>gb|L41506.1|WHTHSP70B Triticum aestivum heat shock protein (hsp70B) mRNA,  partial cds
          Length = 257

 Score = 75.8 bits (38), Expect = 2e-11
 Identities = 53/57 (92%), Gaps = 1/57 (1%)
 Strand = Plus / Minus

                                                                    
Query: 1   gggcaacgtatatatgcccgaacgaaaaattgcagaacgatactngcaatccaccgt 57
           |||||| |||||||||||||||||||||| |||||||||||||| | ||||||||||
Sbjct: 137 gggcaatgtatatatgcccgaacgaaaaactgcagaacgatactag-aatccaccgt 82

>gb|L41505.1|WHTHSP70A Triticum aestivum heat shock protein (hsp70A) mRNA, partial cds
          Length = 289

 Score = 75.8 bits (38), Expect = 2e-11
 Identities = 53/57 (92%), Gaps = 1/57 (1%)
 Strand = Plus / Minus

                                                                    
Query: 1   gggcaacgtatatatgcccgaacgaaaaattgcagaacgatactngcaatccaccgt 57
           |||||| |||||||||||||||||||||| |||||||||||||| | ||||||||||
Sbjct: 138 gggcaatgtatatatgcccgaacgaaaaactgcagaacgatactag-aatccaccgt 83


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 267,187
Number of Sequences: 3902068
Number of extensions: 267187
Number of successful extensions: 16680
Number of sequences better than 10.0: 2
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16678
Number of HSP's gapped (non-prelim): 2
length of query: 109
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 88
effective length of database: 17,151,101,840
effective search space: 1509296961920
effective search space used: 1509296961920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)