>gb|AC016700.8| Homo sapiens BAC clone RP11-175A7 from 2, complete sequence
          Length = 177995

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 1     acttttcttacaaaataatcagctaa 26
             |||||||||||||||||| |||||||
Sbjct: 86048 acttttcttacaaaataaacagctaa 86073

>emb|Z80107.2|HS197J16 Human DNA sequence from clone RP1-197J16 on chromosome X Contains a
             histone H2B family pseudogene, a novel pseudogene and a
             NADH dehydrogenase 6 (MTND6) pseudogene, complete sequence
          Length = 110715

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     ttcttacaaaataatcagct 24
             ||||||||||||||||||||
Sbjct: 18793 ttcttacaaaataatcagct 18774

>gb|AE017134.1| Yersinia pestis biovar Medievalis str. 91001 section 8 of 16 of the
              complete genome
          Length = 290029

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     acaaaataatcagctaact 28
              |||||||||||||||||||
Sbjct: 140423 acaaaataatcagctaact 140405

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 10      acaaaataatcagctaact 28
               |||||||||||||||||||
Sbjct: 2395095 acaaaataatcagctaact 2395113

>gb|AC132588.4| Mus musculus BAC clone RP24-258L16 from chromosome 10, complete
             sequence
          Length = 136807

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    tgatggaggacaacataca 112
             |||||||||||||||||||
Sbjct: 53959 tgatggaggacaacataca 53941

>emb|AL035454.18|HS1002M8 Human DNA sequence from clone RP5-1002M8 on chromosome 20p11.21-11.23
             Contains the 3' end of the NAT5 gene for
             N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae), the
             CRNKL1 gene for crooked neck-like 1 (Drosophila) (Crn),
             the 5' end of the C20orf26 gene for chromosome 20 open
             reading frame 26 (C20orf26) and a CpG island, complete
             sequence
          Length = 111768

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     acttttcttacaaaataat 19
             |||||||||||||||||||
Sbjct: 27973 acttttcttacaaaataat 27955

>emb|AL021978.1|HS147M19 Human DNA sequence from clone RP1-147M19 on chromosome 6p22.1-22.3
             Contains the 3' end of the DTNBP1 gene for dystobrevin
             binding protein 1, complete sequence
          Length = 73087

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     acttttcttacaaaataat 19
             |||||||||||||||||||
Sbjct: 42824 acttttcttacaaaataat 42842

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 10      acaaaataatcagctaact 28
               |||||||||||||||||||
Sbjct: 2452383 acaaaataatcagctaact 2452365

>emb|AJ414151.1| Yersinia pestis strain CO92 complete genome; segment 11/20
          Length = 334050

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     acaaaataatcagctaact 28
              |||||||||||||||||||
Sbjct: 159097 acaaaataatcagctaact 159079

>emb|CR848717.7| Zebrafish DNA sequence from clone DKEY-148B12 in linkage group 5,
             complete sequence
          Length = 207800

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     acttttcttacaaaataat 19
             |||||||||||||||||||
Sbjct: 12348 acttttcttacaaaataat 12330

>dbj|AK137649.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched
            library, clone:9930012O12 product:unclassifiable, full
            insert sequence
          Length = 4700

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 94   tgatggaggacaacataca 112
            |||||||||||||||||||
Sbjct: 3281 tgatggaggacaacataca 3263

>emb|BX511248.7| Zebrafish DNA sequence from clone CH211-173N20 in linkage group 5,
              complete sequence
          Length = 142117

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 97     tggaggacaacatacaaat 115
              |||||||||||||||||||
Sbjct: 117016 tggaggacaacatacaaat 117034

>gb|AC084242.4|AC084242 Arabidopsis thaliana chromosome 1 BAC T24P22 genomic sequence,
            complete sequence
          Length = 18062

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 134  tgaggtaagaatatcacca 152
            |||||||||||||||||||
Sbjct: 9502 tgaggtaagaatatcacca 9484

>gb|AC084414.2|AC084414 Arabidopsis thaliana chromosome 1 BAC F27K7 genomic sequence, complete
             sequence
          Length = 54313

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 134   tgaggtaagaatatcacca 152
             |||||||||||||||||||
Sbjct: 53784 tgaggtaagaatatcacca 53766

>gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, complete sequence
          Length = 180660

 Score = 38.2 bits (19), Expect = 8.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 145   tatcaccatgactgaggca 163
             |||||||||||||||||||
Sbjct: 24192 tatcaccatgactgaggca 24210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,078,403
Number of Sequences: 3902068
Number of extensions: 1078403
Number of successful extensions: 70854
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70799
Number of HSP's gapped (non-prelim): 55
length of query: 167
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 145
effective length of database: 17,147,199,772
effective search space: 2486343966940
effective search space used: 2486343966940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)