

---

>gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complete sequence
          Length = 198224

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 80     gactcaaaaacaaaaccagtagc 102
              |||||||||||||||||||||||
Sbjct: 102524 gactcaaaaacaaaaccagtagc 102546

---

>gb|BC096865.1| Danio rerio cold inducible RNA binding protein, mRNA (cDNA clone
           MGC:111981 IMAGE:7401032), complete cds
          Length = 919

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 461
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 616 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 557

                  
Query: 462 ggatttg 468
           |||||||
Sbjct: 556 ggatttg 550

---

>gb|BC071464.1| Danio rerio eukaryotic translation elongation factor 1 beta 2, mRNA
           (cDNA clone MGC:86802 IMAGE:6901030), complete cds
          Length = 823

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 315 gatctggagcttcttgatgccataacccacaggca 349
           |||||| ||||||||||||||||| || |||||||
Sbjct: 635 gatctgcagcttcttgatgccatagccaacaggca 601

---

>gb|AC159106.2| Mus musculus chromosome 14 clone RP23-244I11, complete sequence
          Length = 168884

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 585   agcagcaggagcagctgcagcaggagc 611
             ||||||||||||||| |||||||||||
Sbjct: 77535 agcagcaggagcagcagcagcaggagc 77509



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 585   agcagcaggagcagctgcagcaggagc 611
             ||||||||||||||| |||||||||||
Sbjct: 77520 agcagcaggagcagcagcagcaggagc 77494

---

>gb|L47221.1|PHVEIF Phaseolus vulgaris eukaryotic initiation factor 5 (eIF-5) gene,
           complete cds
          Length = 1688

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 559 tcatcatcatcatcttcatcctt 581
           |||||||||||||||||||||||
Sbjct: 792 tcatcatcatcatcttcatcctt 770

---

>gb|M36626.1|RATSIMPA1 Rat simple sequence DNA, clone 5
          Length = 205

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 585 agcagcaggagcagctgcagcaggagc 611
           ||||||||||||||| |||||||||||
Sbjct: 149 agcagcaggagcagcagcagcaggagc 175

---

>gb|L36094.1|RICENDP Oryza sativa unknown ORF mRNA, complete cds
          Length = 759

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 260 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 201

                  
Query: 572 cttcatc 578
           |||||||
Sbjct: 200 cttcatc 194

---

>dbj|D83727.1| Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta 2, complete cds
          Length = 1350

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 512 ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
           ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 457 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 398

                  
Query: 572 cttcatc 578
           |||||||
Sbjct: 397 cttcatc 391

---

>dbj|D83726.1| Oryza sativa (japonica cultivar-group) gene for elongation factor 1
            beta 2, complete cds
          Length = 7364

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 512  ctgctgctttcttgtcctcctcggtctcatcgccgaacagatccatgtcatcatcatcat 571
            ||||||||||||| ||||| || ||||| || || |||||||| |  || |||||||| |
Sbjct: 2883 ctgctgctttcttctcctcttcagtctcctcaccaaacagatcaacatcgtcatcatctt 2824

                   
Query: 572  cttcatc 578
            |||||||
Sbjct: 2823 cttcatc 2817

---

>ref|XM_633465.1| Dictyostelium discoideum hypothetical protein (DDB0218618), partial
            mRNA
          Length = 1587

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 557  tgtcatcatcatcatcttcatc 578
            ||||||||||||||||||||||
Sbjct: 1390 tgtcatcatcatcatcttcatc 1369

---

>gb|AC151754.1| Ornithorhynchus anatinus chromosome UNK clone OABb-469A1, complete
             sequence
          Length = 138437

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 586   gcagcaggagcagctgcagcag 607
             ||||||||||||||||||||||
Sbjct: 74348 gcagcaggagcagctgcagcag 74327



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 588   agcaggagcagctgcagcaggagc 611
             ||||| ||||||||||||||||||
Sbjct: 74382 agcagcagcagctgcagcaggagc 74359



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 588   agcaggagcagctgcagcaggagc 611
             ||||| ||||||||||||||||||
Sbjct: 74361 agcagcagcagctgcagcaggagc 74338

---

>ref|XM_641752.1| Dictyostelium discoideum hypothetical protein (DDB0202279), partial
            mRNA
          Length = 5319

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 559  tcatcatcatcatcttcatcct 580
            ||||||||||||||||||||||
Sbjct: 5084 tcatcatcatcatcttcatcct 5063

---

>ref|XM_638843.1| Dictyostelium discoideum hypothetical protein (DDB0220625), partial
            mRNA
          Length = 2505

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 559  tcatcatcatcatcttcatcct 580
            ||||||||||||||||||||||
Sbjct: 2294 tcatcatcatcatcttcatcct 2273

---

>ref|XM_635517.1| Dictyostelium discoideum hypothetical protein (DDB0204637), partial
           mRNA
          Length = 1647

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 559 tcatcatcatcatcttcatcct 580
           ||||||||||||||||||||||
Sbjct: 112 tcatcatcatcatcttcatcct 133

---

>ref|XM_630066.1| Dictyostelium discoideum peptidase A22 family protein (DDB0231427),
           partial mRNA
          Length = 1869

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 558 gtcatcatcatcatcttcatcc 579
           ||||||||||||||||||||||
Sbjct: 465 gtcatcatcatcatcttcatcc 444

---

>ref|XM_629777.1| Dictyostelium discoideum hypothetical protein (DDB0184174), partial
            mRNA
          Length = 4563

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 559  tcatcatcatcatcttcatcct 580
            ||||||||||||||||||||||
Sbjct: 4507 tcatcatcatcatcttcatcct 4528

---

>ref|XM_510590.1| PREDICTED: Pan troglodytes semaphorin 4B (LOC453646), mRNA
          Length = 2144

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 586 gcagcaggagcagctgcagcaggagc 611
           |||||||||||||| |||||||||||
Sbjct: 348 gcagcaggagcagcagcagcaggagc 323

---

>gb|AC145810.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0059C14, complete sequence
          Length = 142138

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 559   tcatcatcatcatcttcatccttgga 584
             |||||||||||||||||||| |||||
Sbjct: 72282 tcatcatcatcatcttcatcattgga 72307

---

>gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
             OSJNBa0035B22, complete sequence
          Length = 155788

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 559   tcatcatcatcatcttcatcct 580
             ||||||||||||||||||||||
Sbjct: 10721 tcatcatcatcatcttcatcct 10700


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9,294,062
Number of Sequences: 3902068
Number of extensions: 9294062
Number of successful extensions: 364874
Number of sequences better than 10.0: 1678
Number of HSP's better than 10.0 without gapping: 1688
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 352735
Number of HSP's gapped (non-prelim): 11089
length of query: 641
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 618
effective length of database: 17,143,297,704
effective search space: 10594557981072
effective search space used: 10594557981072
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---