ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags1i19 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 mRNA, complete cds Length = 868 Score = 214 bits (108), Expect = 2e-52 Identities = 170/191 (89%) Strand = Plus / Minus Query: 264 cggcttgggcaccgggccgtagtctgggtggggctggggcttgggctccggcttcggtgg 323 |||||||||||| ||| ||||| || |||||||||||||||||||||||||| || || Sbjct: 192 cggcttgggcacggggtgatagtcaggatggggctggggcttgggctccggcttgggcgg 133 Query: 324 cacgggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggt 383 |||||||| |||||||||||| ||||| |||||||| |||||||| |||||||||| ||| Sbjct: 132 cacgggctgcttgtggtggaaatgctcgatgatgtgcttcttgatcggcccgcacaaggt 73 Query: 384 catggactggcactccggcgacgctgcanacggcgtggcaatgttgtcaccggcgacgat 443 ||||||| |||||| |||||||||||| || ||||||||||| |||| ||||||||||| Sbjct: 72 catggacgcgcactctggcgacgctgcagaccgcgtggcaatgctgtcgccggcgacgat 13 Query: 444 gccgaaggtgg 454 ||||||||||| Sbjct: 12 gccgaaggtgg 2 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 226 acggggtggtagtccgggtggggctgcggcttgggttccggcttgggc 273 |||||||| ||||| || |||||||| |||||||| |||||||||||| Sbjct: 182 acggggtgatagtcaggatggggctggggcttgggctccggcttgggc 135
>ref|NM_194852.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBb0016M10.10), mRNA Length = 906 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcgt 508 |||| |||||||||||||||||||||||| ||||||||||| Sbjct: 357 cggctcgatcttggatggctcctggccggggcacggcgcgt 317
>gb|AC091665.3| Oryza sativa chromosome 10 clone OSJNBb0016M10, complete sequence Length = 118101 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcgt 508 |||| |||||||||||||||||||||||| ||||||||||| Sbjct: 82614 cggctcgatcttggatggctcctggccggggcacggcgcgt 82654 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 110607 cggcacgatcttggacggctcctgcccggggcacggcg 110644 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 102490 cggcacgatcttggacggctcctgcccggggcacggcg 102527
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcgt 508 |||| |||||||||||||||||||||||| ||||||||||| Sbjct: 2901582 cggctcgatcttggatggctcctggccggggcacggcgcgt 2901622 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 2992438 ggcacgatcttggatggctcctggccggggcatggctcgttgg 2992480 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 2992158 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 2992203 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcg 507 ||||||||||||||| |||||||| |||| |||||||||| Sbjct: 2961113 cggcacgatcttggacggctcctgcccggggcacggcgcg 2961152 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||||||||| ||||| || |||||||||||||||||| Sbjct: 3011416 ggcttgggctctggcttgggcggcacgggcttcttgtgg 3011378 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 3000620 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 3000564 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 3000563 ttcttgatgggaccgca 3000547 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 2996587 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 2996531 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 2996530 ttcttgatggggccgca 2996514 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 2992288 ggctttggctccggcttgggtggcaccggcttcttgtgg 2992326 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2970439 cggcacgatcttggacggctcctgcccggggcacggcg 2970402 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2938498 cggcacgatcttggacggctcctgcccggggcacggcg 2938535 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2929575 cggcacgatcttggacggctcctgcccggggcacggcg 2929612 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2921458 cggcacgatcttggacggctcctgcccggggcacggcg 2921495 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 3011143 ggcacgatcttggatggctcttgtccggggcatggctcgttgg 3011101 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 3000743 ggcttcggctctggcttaggtggcactggcttcttgtgg 3000705 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 3000470 ggcacgatcttggatggctcctg 3000448 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 2996437 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 2996395 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 9661768 tccaccgccaccgccgccgccg 9661789 Score = 44.1 bits (22), Expect = 0.44 Identities = 43/50 (86%) Strand = Plus / Plus Query: 328 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgca 377 ||||| |||||||||||||| || | || ||| |||||||||||| |||| Sbjct: 2978751 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgca 2978800 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 472 acgatcttggatggctcctggccggagcacggcg 505 ||||||||||| |||||||| |||| |||||||| Sbjct: 2946242 acgatcttggacggctcctgcccggggcacggcg 2946275 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 22669853 ccaccgccaccgccgccgccg 22669833 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 20120402 ccaccgccaccgccgccgccg 20120382 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 18930643 ccaccgccaccgccgccgccg 18930623 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 18787143 ccaccgccaccgccgccgccg 18787123 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 18555503 ccaccgccaccgccgccgccg 18555483 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 13010146 ccaccgccaccgccgccgccg 13010166 Score = 42.1 bits (21), Expect = 1.8 Identities = 59/71 (83%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgtttcttg 366 ||||| ||||| |||||||| |||||||||||| ||||| || ||||| | |||||| Sbjct: 3011287 ggctctggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttcttcttg 3011231 Query: 367 atgggcccgca 377 ||||| ||||| Sbjct: 3011230 atgggaccgca 3011220 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 2996704 ggctcaggcttgggtggtacgggcttcttgtgg 2996672 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 20536281 ccaccgccaccgccgccgcc 20536300 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ggctgcggcttgggttccggcttgggcaccgg 278 |||||||||||||| || ||||||||| |||| Sbjct: 3011446 ggctgcggcttgggctctggcttgggctccgg 3011415
>dbj|AK071590.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100N02, full insert sequence Length = 1219 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcgt 508 |||| |||||||||||||||||||||||| ||||||||||| Sbjct: 411 cggctcgatcttggatggctcctggccggggcacggcgcgt 371
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcgt 508 |||| |||||||||||||||||||||||| ||||||||||| Sbjct: 2901533 cggctcgatcttggatggctcctggccggggcacggcgcgt 2901573 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 2992359 ggcacgatcttggatggctcctggccggggcatggctcgttgg 2992401 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 2992079 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 2992124 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcg 507 ||||||||||||||| |||||||| |||| |||||||||| Sbjct: 2961034 cggcacgatcttggacggctcctgcccggggcacggcgcg 2961073 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||||||||| ||||| || |||||||||||||||||| Sbjct: 3011337 ggcttgggctctggcttgggcggcacgggcttcttgtgg 3011299 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 3000541 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 3000485 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 3000484 ttcttgatgggaccgca 3000468 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 2996508 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 2996452 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 2996451 ttcttgatggggccgca 2996435 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 2992209 ggctttggctccggcttgggtggcaccggcttcttgtgg 2992247 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2970360 cggcacgatcttggacggctcctgcccggggcacggcg 2970323 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2938419 cggcacgatcttggacggctcctgcccggggcacggcg 2938456 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2929496 cggcacgatcttggacggctcctgcccggggcacggcg 2929533 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 2921409 cggcacgatcttggacggctcctgcccggggcacggcg 2921446 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 3011064 ggcacgatcttggatggctcttgtccggggcatggctcgttgg 3011022 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 3000664 ggcttcggctctggcttaggtggcactggcttcttgtgg 3000626 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 3000391 ggcacgatcttggatggctcctg 3000369 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 2996358 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 2996316 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 9667807 tccaccgccaccgccgccgccg 9667828 Score = 44.1 bits (22), Expect = 0.44 Identities = 43/50 (86%) Strand = Plus / Plus Query: 328 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgca 377 ||||| |||||||||||||| || | || ||| |||||||||||| |||| Sbjct: 2978672 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgca 2978721 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 472 acgatcttggatggctcctggccggagcacggcg 505 ||||||||||| |||||||| |||| |||||||| Sbjct: 2946163 acgatcttggacggctcctgcccggggcacggcg 2946196 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 22682321 ccaccgccaccgccgccgccg 22682301 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 20131678 ccaccgccaccgccgccgccg 20131658 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 18941897 ccaccgccaccgccgccgccg 18941877 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 18797997 ccaccgccaccgccgccgccg 18797977 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 18565556 ccaccgccaccgccgccgccg 18565536 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 13017486 ccaccgccaccgccgccgccg 13017506 Score = 42.1 bits (21), Expect = 1.8 Identities = 59/71 (83%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgtttcttg 366 ||||| ||||| |||||||| |||||||||||| ||||| || ||||| | |||||| Sbjct: 3011208 ggctctggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttcttcttg 3011152 Query: 367 atgggcccgca 377 ||||| ||||| Sbjct: 3011151 atgggaccgca 3011141 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 2996625 ggctcaggcttgggtggtacgggcttcttgtgg 2996593 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 20547553 ccaccgccaccgccgccgcc 20547572 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ggctgcggcttgggttccggcttgggcaccgg 278 |||||||||||||| || ||||||||| |||| Sbjct: 3011367 ggctgcggcttgggctctggcttgggctccgg 3011336
