>ref|XM_507375.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1092_A07.131
           mRNA
          Length = 1250

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 1   tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
           |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 874 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 820

>ref|XM_478751.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1147

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 1   tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
           |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 763 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 709

>ref|XM_506416.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1092_A07.131
           mRNA
          Length = 1351

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 1   tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
           |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 864 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 810

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1        tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
                |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 22798231 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 22798285

>dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1092_A07
          Length = 137081

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                     
Query: 1      tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
              |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 117573 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 117627

>dbj|AK109391.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-H03, full
           insert sequence
          Length = 1273

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 1   tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
           |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 820 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 766

>dbj|AK100091.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003J19, full
           insert sequence
          Length = 1249

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 1   tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
           |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 873 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 819

>dbj|AK059994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-E09, full
           insert sequence
          Length = 1147

 Score = 81.8 bits (41), Expect = 1e-13
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 1   tccaggtgcacattgttgccactgnttggnaaccagtgtccaggaggatggccaa 55
           |||||||||||||||||||||||| |||| | ||||||||||||||||| |||||
Sbjct: 763 tccaggtgcacattgttgccactgcttgggagccagtgtccaggaggatagccaa 709

>gb|BT017280.1| Zea mays clone EL01N0314B02.c mRNA sequence
          Length = 1047

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 35/41 (85%)
 Strand = Plus / Minus

                                                    
Query: 9   cacattgttgccactgnttggnaaccagtgtccaggaggat 49
           ||||| || ||||||| |||| | ||||||||||| |||||
Sbjct: 898 cacatggtggccactgcttgggagccagtgtccagaaggat 858

>ref|XM_425565.1| PREDICTED: Gallus gallus similar to hypothetical protein FLJ30296
            (LOC427995), mRNA
          Length = 3288

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 32   accagtgtccaggaggatg 50
            |||||||||||||||||||
Sbjct: 2326 accagtgtccaggaggatg 2344

>gb|AC121082.13| Mus musculus chromosome 7, clone RP23-32F14, complete sequence
          Length = 231678

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     ccagtgtccaggaggatgg 51
              |||||||||||||||||||
Sbjct: 230678 ccagtgtccaggaggatgg 230696

>gb|AC108420.8| Mus musculus chromosome 7, clone RP23-38E14, complete sequence
          Length = 134825

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 33     ccagtgtccaggaggatgg 51
              |||||||||||||||||||
Sbjct: 102412 ccagtgtccaggaggatgg 102394

>emb|BX935601.2| Gallus gallus finished cDNA, clone ChEST83j21
          Length = 1818

 Score = 38.2 bits (19), Expect = 2.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 32  accagtgtccaggaggatg 50
           |||||||||||||||||||
Sbjct: 852 accagtgtccaggaggatg 870

>gb|AY349640.1| Uncultured Synechococcus sp. clone SCS-s47 RNA polymerase subunit
           (rpoC1) gene, partial cds
          Length = 519

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 37  tgtccaggaggatggcca 54
           ||||||||||||||||||
Sbjct: 304 tgtccaggaggatggcca 287

>gb|AY440036.1| Armigeres subalbatus ASAP ID: 39001 questionable: serine protease
           inhibitor mRNA sequence
          Length = 513

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 1   tccaggtgcacattgttg 18
           ||||||||||||||||||
Sbjct: 409 tccaggtgcacattgttg 392

>gb|AC123819.2| Mus musculus BAC clone RP23-460M11 from chromosome 8, complete sequence
          Length = 202899

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     aggtgcacattgttgcca 21
             ||||||||||||||||||
Sbjct: 66744 aggtgcacattgttgcca 66761

>emb|AL096843.11|HSA262A13 Human DNA sequence from clone RP11-262A13 on chromosome 22, complete
              sequence
          Length = 128155

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 34     cagtgtccaggaggatgg 51
              ||||||||||||||||||
Sbjct: 118993 cagtgtccaggaggatgg 118976

>gb|AC114802.5| Homo sapiens BAC clone RP11-790N8 from 2, complete sequence
          Length = 154814

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 37    tgtccaggaggatggcca 54
             ||||||||||||||||||
Sbjct: 95325 tgtccaggaggatggcca 95342

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 36      gtgtccaggaggatggcc 53
               ||||||||||||||||||
Sbjct: 1131169 gtgtccaggaggatggcc 1131186

>gb|AC005490.1|AC005490 Homo sapiens UWGC:g1397a051 from 7p14-15, complete sequence
          Length = 41339

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     tgcacattgttgccactg 24
             ||||||||||||||||||
Sbjct: 30211 tgcacattgttgccactg 30194

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 36     gtgtccaggaggatggcc 53
              ||||||||||||||||||
Sbjct: 804528 gtgtccaggaggatggcc 804545

>gb|AC172115.2| Rhesus Macaque CHR16 BAC CH250-479K3 (Children's Hospital Oakland
             Research Institute Rhesus macaque Adult Male BAC Library)
             complete sequence
          Length = 138615

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 31    aaccagtgtccaggaggatggc 52
             ||||||| ||||||||||||||
Sbjct: 77684 aaccagtttccaggaggatggc 77663


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 297,172
Number of Sequences: 3902068
Number of extensions: 297172
Number of successful extensions: 78434
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78274
Number of HSP's gapped (non-prelim): 160
length of query: 56
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 36
effective length of database: 17,155,003,908
effective search space: 617580140688
effective search space used: 617580140688
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)