| Clone Name | rbags1e24 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|BT009085.1| Triticum aestivum clone wkm1c.pk005.m16:fis, full... | 72 | 3e-10 | 2 | gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, com... | 38 | 4.1 | 3 | emb|AL031684.14|HS917N8 Human DNA sequence from clone RP5-917N8 ... | 38 | 4.1 | 4 | gb|AC102224.21| Mus musculus chromosome 3, clone RP24-372D1, com... | 38 | 4.1 |
|---|
>gb|BT009085.1| Triticum aestivum clone wkm1c.pk005.m16:fis, full insert mRNA sequence Length = 654 Score = 71.9 bits (36), Expect = 3e-10 Identities = 53/58 (91%), Gaps = 1/58 (1%) Strand = Plus / Minus Query: 37 atctccacatgacagngatgcccagtatcgctggccaccagnaactccacanaaacag 94 ||||||||||||||| || ||||||||| |||||||||||| ||||||||| |||||| Sbjct: 482 atctccacatgacagtgacgcccagtattgctggccaccag-aactccacataaacag 426
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 38.2 bits (19), Expect = 4.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 23 aaaaaggaatgatcatctc 41 ||||||||||||||||||| Sbjct: 3775 aaaaaggaatgatcatctc 3793
>emb|AL031684.14|HS917N8 Human DNA sequence from clone RP5-917N8 on chromosome 20p11.22-12.1 Contains STSs and GSSs, complete sequence Length = 143712 Score = 38.2 bits (19), Expect = 4.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 tgatcatctccacatgaca 50 ||||||||||||||||||| Sbjct: 82550 tgatcatctccacatgaca 82568
>gb|AC102224.21| Mus musculus chromosome 3, clone RP24-372D1, complete sequence Length = 196936 Score = 38.2 bits (19), Expect = 4.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 23 aaaaaggaatgatcatctc 41 ||||||||||||||||||| Sbjct: 9855 aaaaaggaatgatcatctc 9837 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 554,828 Number of Sequences: 3902068 Number of extensions: 554828 Number of successful extensions: 29659 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 29653 Number of HSP's gapped (non-prelim): 6 length of query: 95 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 74 effective length of database: 17,151,101,840 effective search space: 1269181536160 effective search space used: 1269181536160 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)