ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags1i11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial ... 64 2e-07
2ref|XM_467846.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.23
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.23
4dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.23
5dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.23
6dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.23
7gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochr... 40 3.6
8gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome... 40 3.6
9gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochr... 40 3.6
10gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 40 3.6
11gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 40 3.6
12gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 40 3.6
13gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 40 3.6
14gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochr... 40 3.6
15gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
16gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome... 40 3.6
17gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome... 40 3.6
18gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome... 40 3.6
19gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome... 40 3.6
20gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
21gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
22gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
23gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
24gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
25gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
26gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
27gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
28gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
29gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
30gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochr... 40 3.6
31gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome... 40 3.6
32gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome... 40 3.6
33gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome... 40 3.6
34gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome... 40 3.6
35gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome... 40 3.6
36gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome... 40 3.6
37gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome... 40 3.6
38gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome... 40 3.6
39gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome... 40 3.6
40gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochr... 40 3.6
41gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochr... 40 3.6
42gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 40 3.6
43gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 40 3.6
44gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochr... 40 3.6
45gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome... 40 3.6
46gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome... 40 3.6
47gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome... 40 3.6
48gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome... 40 3.6
49gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 40 3.6
50gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 40 3.6
51gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 40 3.6
52gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 40 3.6
53gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochr... 40 3.6
54gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cy... 40 3.6
55gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) ... 40 3.6
56gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds... 40 3.6
57gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partia... 40 3.6
58gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 40 3.6
59emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chrom... 40 3.6 
>gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial sequence
          Length = 766

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 173 ctggtacgcctcctttatcaccttcaggtcca 204
           ||||||||||||||||||||||||||||||||
Sbjct: 619 ctggtacgcctcctttatcaccttcaggtcca 588
to top
>ref|XM_467846.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1223

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 173 ctggtacgcctcctttatcaccttcaggtc 202
           |||||| ||||||||||||| |||||||||
Sbjct: 967 ctggtaggcctcctttatcagcttcaggtc 938
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 173      ctggtacgcctcctttatcaccttcaggtc 202
                |||||| ||||||||||||| |||||||||
Sbjct: 31716953 ctggtaggcctcctttatcagcttcaggtc 31716982
to top
>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0627E03
          Length = 159861

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 173   ctggtacgcctcctttatcaccttcaggtc 202
             |||||| ||||||||||||| |||||||||
Sbjct: 12751 ctggtaggcctcctttatcagcttcaggtc 12780
to top
>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1288_G09
          Length = 109672

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 173   ctggtacgcctcctttatcaccttcaggtc 202
             |||||| ||||||||||||| |||||||||
Sbjct: 96740 ctggtaggcctcctttatcagcttcaggtc 96769
to top
>dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065F07, full
           insert sequence
          Length = 1223

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 173 ctggtacgcctcctttatcaccttcaggtc 202
           |||||| ||||||||||||| |||||||||
Sbjct: 967 ctggtaggcctcctttatcagcttcaggtc 938
to top
>gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 504

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 440 atctcttattcctccatcaaaca 462
to top
>gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 465

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 465

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 465

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 30  atctcttattcctncatcaaaca 52
           ||||||||||||| |||||||||
Sbjct: 378 atctcttattcctccatcaaaca 400
to top
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 137     ggaaacagccttctgcaggg 156
               ||||||||||||||||||||
Sbjct: 2552474 ggaaacagccttctgcaggg 2552455
to top
>emb|AL772290.3| Mouse DNA sequence from clone RP23-66O4 on chromosome 4, complete
             sequence
          Length = 110623

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   tgtgtccttggaaacagccttctg 151
             ||||||||||| ||||||||||||
Sbjct: 65004 tgtgtccttgggaacagccttctg 64981


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,396,961
Number of Sequences: 3902068
Number of extensions: 1396961
Number of successful extensions: 50710
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50638
Number of HSP's gapped (non-prelim): 72
length of query: 273
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 251
effective length of database: 17,147,199,772
effective search space: 4303947142772
effective search space used: 4303947142772
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top