>ref|NM_194864.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.12), mRNA Length = 675 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 344 ggcacgatcttggatggctcctggccggggcatggctcgttgg 302 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 624 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 579 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 494 ggctttggctccggcttgggtggcaccggcttcttgtgg 456
>gb|AC084884.2| Oryza sativa chromosome 10 clone OSJNBa0031A07, complete sequence Length = 134553 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 80860 ggcacgatcttggatggctcctggccggggcatggctcgttgg 80902 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 80580 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 80625 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcg 507 ||||||||||||||| |||||||| |||| |||||||||| Sbjct: 49535 cggcacgatcttggacggctcctgcccggggcacggcgcg 49574 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||||||||| ||||| || |||||||||||||||||| Sbjct: 99838 ggcttgggctctggcttgggcggcacgggcttcttgtgg 99800 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 89042 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 88986 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 88985 ttcttgatgggaccgca 88969 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 85009 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 84953 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 84952 ttcttgatggggccgca 84936 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 80710 ggctttggctccggcttgggtggcaccggcttcttgtgg 80748 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 58861 cggcacgatcttggacggctcctgcccggggcacggcg 58824 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 26920 cggcacgatcttggacggctcctgcccggggcacggcg 26957 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 17997 cggcacgatcttggacggctcctgcccggggcacggcg 18034 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 9910 cggcacgatcttggacggctcctgcccggggcacggcg 9947 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 99565 ggcacgatcttggatggctcttgtccggggcatggctcgttgg 99523 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 89165 ggcttcggctctggcttaggtggcactggcttcttgtgg 89127 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 88892 ggcacgatcttggatggctcctg 88870 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 84859 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 84817 Score = 44.1 bits (22), Expect = 0.44 Identities = 43/50 (86%) Strand = Plus / Plus Query: 328 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgca 377 ||||| |||||||||||||| || | || ||| |||||||||||| |||| Sbjct: 67173 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgca 67222 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 472 acgatcttggatggctcctggccggagcacggcg 505 ||||||||||| |||||||| |||| |||||||| Sbjct: 34664 acgatcttggacggctcctgcccggggcacggcg 34697 Score = 42.1 bits (21), Expect = 1.8 Identities = 59/71 (83%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgtttcttg 366 ||||| ||||| |||||||| |||||||||||| ||||| || ||||| | |||||| Sbjct: 99709 ggctctggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttcttcttg 99653 Query: 367 atgggcccgca 377 ||||| ||||| Sbjct: 99652 atgggaccgca 99642 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 85126 ggctcaggcttgggtggtacgggcttcttgtgg 85094 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ggctgcggcttgggttccggcttgggcaccgg 278 |||||||||||||| || ||||||||| |||| Sbjct: 99868 ggctgcggcttgggctctggcttgggctccgg 99837
>dbj|AK104236.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G04, full insert sequence Length = 963 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 407 ggcacgatcttggatggctcctggccggggcatggctcgttgg 365 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 687 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 642 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 557 ggctttggctccggcttgggtggcaccggcttcttgtgg 519
>dbj|AK061529.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-E01, full insert sequence Length = 976 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 407 ggcacgatcttggatggctcctggccggggcatggctcgttgg 365 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 687 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 642 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 557 ggctttggctccggcttgggtggcaccggcttcttgtgg 519
>dbj|AK059999.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-G07, full insert sequence Length = 963 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 407 ggcacgatcttggatggctcctggccggggcatggctcgttgg 365 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 687 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 642 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 557 ggctttggctccggcttgggtggcaccggcttcttgtgg 519
>dbj|AB055842.1| Oryza sativa OsPRP1 mRNA for proline-rich protein, complete cds Length = 980 Score = 60.0 bits (30), Expect = 7e-06 Identities = 42/46 (91%) Strand = Plus / Minus Query: 294 gggctggggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| |||||| ||||| ||||| ||||||||||||||||||||| Sbjct: 681 gggctcgggcttaggctcaggcttgggtggcacgggcttcttgtgg 636 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||||||||| |||||||| |||||||||||| Sbjct: 551 ggctttggctccggcttgggtggcaccggcttcttgtgg 513 Score = 44.1 bits (22), Expect = 0.44 Identities = 37/42 (88%) Strand = Plus / Minus Query: 470 gcacgatcttggatggctcctggccggagcacggcgcgttgg 511 ||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 400 gcacgatcttggatggctcttgtccggggcatggctcgttgg 359
>ref|NM_194860.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.8), mRNA Length = 621 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcgcg 507 ||||||||||||||| |||||||| |||| |||||||||| Sbjct: 372 cggcacgatcttggacggctcctgcccggggcacggcgcg 333
>ref|NM_194867.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.15), mRNA Length = 690 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||||||||| ||||| || |||||||||||||||||| Sbjct: 617 ggcttgggctctggcttgggcggcacgggcttcttgtgg 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 344 ggcacgatcttggatggctcttgtccggggcatggctcgttgg 302 Score = 42.1 bits (21), Expect = 1.8 Identities = 59/71 (83%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgtttcttg 366 ||||| ||||| |||||||| |||||||||||| ||||| || ||||| | |||||| Sbjct: 488 ggctctggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttcttcttg 432 Query: 367 atgggcccgca 377 ||||| ||||| Sbjct: 431 atgggaccgca 421 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ggctgcggcttgggttccggcttgggcaccgg 278 |||||||||||||| || ||||||||| |||| Sbjct: 647 ggctgcggcttgggctctggcttgggctccgg 616
>ref|NM_194866.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.14), mRNA Length = 690 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 494 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 438 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 437 ttcttgatgggaccgca 421 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 617 ggcttcggctctggcttaggtggcactggcttcttgtgg 579 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 344 ggcacgatcttggatggctcctg 322
>ref|NM_194865.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.13), mRNA Length = 690 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 494 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 438 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 437 ttcttgatggggccgca 421 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 344 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 302 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 611 ggctcaggcttgggtggtacgggcttcttgtgg 579
>dbj|AK104542.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-B03, full insert sequence Length = 1008 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 539 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 483 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 482 ttcttgatggggccgca 466 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 389 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 347 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 656 ggctcaggcttgggtggtacgggcttcttgtgg 624
>dbj|AK104765.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H08, full insert sequence Length = 1080 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 498 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 677 ggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 404 ggcacgatcttggatggctcctg 382
>dbj|AK104622.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H10, full insert sequence Length = 1032 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 498 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 677 ggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 404 ggcacgatcttggatggctcctg 382
>dbj|AK104398.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D05, full insert sequence Length = 1032 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 498 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 677 ggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 404 ggcacgatcttggatggctcctg 382
>dbj|AK104262.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-C07, full insert sequence Length = 1030 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 498 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 677 ggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 404 ggcacgatcttggatggctcctg 382
