>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 100   aaggagtctctgaatgcgacaagcagca 127
             ||||||||| |||||||||||| |||||
Sbjct: 86895 aaggagtctatgaatgcgacaatcagca 86922

>ref|XM_842894.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0289)
           partial mRNA
          Length = 2376

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 100 aaggagtctctgaatgcgacaagcagca 127
           ||||||||| |||||||||||| |||||
Sbjct: 793 aaggagtctatgaatgcgacaatcagca 820

>emb|AL109936.11|HSJ1057J7 Human DNA sequence from clone RP5-1057J7 on chromosome 1 Contains a
              ribosomal protein L29 (RPL29) pseudogene, the HNRPR gene
              for heterogeneous nuclear ribonucleoprotein R, the ZNF436
              gene for zinc finger protein 436 (KIAA1710, FLJ35045), a
              novel gene (LOC148898), the 3' end of the TCEA3 gene for
              transcription elongation factor A (SII) 3 and a CpG island,
              complete sequence
          Length = 150285

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     ttgaaggagtctctgaatgc 116
              ||||||||||||||||||||
Sbjct: 110355 ttgaaggagtctctgaatgc 110336

>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 143    ccgagatccggcgcagctt 161
              |||||||||||||||||||
Sbjct: 811718 ccgagatccggcgcagctt 811700

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 112     aatgcgacaagcagcagat 130
               |||||||||||||||||||
Sbjct: 5986260 aatgcgacaagcagcagat 5986278

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 112    aatgcgacaagcagcagat 130
              |||||||||||||||||||
Sbjct: 296648 aatgcgacaagcagcagat 296630

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 112    aatgcgacaagcagcagat 130
              |||||||||||||||||||
Sbjct: 307305 aatgcgacaagcagcagat 307287

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 126     cagatctttggcgatcacc 144
               |||||||||||||||||||
Sbjct: 2249815 cagatctttggcgatcacc 2249797

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                          
Query: 122     gcagcagatctttggcgatcaccgaga 148
               |||||||||| || |||||||||||||
Sbjct: 2236285 gcagcagatcgttcgcgatcaccgaga 2236311

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 138     gatcaccgagatccggcgc 156
               |||||||||||||||||||
Sbjct: 1512607 gatcaccgagatccggcgc 1512625

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 140   tcaccgagatccggcgcag 158
             |||||||||||||||||||
Sbjct: 21276 tcaccgagatccggcgcag 21294

>dbj|D78001.1|RHMTREY Rhizobium sp. DNA for maltooligosyl trehalose trehalohydrolase,
            maltooligosyl trehalose synthase, complete cds
          Length = 4834

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 135  ggcgatcaccgagatccgg 153
            |||||||||||||||||||
Sbjct: 2058 ggcgatcaccgagatccgg 2040


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,274,117
Number of Sequences: 3902068
Number of extensions: 1274117
Number of successful extensions: 96333
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 96034
Number of HSP's gapped (non-prelim): 299
length of query: 182
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 160
effective length of database: 17,147,199,772
effective search space: 2743551963520
effective search space used: 2743551963520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)