>gb|BC090190.1| Xenopus laevis cDNA clone IMAGE:6326555, partial cds
          Length = 1451

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 108 actgtaatgttgccatctttgatcaa 133
           |||||| |||||||||||||||||||
Sbjct: 526 actgtagtgttgccatctttgatcaa 501

>gb|AC146316.3| Microcebus murinus clone CH257-437M14, complete sequence
          Length = 274705

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 115    tgttgccatctttgatcaaactctt 139
              |||||||| ||||||||||||||||
Sbjct: 254235 tgttgccagctttgatcaaactctt 254259

>ref|XM_368176.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
            (MG01068.4) partial mRNA
          Length = 4038

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 559  ctttgtagtatttcttcagag 579
            |||||||||||||||||||||
Sbjct: 1084 ctttgtagtatttcttcagag 1064

>gb|DP000022.1| Microcebus murinus target 1 genomic scaffold
          Length = 1595145

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 115    tgttgccatctttgatcaaactctt 139
              |||||||| ||||||||||||||||
Sbjct: 825726 tgttgccagctttgatcaaactctt 825750

>gb|AC165229.7| Mus musculus chromosome 1, clone RP23-47K10, complete sequence
          Length = 218929

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 43    aagtcttatataacacaaccaaaa 66
             |||||||||| |||||||||||||
Sbjct: 62749 aagtcttatagaacacaaccaaaa 62726

>gb|DQ443407.1| Bombyx mori estrogen sulfotransferase mRNA, complete cds
          Length = 1508

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 559 ctttgtagtatttcttcaga 578
           ||||||||||||||||||||
Sbjct: 147 ctttgtagtatttcttcaga 128

>emb|AL451105.13| Human DNA sequence from clone RP11-212D3 on chromosome X Contains a
             SAR1a gene homolog 1 (S. cerevisiae) (SARA1) pseudogene,
             two novel genes and a chromosome 14 open reading frame 116
             (C14orf116) pseudogene, complete sequence
          Length = 125288

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 105   ggtactgtaatgttgccatctttg 128
             |||| |||||||||||||||||||
Sbjct: 84230 ggtaatgtaatgttgccatctttg 84253

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 151    aaggatccttggggttactg 170
              ||||||||||||||||||||
Sbjct: 498233 aaggatccttggggttactg 498252

>emb|AL137000.6| Human DNA sequence from clone RP11-203I16 on chromosome 13 Contains the
             gene for KIAA0970 protein,  the COX7CP1 cytochrome c
             oxidase subunit VIIc pseudogene 1, a novel pseudogene, the
             GPR38 gene for G protein-coupled receptor 38 and a CpG
             island, complete sequence
          Length = 163284

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    aataagtcttatataacaca 59
             ||||||||||||||||||||
Sbjct: 11055 aataagtcttatataacaca 11036

>gb|AY003872.1| Plasmodium vivax YAC 1H14, complete sequence
          Length = 199866

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 562    tgtagtatttcttcagagtg 581
              ||||||||||||||||||||
Sbjct: 179841 tgtagtatttcttcagagtg 179860

>gb|AC091332.8| Mus musculus chromosome 17, clone RP23-12K1, complete sequence
          Length = 216370

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    ttttgtggtactgtaatgtt 118
             ||||||||||||||||||||
Sbjct: 42841 ttttgtggtactgtaatgtt 42860


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,060,685
Number of Sequences: 3902068
Number of extensions: 4060685
Number of successful extensions: 63281
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63237
Number of HSP's gapped (non-prelim): 44
length of query: 612
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 589
effective length of database: 17,143,297,704
effective search space: 10097402347656
effective search space used: 10097402347656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)