>dbj|AK104257.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F02, full insert sequence Length = 1010 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 542 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 486 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 485 ttcttgatggggccgca 469 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 392 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 350 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 659 ggctcaggcttgggtggtacgggcttcttgtgg 627
>dbj|AK104235.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-F12, full insert sequence Length = 972 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 557 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 501 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 500 ttcttgatgggaccgca 484 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 680 ggcttcggctctggcttaggtggcactggcttcttgtgg 642 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 407 ggcacgatcttggatggctcctg 385
>dbj|AK072923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023146D17, full insert sequence Length = 1015 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 546 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 490 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 489 ttcttgatggggccgca 473 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 396 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 354 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 663 ggctcaggcttgggtggtacgggcttcttgtgg 631
>dbj|AK067147.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098B06, full insert sequence Length = 1032 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 556 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 500 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 499 ttcttgatgggaccgca 483 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 679 ggcttcggctctggcttaggtggcactggcttcttgtgg 641
>dbj|AK062795.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-C07, full insert sequence Length = 862 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||||||||| ||||| || |||||||||||||||||| Sbjct: 660 ggcttgggctctggcttgggcggcacgggcttcttgtgg 622 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 387 ggcacgatcttggatggctcttgtccggggcatggctcgttgg 345 Score = 42.1 bits (21), Expect = 1.8 Identities = 59/71 (83%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgtttcttg 366 ||||| ||||| |||||||| |||||||||||| ||||| || ||||| | |||||| Sbjct: 531 ggctctggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttcttcttg 475 Query: 367 atgggcccgca 377 ||||| ||||| Sbjct: 474 atgggaccgca 464 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ggctgcggcttgggttccggcttgggcaccgg 278 |||||||||||||| || ||||||||| |||| Sbjct: 690 ggctgcggcttgggctctggcttgggctccgg 659
>dbj|AK061576.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-G10, full insert sequence Length = 1011 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 542 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 486 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 485 ttcttgatggggccgca 469 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 392 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 350 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 659 ggctcaggcttgggtggtacgggcttcttgtgg 627
>dbj|AK061567.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F04, full insert sequence Length = 1080 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 498 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 677 ggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 404 ggcacgatcttggatggctcctg 382
>dbj|AK061299.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-E05, full insert sequence Length = 928 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||||||||| ||||| || |||||||||||||||||| Sbjct: 674 ggcttgggctctggcttgggcggcacgggcttcttgtgg 636 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 401 ggcacgatcttggatggctcttgtccggggcatggctcgttgg 359 Score = 42.1 bits (21), Expect = 1.8 Identities = 59/71 (83%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgtttcttg 366 ||||| ||||| |||||||| |||||||||||| ||||| || ||||| | |||||| Sbjct: 545 ggctctggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttcttcttg 489 Query: 367 atgggcccgca 377 ||||| ||||| Sbjct: 488 atgggaccgca 478 Score = 40.1 bits (20), Expect = 6.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 247 ggctgcggcttgggttccggcttgggcaccgg 278 |||||||||||||| || ||||||||| |||| Sbjct: 704 ggctgcggcttgggctctggcttgggctccgg 673
>dbj|AK059996.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-F05, full insert sequence Length = 989 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 ||||| ||||||||||| |||||||| |||||||||||| ||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttcttgtgg---aagtggtctatgatcttc 498 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 677 ggcttcggctctggcttaggtggcactggcttcttgtgg 639 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctg 491 ||||||||||||||||||||||| Sbjct: 404 ggcacgatcttggatggctcctg 382
>dbj|AK058887.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-C09, full insert sequence Length = 1011 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 542 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 486 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 485 ttcttgatggggccgca 469 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 392 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 350 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 659 ggctcaggcttgggtggtacgggcttcttgtgg 627
>dbj|AB071178.1| Oryza sativa (japonica cultivar-group) OsPRP2 mRNA for proline-rich protein 2, complete cds Length = 828 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 301 ggcttgggctccggcttcggtggcacgggcttcttgtggtggaagtgctccatgatgtgt 360 |||||||| ||||||||||||||||| |||||||| ||| ||||| || ||||| | Sbjct: 494 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 438 Query: 361 ttcttgatgggcccgca 377 ||||||||||| ||||| Sbjct: 437 ttcttgatggggccgca 421 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Minus Query: 469 ggcacgatcttggatggctcctggccggagcacggcgcgttgg 511 |||||||||||||||||||| || |||| ||| ||| |||||| Sbjct: 344 ggcacgatcttggatggctcttgcccggggcatggctcgttgg 302 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Minus Query: 307 ggctccggcttcggtggcacgggcttcttgtgg 339 ||||| ||||| ||||| ||||||||||||||| Sbjct: 611 ggctcgggcttgggtggtacgggcttcttgtgg 579
>ref|NM_194861.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.9), mRNA Length = 636 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 372 cggcacgatcttggacggctcctgcccggggcacggcg 335
>ref|NM_194857.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.5), mRNA Length = 675 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 366 cggcacgatcttggacggctcctgcccggggcacggcg 329
>ref|NM_194856.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBb0016M10.14), mRNA Length = 627 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 318 cggcacgatcttggacggctcctgcccggggcacggcg 281
>ref|NM_194855.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBb0016M10.13), mRNA Length = 660 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 468 cggcacgatcttggatggctcctggccggagcacggcg 505 ||||||||||||||| |||||||| |||| |||||||| Sbjct: 351 cggcacgatcttggacggctcctgcccggggcacggcg 314
>ref|NM_030758.3| Homo sapiens oxysterol binding protein 2 (OSBP2), transcript variant 1, mRNA Length = 4349 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 268 tggggctggggcttgggctccggc 245
>emb|AL079299.12|HSBA492A7 Human DNA sequence from clone RP11-492A7 on chromosome 22, complete sequence Length = 15730 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 3540 tggggctggggcttgggctccggc 3517
>emb|CR860450.1| Pongo pygmaeus mRNA; cDNA DKFZp459L071 (from clone DKFZp459L071) Length = 4187 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 181 tggggctggggcttgggctccggc 158
>dbj|AK097581.1| Homo sapiens cDNA FLJ40262 fis, clone TESTI2025846, highly similar to Homo sapiens OSBP-related protein 4 mRNA Length = 2048 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 200 tggggctggggcttgggctccggc 177
>gb|AF323731.1|AF323731 Homo sapiens OSBP-related protein 4 mRNA, complete cds Length = 2886 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 268 tggggctggggcttgggctccggc 245
>gb|AF288742.1|AF288742 Homo sapiens oxysterol binding protein 2 (OSBP2) gene, complete cds Length = 217292 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 3540 tggggctggggcttgggctccggc 3517
>gb|AF288741.1|AF288741 Homo sapiens oxysterol binding protein 2 (OSBP2) mRNA, complete cds Length = 4247 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 162 tggggctggggcttgggctccggc 139
>dbj|AB051451.2| Homo sapiens mRNA for KIAA1664 protein, partial cds Length = 4244 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 176 tggggctggggcttgggctccggc 153
>emb|AJ335165.1|HSA335165 Homo sapiens genomic sequence surrounding NotI site, clone NR1-BO18C Length = 679 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 124 tggggctggggcttgggctccggc 101
>emb|AJ335054.1|HSA335054 Homo sapiens genomic sequence surrounding NotI site, clone NR1-XL21C Length = 644 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggc 315 |||||||||||||||||||||||| Sbjct: 124 tggggctggggcttgggctccggc 101
