>gb|AF419005.1| Selaginella balansae internal transcribed spacer 1,  partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 613

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 39  ttctgagttctggcctgggctttt 62
           |||||||||||||||| |||||||
Sbjct: 106 ttctgagttctggcctcggctttt 129

>gb|AC093012.9| Homo sapiens 12 BAC RP11-210N13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 118572

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 78    atttcctttgaggtgacacttatg 101
             |||||||||||||||||| |||||
Sbjct: 94117 atttcctttgaggtgacatttatg 94094

>gb|AC019131.7| Homo sapiens BAC clone RP11-571L19 from 4, complete sequence
          Length = 208738

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 67     agagnaaatacatttcctttgag 89
              |||| ||||||||||||||||||
Sbjct: 161604 agagcaaatacatttcctttgag 161626

>gb|AY987960.1| Homo sapiens alcohol dehydrogenase 5 (class III), chi polypeptide
             (ADH5) gene, complete cds
          Length = 21460

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 67    agagnaaatacatttcctttgag 89
             |||| ||||||||||||||||||
Sbjct: 12527 agagcaaatacatttcctttgag 12505

>emb|AL928917.9| Zebrafish DNA sequence from clone CH211-103D12 in linkage group 1,
              complete sequence
          Length = 176961

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 74     atacatttcctttgaggtga 93
              ||||||||||||||||||||
Sbjct: 124579 atacatttcctttgaggtga 124560

>dbj|AP002026.2| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:429K21, complete
            sequence
          Length = 195389

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 67   agagnaaatacatttcctttgag 89
            |||| ||||||||||||||||||
Sbjct: 4595 agagcaaatacatttcctttgag 4617

>dbj|AP002028.1| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2043B18, complete
              sequence
          Length = 138621

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 67     agagnaaatacatttcctttgag 89
              |||| ||||||||||||||||||
Sbjct: 124675 agagcaaatacatttcctttgag 124697

>ref|XM_656994.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4482.2), mRNA
          Length = 1740

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 46  ttctggcctgggcttttat 64
           |||||||||||||||||||
Sbjct: 776 ttctggcctgggcttttat 794

>gb|AC163286.4| Mus musculus BAC clone RP23-334L22 from chromosome 12, complete
             sequence
          Length = 239973

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 58    cttttatatagagnaaatacatttcc 83
             ||||||||||||| ||| ||||||||
Sbjct: 84791 cttttatatagagtaaaaacatttcc 84816

>gb|AC097451.2| Homo sapiens BAC clone RP11-1E6 from 4, complete sequence
          Length = 146808

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 84    tttgaggtgacacttatga 102
             |||||||||||||||||||
Sbjct: 86556 tttgaggtgacacttatga 86538

>gb|AC139993.16| Mus musculus chromosome 12, clone RP23-67O10, complete sequence
          Length = 239577

 Score = 38.2 bits (19), Expect = 4.5
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 58     cttttatatagagnaaatacatttcc 83
              ||||||||||||| ||| ||||||||
Sbjct: 227211 cttttatatagagtaaaaacatttcc 227236


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 703,042
Number of Sequences: 3902068
Number of extensions: 703042
Number of successful extensions: 47694
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47681
Number of HSP's gapped (non-prelim): 13
length of query: 102
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 81
effective length of database: 17,151,101,840
effective search space: 1389239249040
effective search space used: 1389239249040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)