>gb|AF377569.1| Zea mays subsp. mays clone Ky21 anonymous genomic RFLP marker Csu1138 Length = 355 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|AF377562.1| Zea mays subsp. mays clone NC258 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|AF377560.1| Zea mays subsp. mays clone Mo17 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|AF377559.1| Zea mays subsp. mays clone W153R anonymous genomic RFLP marker Csu1138 Length = 355 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|AF377555.1| Zea mays subsp. mays clone PI213793 anonymous genomic RFLP marker Csu1138 Length = 355 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|AF377550.1| Zea mays subsp. mays clone GUA14 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|AF377545.1| Zea mays subsp. mays clone MEX48 anonymous genomic RFLP marker Csu1138 Length = 355 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|AF377544.1| Zea mays subsp. mays clone CHI349 anonymous genomic RFLP marker Csu1138 Length = 355 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtgg 339 |||||||||||||| |||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtgg 70
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 251 gcggcttgggttccggcttgggc 273 ||||||||||||||||||||||| Sbjct: 1086935 gcggcttgggttccggcttgggc 1086913
>ref|XM_534736.2| PREDICTED: Canis familiaris similar to oxysterol binding protein 2 isoform a (LOC477541), mRNA Length = 3201 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 293 ggggctggggcttgggctccggc 315 ||||||||||||||||||||||| Sbjct: 163 ggggctggggcttgggctccggc 141
>emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genome; segment 1/16 Length = 349315 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 437 cgacgatgccgaaggtggtgccc 459 ||||||||||||||||||||||| Sbjct: 112141 cgacgatgccgaaggtggtgccc 112163
>gb|AC011911.4| Drosophila melanogaster 3L BAC RP98-48J5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 178394 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 152762 atccaccgccaccgccgccgccg 152784
>gb|AC093438.2| Drosophila melanogaster 3L BAC RP98-26C20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 167344 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 17916 atccaccgccaccgccgccgccg 17938
>ref|NM_140314.2| Drosophila melanogaster GRHRII CG10698-RA (GRHRII), mRNA Length = 3238 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 2316 atccaccgccaccgccgccgccg 2294
>gb|AY071408.1| Drosophila melanogaster RE49422 full length cDNA Length = 3245 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 2312 atccaccgccaccgccgccgccg 2290
>gb|AF259553.1|AF259553 Trypanosoma brucei metacyclic variable surface glycoprotein MVSG5 (mvsg5) gene, complete cds Length = 3451 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 444 gccgaaggtggtgccctcggaaa 466 ||||||||||||||||||||||| Sbjct: 1931 gccgaaggtggtgccctcggaaa 1953
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 25681046 atccaccgccaccgccgccgccg 25681068 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 25248942 atccaccgccaccgccgccgccg 25248920 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 26711852 ccaccgccaccgccgccgccg 26711872 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 26213758 ccaccgccaccgccgccgccg 26213778 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 26151324 ccaccgccaccgccgccgccg 26151344 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 24999596 ccaccgccaccgccgccgccg 24999576 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 3967821 ccaccgccaccgccgccgccg 3967801 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 caccgccaccgccgccgccg 204 |||||||||||||||||||| Sbjct: 23068955 caccgccaccgccgccgccg 23068936 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 20441576 ccaccgccaccgccgccgcc 20441557
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 6473407 atccaccgccaccgccgccgccg 6473385 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 24532779 tccaccgccaccgccgccgccg 24532800 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 28835114 ccaccgccaccgccgccgccg 28835134 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 28453156 ccaccgccaccgccgccgccg 28453176 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 27060793 ccaccgccaccgccgccgccg 27060773 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 17594036 ccaccgccaccgccgccgccg 17594056 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 11519846 ccaccgccaccgccgccgccg 11519866 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 7836277 ccaccgccaccgccgccgccg 7836297 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 2965597 ccaccgccaccgccgccgccg 2965617 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 19556570 ccaccgccaccgccgccgcc 19556589 Score = 40.1 bits (20), Expect = 6.9 Identities = 28/31 (90%) Strand = Plus / Plus Query: 187 ccgccaccgccgccgccgncgtaggtgggcg 217 ||||| |||||||||||| || ||||||||| Sbjct: 17216521 ccgccgccgccgccgccgtcgcaggtgggcg 17216551 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 3140289 ccaccgccaccgccgccgcc 3140308
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 46.1 bits (23), Expect = 0.11 Identities = 34/38 (89%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccgncgtaggtgggcgtggg 221 ||||||||||||||||||||| | | |||||| ||||| Sbjct: 39372727 ccaccgccaccgccgccgccgccattggtgggggtggg 39372764 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 25322732 ccaccgccaccgccgccgccg 25322712 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 22855754 ccaccgccaccgccgccgccg 22855734 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 11237761 tccaccgccaccgccgccgcc 11237781 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 2565768 ccaccgccaccgccgccgccg 2565748 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 28788312 ccaccgccaccgccgccgcc 28788331 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 26383398 ccaccgccaccgccgccgcc 26383417 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 11527710 ccaccgccaccgccgccgcc 11527691 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 caccgccaccgccgccgccg 204 |||||||||||||||||||| Sbjct: 10983511 caccgccaccgccgccgccg 10983530 Score = 40.1 bits (20), Expect = 6.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 gtatccaccgccaccgccgccgcc 203 |||||| ||||||||||||||||| Sbjct: 3323595 gtatccgccgccaccgccgccgcc 3323572
>dbj|AP006838.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, fosmid clone:OSJNOa013M08 Length = 36891 Score = 46.1 bits (23), Expect = 0.11 Identities = 34/38 (89%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccgncgtaggtgggcgtggg 221 ||||||||||||||||||||| | | |||||| ||||| Sbjct: 8468 ccaccgccaccgccgccgccgccattggtgggggtggg 8505
>dbj|AP005545.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0638H11 Length = 162746 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 140351 atccaccgccaccgccgccgccg 140329
>dbj|AK122105.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033126A16, full insert sequence Length = 2078 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 64 atccaccgccaccgccgccgccg 86
>dbj|AK119437.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-133-B03, full insert sequence Length = 2812 Score = 46.1 bits (23), Expect = 0.11 Identities = 34/38 (89%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccgncgtaggtgggcgtggg 221 ||||||||||||||||||||| | | |||||| ||||| Sbjct: 78 ccaccgccaccgccgccgccgccattggtgggggtggg 41
>dbj|AK100116.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007D12, full insert sequence Length = 1442 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 41 atccaccgccaccgccgccgccg 63
>gb|AE003541.3| Drosophila melanogaster chromosome 3L, section 44 of 83 of the complete sequence Length = 265524 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 28954 atccaccgccaccgccgccgccg 28976
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 25609222 atccaccgccaccgccgccgccg 25609244 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 25177118 atccaccgccaccgccgccgccg 25177096 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 26640022 ccaccgccaccgccgccgccg 26640042 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 26141934 ccaccgccaccgccgccgccg 26141954 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 26079500 ccaccgccaccgccgccgccg 26079520 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 24927802 ccaccgccaccgccgccgccg 24927782 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 3967795 ccaccgccaccgccgccgccg 3967775 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 caccgccaccgccgccgccg 204 |||||||||||||||||||| Sbjct: 22997146 caccgccaccgccgccgccg 22997127 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 20367790 ccaccgccaccgccgccgcc 20367771
>emb|AL731881.4|CNS08C8L Oryza sativa chromosome 12, . BAC OSJNBa0002L05 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 167131 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 48284 atccaccgccaccgccgccgccg 48306
>emb|AL732535.4|CNS08C9A Oryza sativa chromosome 12, . BAC OSJNBa0035N13 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 158927 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 88248 atccaccgccaccgccgccgccg 88270
>gb|AF373862.3| Drosophila melanogaster Drm corazonin receptor mRNA, complete cds Length = 3226 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 182 atccaccgccaccgccgccgccg 204 ||||||||||||||||||||||| Sbjct: 2317 atccaccgccaccgccgccgccg 2295
>ref|XM_481279.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1500 Score = 44.1 bits (22), Expect = 0.44 Identities = 24/25 (96%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccgncgt 208 ||||||||||||||||||||| ||| Sbjct: 590 ccaccgccaccgccgccgccgccgt 614
>ref|NM_194863.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.11), mRNA Length = 591 Score = 44.1 bits (22), Expect = 0.44 Identities = 43/50 (86%) Strand = Plus / Minus Query: 328 ggcttcttgtggtggaagtgctccatgatgtgtttcttgatgggcccgca 377 ||||| |||||||||||||| || | || ||| |||||||||||| |||| Sbjct: 470 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgca 421
>ref|NM_194858.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.6), mRNA Length = 699 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Minus Query: 472 acgatcttggatggctcctggccggagcacggcg 505 ||||||||||| |||||||| |||| |||||||| Sbjct: 386 acgatcttggacggctcctgcccggggcacggcg 353
>ref|XM_469566.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3042 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 62 tccaccgccaccgccgccgccg 41
>gb|AC090441.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBb0052C09, complete sequence Length = 139468 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 14293 tccaccgccaccgccgccgccg 14314
>gb|DQ472187.1| Trypanosoma cruzi strain CL Brener formin 104 kDa gene, complete cds Length = 2814 Score = 44.1 bits (22), Expect = 0.44 Identities = 24/25 (96%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccgncgt 208 ||||||||||||||||||||| ||| Sbjct: 1468 ccaccgccaccgccgccgccgccgt 1492
>ref|NM_009795.1| Mus musculus calpain, small subunit 1 (Capns1), mRNA Length = 1401 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 169 tccaccgccaccgccgccgccg 148
>gb|AF377565.1| Tripsacum dactyloides clone T. anonymous genomic RFLP marker Csu1138 Length = 369 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377563.1| Zea mays subsp. mays clone T8 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377561.1| Zea mays subsp. mays clone Mo24W anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377558.1| Zea mays subsp. mays clone SIN2 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377557.1| Zea mays subsp. mays clone SAN329 anonymous genomic RFLP marker Csu1138 Length = 324 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 69 ggcttcggtggcacaggcttcttgtg 44
>gb|AF377553.1| Zea mays subsp. mays clone OAX70 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377552.1| Zea mays subsp. mays clone MAG450 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377548.1| Zea mays subsp. mays clone GUA131 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377547.1| Zea mays subsp. mays clone OAX68 anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|AF377546.1| Zea mays subsp. mays clone URGII anonymous genomic RFLP marker Csu1138 Length = 351 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 313 ggcttcggtggcacgggcttcttgtg 338 |||||||||||||| ||||||||||| Sbjct: 96 ggcttcggtggcacaggcttcttgtg 71
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 28757662 tccaccgccaccgccgccgccg 28757641 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 11682738 ccaccgccaccgccgccgccg 11682758 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 6196358 ccaccgccaccgccgccgccg 6196338 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 5519680 ccaccgccaccgccgccgccg 5519700 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 4495196 ccaccgccaccgccgccgccg 4495216 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 17828773 ccaccgccaccgccgccgcc 17828754 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 11682720 ccaccgccaccgccgccgcc 11682739 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgc 202 |||||||||||||||||||| Sbjct: 1483857 tccaccgccaccgccgccgc 1483838
>ref|XM_803778.1| Trypanosoma cruzi strain CL Brener formin homology 2 (FH2) domain protein (Tc00.1047053511393.30) partial mRNA Length = 2814 Score = 44.1 bits (22), Expect = 0.44 Identities = 24/25 (96%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccgncgt 208 ||||||||||||||||||||| ||| Sbjct: 1468 ccaccgccaccgccgccgccgccgt 1492
>ref|XM_812407.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053509631.60) partial mRNA Length = 10434 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 4914 tccaccgccaccgccgccgccg 4935
>gb|BC018352.1| Mus musculus calpain, small subunit 1, mRNA (cDNA clone MGC:25263 IMAGE:3156021), complete cds Length = 1438 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 184 tccaccgccaccgccgccgccg 163
>gb|AC110169.7| Mus musculus chromosome 9, clone RP23-233D3, complete sequence Length = 193041 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 61425 tccaccgccaccgccgccgccg 61446
>gb|AF040647.1| Caenorhabditis elegans cosmid F54D12, complete sequence Length = 38094 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 10 ttccgaattcattcctgcaaatactg 35 ||||||||||||||||||||| |||| Sbjct: 9688 ttccgaattcattcctgcaaaaactg 9713
>gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome 7, complete sequence Length = 267610 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 2654 tccaccgccaccgccgccgccg 2675
>gb|AC010010.6| Drosophila melanogaster 3L BAC RP98-13F6 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 167977 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 133499 tccaccgccaccgccgccgccg 133520
>gb|AY094911.1| Drosophila melanogaster RH17284 full insert cDNA Length = 3827 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 705 tccaccgccaccgccgccgccg 684
>ref|NM_079148.2| Drosophila melanogaster trachealess CG6883-RA (trh), mRNA Length = 4589 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 1403 tccaccgccaccgccgccgccg 1382
>gb|AC027139.5|AC027139 Homo sapiens, clone RP11-1H8, complete sequence Length = 151498 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 51592 tccaccgccaccgccgccgccg 51613
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 437 cgacgatgccgaaggtggtgcc 458 |||||||||||||||||||||| Sbjct: 139285 cgacgatgccgaaggtggtgcc 139306
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.44 Identities = 24/25 (96%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccgncgt 208 ||||||||||||||||||||| ||| Sbjct: 11252278 ccaccgccaccgccgccgccgccgt 11252254 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 22965506 ccaccgccaccgccgccgccg 22965526 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 21301394 ccaccgccaccgccgccgccg 21301374 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 20551904 ccaccgccaccgccgccgccg 20551924 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 10153950 ccaccgccaccgccgccgccg 10153970 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 4422416 ccaccgccaccgccgccgccg 4422436 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 25053630 ccaccgccaccgccgccgcc 25053611 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 6208323 ccaccgccaccgccgccgcc 6208304 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 caccgccaccgccgccgccg 204 |||||||||||||||||||| Sbjct: 3087969 caccgccaccgccgccgccg 3087950 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 caccgccaccgccgccgccg 204 |||||||||||||||||||| Sbjct: 3082975 caccgccaccgccgccgccg 3082956
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 28848986 tccaccgccaccgccgccgccg 28848965 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 11679501 ccaccgccaccgccgccgccg 11679521 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 6195571 ccaccgccaccgccgccgccg 6195551 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 5518895 ccaccgccaccgccgccgccg 5518915 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 4495311 ccaccgccaccgccgccgccg 4495331 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 17822314 ccaccgccaccgccgccgcc 17822295 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 11679483 ccaccgccaccgccgccgcc 11679502 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgc 202 |||||||||||||||||||| Sbjct: 1483855 tccaccgccaccgccgccgc 1483836
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 22555002 tccaccgccaccgccgccgccg 22555023 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 35502439 ccaccgccaccgccgccgccg 35502419 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 32758653 ccaccgccaccgccgccgccg 32758673 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 31008430 ccaccgccaccgccgccgccg 31008450 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 29694737 ccaccgccaccgccgccgccg 29694717 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 24594620 ccaccgccaccgccgccgccg 24594600 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 21631513 ccaccgccaccgccgccgccg 21631533 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 20830874 ccaccgccaccgccgccgccg 20830894 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 12264684 tccaccgccaccgccgccgcc 12264704 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 8342251 ccaccgccaccgccgccgccg 8342231 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 1680364 ccaccgccaccgccgccgccg 1680384 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 28649452 ccaccgccaccgccgccgcc 28649433 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 caccgccaccgccgccgccg 204 |||||||||||||||||||| Sbjct: 12491404 caccgccaccgccgccgccg 12491385 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgc 202 |||||||||||||||||||| Sbjct: 8902038 tccaccgccaccgccgccgc 8902019 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 8881463 ccaccgccaccgccgccgcc 8881482
>gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete sequence Length = 147344 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 64643 tccaccgccaccgccgccgccg 64622
>dbj|AP005800.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0016D04 Length = 147313 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 125358 tccaccgccaccgccgccgccg 125379
>dbj|AP003539.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0040H10 Length = 173301 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 15972 tccaccgccaccgccgccgccg 15993
>dbj|AP003609.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0012B02 Length = 149807 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 144252 tccaccgccaccgccgccgccg 144273
>dbj|AP005644.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0056I22 Length = 147728 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 2813 tccaccgccaccgccgccgccg 2834
>dbj|AP005541.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0436B05 Length = 149754 Score = 44.1 bits (22), Expect = 0.44 Identities = 24/25 (96%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccgncgt 208 ||||||||||||||||||||| ||| Sbjct: 87296 ccaccgccaccgccgccgccgccgt 87272
>dbj|AK108244.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-140-H04, full insert sequence Length = 1056 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 186 tccaccgccaccgccgccgccg 165
>gb|BC090988.1| Mus musculus calpain, small subunit 1, mRNA (cDNA clone MGC:107284 IMAGE:30246016), complete cds Length = 1462 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 190 tccaccgccaccgccgccgccg 169
>gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 of 83 of the complete sequence Length = 307657 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 51095 tccaccgccaccgccgccgccg 51116
>gb|AF058298.1|AF058298 Mus musculus calpain small subunit mRNA, complete cds Length = 1401 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 169 tccaccgccaccgccgccgccg 148
>gb|AY833420.1| Desulfovibrio gigas chemotaxis operon, complete sequence Length = 11022 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 252 cggcttgggttccggcttgggc 273 |||||||||||||||||||||| Sbjct: 8640 cggcttgggttccggcttgggc 8619
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 296 gctggggcttgggctccggctt 317 |||||||||||||||||||||| Sbjct: 1060517 gctggggcttgggctccggctt 1060538
>gb|AC173346.1| Mus musculus BAC clone RP23-42N8 from chromosome 9, complete sequence Length = 219266 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 72421 tccaccgccaccgccgccgccg 72400
>gb|U42699.1|DMU42699 Drosophila melanogaster trachealess (trh) mRNA, complete cds Length = 4565 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 1396 tccaccgccaccgccgccgccg 1375
>gb|U33427.1|DMU33427 Drosophila melanogaster bHLH-PAS protein (trh) mRNA, complete cds Length = 4489 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgccg 204 |||||||||||||||||||||| Sbjct: 1408 tccaccgccaccgccgccgccg 1387
>ref|NM_001036066.1| Arabidopsis thaliana beta-fructofuranosidase AT1G35580 transcript variant AT1G35580.3 mRNA, complete cds Length = 1854 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 96 ccaccgccaccgccgccgccg 116
>ref|NM_179419.1| Arabidopsis thaliana beta-fructofuranosidase AT1G35580 transcript variant AT1G35580.2 mRNA, complete cds Length = 2065 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 84 ccaccgccaccgccgccgccg 104
>ref|NM_103255.2| Arabidopsis thaliana beta-fructofuranosidase AT1G35580 transcript variant AT1G35580.1 mRNA, complete cds Length = 2066 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 97 ccaccgccaccgccgccgccg 117
>ref|NM_119068.2| Arabidopsis thaliana protein binding AT4G29240 mRNA, complete cds Length = 1646 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 364 ccaccgccaccgccgccgccg 344
>ref|XM_476085.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 4425 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 334 ccaccgccaccgccgccgccg 314
>ref|NM_122651.2| Arabidopsis thaliana metal ion binding AT5G27690 mRNA, complete cds Length = 1215 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 634 ccaccgccaccgccgccgccg 614
>ref|XM_550137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 990 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 65 ccaccgccaccgccgccgccg 45
>gb|AC135427.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0617H07, complete sequence Length = 114135 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 33376 ccaccgccaccgccgccgccg 33356
>ref|XM_482591.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1080 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 328 ccaccgccaccgccgccgccg 348
>ref|XM_482489.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3181 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 126 ccaccgccaccgccgccgccg 146
>ref|XM_481138.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2856 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 63 ccaccgccaccgccgccgccg 83
>ref|XM_468052.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3317 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 156 ccaccgccaccgccgccgccg 136
>ref|XM_467465.1| Oryza sativa (japonica cultivar-group), mRNA Length = 995 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 202 ccaccgccaccgccgccgccg 182
>ref|XM_506938.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1191_G08.14 mRNA Length = 1008 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 223 ccaccgccaccgccgccgccg 203
>ref|XM_466314.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2316 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 307 ccaccgccaccgccgccgccg 287
>ref|XM_466169.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2240 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 117 ccaccgccaccgccgccgccg 137
>ref|XM_506821.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1004_H01.22 mRNA Length = 2266 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 143 ccaccgccaccgccgccgccg 163
>gb|AC102535.17| Mus musculus chromosome 7, clone RP23-61O11, complete sequence Length = 220003 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 gggtggggctggggcttgggc 309 ||||||||||||||||||||| Sbjct: 32472 gggtggggctggggcttgggc 32452
>ref|XM_464962.1| Oryza sativa (japonica cultivar-group), mRNA Length = 495 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 328 ccaccgccaccgccgccgccg 308
>ref|XM_464810.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1930 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 25 ccaccgccaccgccgccgccg 45
>ref|XM_507435.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1007_D04.30 mRNA Length = 1499 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 98 ccaccgccaccgccgccgccg 118
>ref|XM_464017.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1369 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 116 ccaccgccaccgccgccgccg 136
>ref|XM_506707.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1007_D04.30 mRNA Length = 2113 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 153 ccaccgccaccgccgccgccg 173
>ref|XM_450572.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2073 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 482 ccaccgccaccgccgccgccg 462
>ref|NM_197930.1| Oryza sativa (japonica cultivar-group) putative Clp protease (OSJNBa0056G17.6), mRNA Length = 897 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 61 ccaccgccaccgccgccgccg 41
>ref|NM_197242.1| Oryza sativa (japonica cultivar-group) putative lipid transfer protein (OSJNBa0062C05.16), mRNA Length = 306 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 70 ccaccgccaccgccgccgccg 50
>ref|NM_197198.1| Oryza sativa (japonica cultivar-group) putative transcription factor (OSJNBa0078O01.21), mRNA Length = 885 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 613 ccaccgccaccgccgccgccg 633
>ref|NM_197501.1| Oryza sativa (japonica cultivar-group) putative transposon protein (OSJNBb0038A07.22), mRNA Length = 2508 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 140 ccaccgccaccgccgccgccg 120
>ref|NM_197271.1| Oryza sativa (japonica cultivar-group) putative ascorbate oxidase (OSJNBb0015K05.9), mRNA Length = 1722 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 43 ccaccgccaccgccgccgccg 23
>ref|NM_196380.1| Oryza sativa (japonica cultivar-group) putative tyrosine/dopa decarboxylase (OSJNBa0050N08.21), mRNA Length = 1509 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 476 ccaccgccaccgccgccgccg 456
>ref|XM_517968.1| PREDICTED: Pan troglodytes similar to ubiquitin conjugating enzyme (LOC462108), mRNA Length = 1304 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ccgccaccgccgccgccgncgtag 210 |||||||||||||||||| ||||| Sbjct: 181 ccgccaccgccgccgccgccgtag 158
>ref|NM_192946.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3318 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 1977 ccaccgccaccgccgccgccg 1957
>ref|NM_181838.1| Homo sapiens ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) (UBE2D2), transcript variant 2, mRNA Length = 2879 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ccgccaccgccgccgccgncgtag 210 |||||||||||||||||| ||||| Sbjct: 390 ccgccaccgccgccgccgccgtag 367
>ref|XM_479380.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1209 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 749 ccaccgccaccgccgccgccg 729
>ref|XM_478422.1| Oryza sativa (japonica cultivar-group), mRNA Length = 872 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 598 ccaccgccaccgccgccgccg 578
>ref|XM_478421.1| Oryza sativa (japonica cultivar-group), mRNA Length = 787 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 516 ccaccgccaccgccgccgccg 496
>ref|XM_506371.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0036M16.111-2 mRNA Length = 801 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 563 ccaccgccaccgccgccgccg 543
>ref|NM_188801.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2112 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 40 ccaccgccaccgccgccgccg 60
>ref|NM_003339.2| Homo sapiens ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) (UBE2D2), transcript variant 1, mRNA Length = 2715 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ccgccaccgccgccgccgncgtag 210 |||||||||||||||||| ||||| Sbjct: 390 ccgccaccgccgccgccgccgtag 367
>ref|XM_472593.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 516 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 148 ccaccgccaccgccgccgccg 168
>ref|XM_513054.1| PREDICTED: Pan troglodytes similar to PLEKHM2 protein (LOC456462), mRNA Length = 3609 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 248 ccaccgccaccgccgccgccg 228
>ref|NM_189226.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 612 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 281 tccaccgccaccgccgccgcc 261
>gb|AC136519.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0007C23, complete sequence Length = 173764 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 1292 ccaccgccaccgccgccgccg 1272
>gb|AC161431.4| Mus musculus chromosome 7, clone RP24-306C18, complete sequence Length = 148949 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 gggtggggctggggcttgggc 309 ||||||||||||||||||||| Sbjct: 13242 gggtggggctggggcttgggc 13262
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence Length = 2300533 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 42172 ccaccgccaccgccgccgccg 42152
>gb|AC084023.8| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0062C05 map S21174S, complete sequence Length = 178867 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 82564 ccaccgccaccgccgccgccg 82544
>gb|BC069184.1| Homo sapiens heterogeneous nuclear ribonucleoprotein L, mRNA (cDNA clone MGC:70802 IMAGE:6174088), complete cds Length = 2061 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 184 tccaccgccaccgccgccgcc 164
>gb|BC101932.1| Rattus norvegicus nucleosome assembly protein 1-like 3, mRNA (cDNA clone MGC:124570 IMAGE:7938895), complete cds Length = 2824 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 241 ccaccgccaccgccgccgccg 261
>gb|AC158787.14| Mus musculus chromosome 15, clone RP23-136G8, complete sequence Length = 203772 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 tggggctggggcttgggctcc 312 ||||||||||||||||||||| Sbjct: 17209 tggggctggggcttgggctcc 17229
>gb|AC021891.6| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0050N08, complete sequence Length = 144593 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 109062 ccaccgccaccgccgccgccg 109082
>gb|AC132493.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0636E04, complete sequence Length = 141171 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 91084 ccaccgccaccgccgccgccg 91064
>gb|AY707319.1| Sitobion avenae acetylcholinesterase 2 (ACE2) mRNA, complete cds Length = 2131 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 200 tccaccgccaccgccgccgcc 180
>gb|BC079538.1| Mus musculus enhancer of zeste homolog 2 (Drosophila), mRNA (cDNA clone MGC:90723 IMAGE:6817366), complete cds Length = 2617 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 34 ccaccgccaccgccgccgccg 14
>gb|AC135423.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0015C02, complete sequence Length = 147407 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 112406 ccaccgccaccgccgccgccg 112386
>gb|AC121364.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0052E20, complete sequence Length = 162434 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 153939 ccaccgccaccgccgccgccg 153919
>gb|AC148870.2| Chlamydomonas reinhardtii clone cr-13O11, complete sequence Length = 56858 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 42324 tccaccgccaccgccgccgcc 42304 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 caccgccaccgccgccgccg 204 |||||||||||||||||||| Sbjct: 42301 caccgccaccgccgccgccg 42282
>ref|XM_366331.1| Magnaporthe grisea 70-15 predicted protein (MG10549.4) partial mRNA Length = 333 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 299 ccaccgccaccgccgccgccg 279
>gb|DQ472190.1| Trypanosoma cruzi strain CL Brener formin 127 kDa gene, complete cds Length = 3537 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 2058 tccaccgccaccgccgccgcc 2078 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 1803 tccaccgccaccgccgccgcc 1823
>gb|DQ472188.1| Trypanosoma cruzi strain CL Brener formin 120 kDa gene, complete cds Length = 3294 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 1815 tccaccgccaccgccgccgcc 1835 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 1672 ccaccgccaccgccgccgcc 1691
>gb|AC145748.4| Mus musculus BAC clone RP23-31L10 from chromosome 5, complete sequence Length = 220208 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 26066 ccaccgccaccgccgccgccg 26046
>gb|BC038034.1| Mus musculus ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila), mRNA (cDNA clone MGC:47121 IMAGE:4035861), complete cds Length = 2326 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 201 ccaccgccaccgccgccgccg 181
>gb|AC120984.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBb0026G02, complete sequence Length = 123472 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 105277 ccaccgccaccgccgccgccg 105297 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 85495 ccaccgccaccgccgccgccg 85515
>ref|XM_956463.1| Neurospora crassa OR74A hypothetical protein (NCU01190.1) partial mRNA Length = 1032 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 953 ccaccgccaccgccgccgccg 933
>ref|XM_326682.1| Neurospora crassa OR74A hypothetical protein (NCU01190.1) partial mRNA Length = 1032 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 953 ccaccgccaccgccgccgccg 933
>ref|XM_614736.2| PREDICTED: Bos taurus similar to c-K-ras2 protein isoform b (LOC541140), mRNA Length = 1209 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 294 ccaccgccaccgccgccgccg 274
>ref|NM_001533.2| Homo sapiens heterogeneous nuclear ribonucleoprotein L (HNRPL), transcript variant 1, mRNA Length = 2129 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 245 tccaccgccaccgccgccgcc 225
>ref|NM_019927.1| Mus musculus ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) (Arih1), mRNA Length = 2326 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 201 ccaccgccaccgccgccgccg 181
>ref|XM_711641.1| Candida albicans SC5314 hypothetical protein (CaO19_3427), mRNA Length = 351 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 296 ccaccgccaccgccgccgccg 276
>ref|XM_711582.1| Candida albicans SC5314 hypothetical protein (CaO19_10931), mRNA Length = 351 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 296 ccaccgccaccgccgccgccg 276
>gb|AC147076.3| Pan troglodytes BAC clone RP43-172O18 from 7, complete sequence Length = 175186 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 719 ccaccgccaccgccgccgccg 699
>gb|AC158915.4| Mus musculus chromosome 8, clone RP23-146N20, complete sequence Length = 207367 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 16358 ccaccgccaccgccgccgccg 16338
>ref|NM_133402.2| Rattus norvegicus nucleosome assembly protein 1-like 3 (Nap1l3), mRNA Length = 2824 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 241 ccaccgccaccgccgccgccg 261
>gb|AY651263.1| Homo sapiens ubiquitin-conjugating enzyme E2 D2 transcript variant 1 mRNA, complete cds Length = 1715 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ccgccaccgccgccgccgncgtag 210 |||||||||||||||||| ||||| Sbjct: 146 ccgccaccgccgccgccgccgtag 123
>gb|BC040441.1| Homo sapiens pleckstrin homology domain containing, family M (with RUN domain) member 2, mRNA (cDNA clone IMAGE:5590182), partial cds Length = 4172 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 205 ccaccgccaccgccgccgccg 185
>gb|AY848685.1| Enterobacteria phage PR3, complete genome Length = 14937 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 11310 ccaccgccaccgccgccgccg 11290
>gb|AY848684.1| Enterobacteria phage L17, complete genome Length = 14935 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 11309 ccaccgccaccgccgccgccg 11289
>gb|AC120887.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0088K21, complete sequence Length = 153239 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 4194 ccaccgccaccgccgccgccg 4214
>gb|AC118012.9| Mus musculus chromosome 8, clone RP23-454D11, complete sequence Length = 192971 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 168843 ccaccgccaccgccgccgccg 168823
>ref|XM_543959.2| PREDICTED: Canis familiaris similar to Lysyl oxidase homolog 4 precursor (Lysyl oxidase-like protein 4) (Lysyl oxidase related protein C) (LOC486830), mRNA Length = 2467 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 37 ccaccgccaccgccgccgccg 57 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 19 ccaccgccaccgccgccgcc 38
>ref|XM_976338.1| PREDICTED: Mus musculus hypothetical protein LOC665357 (LOC665357), mRNA Length = 864 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 517 ccaccgccaccgccgccgccg 537
>ref|XM_976560.1| PREDICTED: Mus musculus hypothetical protein LOC669696 (LOC669696), mRNA Length = 864 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 517 ccaccgccaccgccgccgccg 537
>gb|AC146376.4| Pan troglodytes BAC clone RP43-76K24 from 7, complete sequence Length = 173021 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 35045 ccaccgccaccgccgccgccg 35065
>gb|BC057680.1| Mus musculus ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila), mRNA (cDNA clone MGC:68355 IMAGE:3498094), complete cds Length = 2636 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 521 ccaccgccaccgccgccgccg 501
>ref|XM_566442.1| Cryptococcus neoformans hypothetical protein (CNA00130) partial mRNA Length = 3025 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 2498 ccaccgccaccgccgccgccg 2478
>ref|XM_755195.1| Ustilago maydis 521 hypothetical protein (UM04141.1) partial mRNA Length = 5580 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 3093 tccaccgccaccgccgccgcc 3113
>emb|AJ849710.1| Ceratosolen bisulcatus microsatellite DNA, clone WCB3-61 Length = 490 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 255 ccaccgccaccgccgccgccg 235
>ref|XM_850922.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 5 (LOC482895), mRNA Length = 1154 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 115 ccaccgccaccgccgccgccg 135
>ref|XM_850883.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 4 (LOC482895), mRNA Length = 1015 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 115 ccaccgccaccgccgccgccg 135
>ref|XM_850844.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 3 (LOC482895), mRNA Length = 1628 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 115 ccaccgccaccgccgccgccg 135
>ref|XM_850800.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 2 (LOC482895), mRNA Length = 1679 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 115 ccaccgccaccgccgccgccg 135
>ref|XM_540010.2| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 1 (LOC482895), mRNA Length = 1790 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 115 ccaccgccaccgccgccgccg 135
>gb|AY129336.1| Mycobacteriophage Che9d, complete genome Length = 56276 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 21934 ccaccgccaccgccgccgccg 21914
>gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosome 9, complete sequence Length = 169614 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 27211 ccaccgccaccgccgccgccg 27231
>gb|AC130221.4| Mus musculus BAC clone RP23-168E11 from chromosome 5, complete sequence Length = 200384 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 196689 ccaccgccaccgccgccgccg 196669
>gb|AC127694.3| Mus musculus BAC clone RP23-235J3 from chromosome 7, complete sequence Length = 225732 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 292 tggggctggggcttgggctccggct 316 ||||||||||||| ||||||||||| Sbjct: 161382 tggggctggggctggggctccggct 161358
>ref|XM_803262.1| Trypanosoma cruzi strain CL Brener formin (Tc00.1047053511313.30) partial mRNA Length = 3537 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 2058 tccaccgccaccgccgccgcc 2078 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 1803 tccaccgccaccgccgccgcc 1823
>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12 Length = 294800 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 149584 ccaccgccaccgccgccgccg 149564
>ref|XM_807206.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510241.40) partial mRNA Length = 1812 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 1174 ccaccgccaccgccgccgccg 1194
>ref|XM_809309.1| Trypanosoma cruzi strain CL Brener formin (Tc00.1047053511755.80) partial mRNA Length = 3294 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 1815 tccaccgccaccgccgccgcc 1835 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 1672 ccaccgccaccgccgccgcc 1691
>gb|AC104231.10| Homo sapiens chromosome 15, clone RP11-96H23, complete sequence Length = 81256 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 286 tctgggtggggctggggcttgggct 310 ||||| ||||||||||||||||||| Sbjct: 64371 tctggctggggctggggcttgggct 64395
>ref|XM_814822.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506789.150) partial mRNA Length = 2526 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 2251 ccaccgccaccgccgccgccg 2231
>ref|XM_802503.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053508399.49) partial mRNA Length = 6224 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 4873 ccaccgccaccgccgccgccg 4893
>gb|AC137744.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0074L11, complete sequence Length = 180703 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 122293 ccaccgccaccgccgccgccg 122273
>gb|AC079888.10| Oryza sativa chromosome 10 BAC OSJNBa0078O01 genomic sequence, complete sequence Length = 146664 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 58514 ccaccgccaccgccgccgccg 58494
>gb|AC146221.3| Pan troglodytes BAC clone RP43-33B24 from 7, complete sequence Length = 127675 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 35047 ccaccgccaccgccgccgccg 35067
>gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, complete sequence Length = 202544 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 22171 ccaccgccaccgccgccgccg 22151
>gb|BC006021.1| Mus musculus CCR4-NOT transcription complex, subunit 7, mRNA (cDNA clone MGC:6050 IMAGE:3590764), complete cds Length = 2679 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 85 ccaccgccaccgccgccgccg 105
>emb|Z69667.1|HS314G4 Human DNA sequence from clone LA16c-314G4 on chromosome 16 Contains the 3' end of the C16orf9 gene for chromosome 16 open reading frame 9, the RGS11 gene for regulator of G-protein signalling 11, a novel gene, the ARHGDIG gene for Rho GDP dissociation inhibitor (GDI) gamma, the PDIP gene for protein disulfide isomerase, pancreatic, the 3' end of the AXIN1 gene for axin 1 and two CpG islands, complete sequence Length = 31557 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 288 tgggtggggctggggcttgggctccggct 316 ||||||||||||||||| |||||| |||| Sbjct: 18613 tgggtggggctggggctggggctcaggct 18641
>emb|AL354943.9| Human DNA sequence from clone RP11-160A9 on chromosome 6 Contains a solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator) member 6 (SLC25A6) pseudogene, an NADH dehydrogenase (ubiquinone) 1 alpha/beta subcomplex 1 (8kD, SDAP) (NDUFAB1) pseudogene, the 5' end of the gene for stromal membrane-associated protein SMAP1 and a CpG island, complete sequence Length = 151445 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 124788 ccaccgccaccgccgccgccg 124768
>emb|AL161908.13| Human DNA sequence from clone RP11-123K19 on chromosome 9 Contains two novel genes, the 5' end of the LMX1B gene for LIM homeobox transcription factor 1 beta and two CpG islands, complete sequence Length = 106216 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 64119 ccaccgccaccgccgccgccg 64139
>gb|AC009333.12| Homo sapiens chromosome 7 clone RP11-356G1, complete sequence Length = 180019 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 703 ccaccgccaccgccgccgccg 683
>gb|AC118674.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0093J20, from chromosome 3, complete sequence Length = 148635 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 71833 ccaccgccaccgccgccgccg 71853 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgcc 203 |||||||||||||||||||| Sbjct: 71815 ccaccgccaccgccgccgcc 71834
>ref|XM_967085.1| PREDICTED: Tribolium castaneum similar to CG8912-PC, isoform C (LOC660887), mRNA Length = 2533 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 602 ccaccgccaccgccgccgccg 582
>emb|BX040466.1|CNS093DY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC11BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 108 ccaccgccaccgccgccgccg 128
>emb|BX040465.1|CNS093DX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 761 ccaccgccaccgccgccgccg 741
>gb|AC113948.5| Oryza sativa chromosome 10 BAC OSJNBb0038A07 genomic sequence, complete sequence Length = 132900 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 46089 ccaccgccaccgccgccgccg 46109
>gb|AY117248.1| Arabidopsis thaliana putative extensin (At4g29240) mRNA, complete cds Length = 1279 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 143 ccaccgccaccgccgccgccg 123
>gb|AY091036.1| Arabidopsis thaliana putative extensin (At4g29240) mRNA, complete cds Length = 1521 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 222 ccaccgccaccgccgccgccg 202
>emb|X16135.1|HSHNRNPL Human mRNA for novel heterogeneous nuclear RNP protein, L protein Length = 2033 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 tccaccgccaccgccgccgcc 203 ||||||||||||||||||||| Sbjct: 169 tccaccgccaccgccgccgcc 149
>gb|AY065247.1| Arabidopsis thaliana putative invertase (At1g35580) mRNA, complete cds Length = 2004 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 84 ccaccgccaccgccgccgccg 104
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 303 cttgggctccggcttcggtggcacgggcttctt 335 ||||||||||||||| || ||| |||||||||| Sbjct: 4353687 cttgggctccggcttggggggctcgggcttctt 4353719
>gb|BC033349.1| Homo sapiens ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast), transcript variant 1, mRNA (cDNA clone MGC:42697 IMAGE:4827210), complete cds Length = 1979 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ccgccaccgccgccgccgncgtag 210 |||||||||||||||||| ||||| Sbjct: 390 ccgccaccgccgccgccgccgtag 367
>emb|BX248354.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment 1/8 Length = 348517 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 253 ggcttgggttccggcttgggc 273 ||||||||||||||||||||| Sbjct: 223008 ggcttgggttccggcttgggc 222988
>gb|BC048426.1| Homo sapiens ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast), mRNA (cDNA clone IMAGE:4823527) Length = 818 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ccgccaccgccgccgccgncgtag 210 |||||||||||||||||| ||||| Sbjct: 389 ccgccaccgccgccgccgccgtag 366
>emb|AL670010.1|NCB10H4 Neurospora crassa DNA linkage group V BAC contig B10H4 Length = 90763 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 41728 ccaccgccaccgccgccgccg 41748
>emb|AL607000.3|OSJN00132 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089B03, complete sequence Length = 130910 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 77861 ccaccgccaccgccgccgccg 77881
>emb|AL606999.3|OSJN00127 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete sequence Length = 163448 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 22943 ccaccgccaccgccgccgccg 22923
>emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 70 Length = 198429 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ccaccgccaccgccgccgccg 204 ||||||||||||||||||||| Sbjct: 147048 ccaccgccaccgccgccgccg 147028 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,912,157 Number of Sequences: 3902068 Number of extensions: 3912157 Number of successful extensions: 159719 Number of sequences better than 10.0: 699 Number of HSP's better than 10.0 without gapping: 759 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 139859 Number of HSP's gapped (non-prelim): 19238 length of query: 513 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 490 effective length of database: 17,143,297,704 effective search space: 8400215874960 effective search space used: 8400215874960 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
