ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags1e21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BC046262.1| Xenopus laevis similar to Heat shock cognate prot... 46 0.16
2gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001... 46 0.16
3gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B0702... 46 0.16
4gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B5701... 46 0.16
5gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/... 46 0.16
6gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B1501... 46 0.16
7gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/... 46 0.16
8gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B0801... 46 0.16
9gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B0801... 46 0.16
10ref|NG_002397.2| Homo sapiens major histocompatibility complex, ... 46 0.16
11emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chr... 46 0.16
12emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on ch... 46 0.16
13emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chro... 46 0.16
14emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chr... 46 0.16
15emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chro... 46 0.16
16dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 46 0.16
17gb|DQ310791.1| Tetranychus urticae heat shock cognate 70 (hsc70)... 46 0.16
18gb|AC004210.1|AC004210 Homo sapiens clone UWGC:y5c028 from 6p21,... 46 0.16
19dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21... 46 0.16
20ref|XM_237623.3| PREDICTED: Rattus norvegicus general transcript... 44 0.63
21gb|CP000167.1| Drosophila melanogaster genomic scaffold 21100002... 44 0.63
22gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome 42 2.5
23gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome 42 2.5
24emb|AJ719639.1| Gallus gallus mRNA for hypothetical protein, clo... 42 2.5
25ref|NM_001006515.1| Gallus gallus general transcription factor I... 42 2.5
26gb|AC009785.8| Homo sapiens chromosome 7 clone RP11-198E23, comp... 42 2.5
27gb|AC018714.4| Homo sapiens BAC clone RP11-382A18 from 8, comple... 42 2.5
28dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.5
29dbj|AP002837.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.5
30gb|AC092129.3| Homo sapiens chromosome 16 clone RP11-140O8, comp... 40 9.8
31gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B1402... 40 9.8
32gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B1402... 40 9.8
33gb|AC145985.2| Pan troglodytes BAC clone RP43-17I24 from 7, comp... 40 9.8
34gb|AC144928.17| Medicago truncatula clone mth2-8a18, complete se... 40 9.8
35emb|AL163249.2|HS21C049 Homo sapiens chromosome 21 segment HS21C049 40 9.8
36emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chro... 40 9.8
37emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chrom... 40 9.8
38gb|AF129075.3| Homo sapiens chromosome 21 clone RP1-100J12, Rp1-... 40 9.8
39emb|AL354896.16| Human DNA sequence from clone RP11-512M17 on ch... 40 9.8
40emb|AL023807.6|HS525L6 Human DNA sequence from clone RP3-525L6 o... 40 9.8
41gb|AC092125.2| Homo sapiens chromosome 16 clone RP11-109D24, com... 40 9.8
42gb|AC148665.1| Macaca mulatta Major Histocompatibility Complex B... 40 9.8
43ref|XM_625139.1| PREDICTED: Apis mellifera similar to CG5971-PA ... 40 9.8
44gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, co... 40 9.8
45dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 40 9.8
46dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 40 9.8
47emb|BX784029.5| Zebrafish DNA sequence from clone DKEY-21H14 in ... 40 9.8
48emb|BX248111.7| Zebrafish DNA sequence from clone DKEY-22L11 in ... 40 9.8
49gb|AC004205.1|AC004205 Homo sapiens clone UWGC:y3c071 from 6p21,... 40 9.8
50gb|AC003688.1|AC003688 Homo sapiens chromosome 17, clone hRPC.4_... 40 9.8
51gb|AC133709.11| Medicago truncatula clone mth2-7b3, complete seq... 40 9.8 
>gb|BC046262.1| Xenopus laevis similar to Heat shock cognate protein 70, mRNA (cDNA
            clone MGC:53952 IMAGE:5570547), complete cds
          Length = 2202

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 384  aagagcaatgaccaaagataaca 406
            |||||||||||||||||||||||
Sbjct: 1386 aagagcaatgaccaaagataaca 1408
to top
>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic
             sequence
          Length = 346809

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 71931 atgccatgatgcaaacaccattg 71909
to top
>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103
             genomic sequence
          Length = 341361

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 70632 atgccatgatgcaaacaccattg 70610
to top
>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic
             sequence
          Length = 265420

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 75092 atgccatgatgcaaacaccattg 75070
to top
>gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 338517

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 71117 atgccatgatgcaaacaccattg 71095
to top
>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401
             genomic sequence
          Length = 351341

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 86724 atgccatgatgcaaacaccattg 86702
to top
>gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 328871

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 72100 atgccatgatgcaaacaccattg 72078
to top
>gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B080101/HLA-Cw070101
             genomic sequence
          Length = 338544

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 82836 atgccatgatgcaaacaccattg 82814
to top
>gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B080101/HLA-Cw070101
             genomic sequence
          Length = 342745

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 63445 atgccatgatgcaaacaccattg 63423
to top
>ref|NG_002397.2| Homo sapiens major histocompatibility complex, class I, BC (HLA-BC) on
             chromosome 6
          Length = 89417

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 37407 atgccatgatgcaaacaccattg 37429
to top
>emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chromosome 6 contains the
              gene for HCR, the TCF19 gene for  transcription factor 19,
              the POU5F1 gene for POU domain, class 5, transcription
              factor 1, a putative novel transcript, the HLA-C gene for
              major histocompatibility complex, class I, C, a ubiquitin
              specific protease 8 (USP8) pseudogene, a ribosomal protein
              L3 (RPL3) pseudogene, a WAS protein family, member 3
              (WASF3) pseudogene and  three CpG islands, complete
              sequence
          Length = 168887

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 268    atgccatgatgcaaacaccattg 290
              |||||||||||||||||||||||
Sbjct: 165300 atgccatgatgcaaacaccattg 165322
to top
>emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on chromosome 6 contains the
             HLA-C gene for major histocompatibility complex, class I,
             C, a ubiquitin specific protease 8 (USP8) pseudogene, a
             ribosomal protein L3 (RPL3) pseudogene, a WAS protein
             family, member 3 (WASF3) pseudogene, the HLA-B gene for
             major histocompatibility complex, class I, B, a
             dihydrofolate reductase pseudogene, a fibroblast growth
             factor receptor 3 (FGFR3) pseudogene and two CpG islands,
             complete sequence
          Length = 120197

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 40854 atgccatgatgcaaacaccattg 40876
to top
>emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chromosome 6, complete
             sequence
          Length = 106199

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 44867 atgccatgatgcaaacaccattg 44889
to top
>emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chromosome 6, complete
             sequence
          Length = 102821

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 44300 atgccatgatgcaaacaccattg 44322
to top
>emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chromosome 6, complete
             sequence
          Length = 63499

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 26225 atgccatgatgcaaacaccattg 26247
to top
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 268    atgccatgatgcaaacaccattg 290
              |||||||||||||||||||||||
Sbjct: 637959 atgccatgatgcaaacaccattg 637937
to top
>gb|DQ310791.1| Tetranychus urticae heat shock cognate 70 (hsc70) mRNA, complete cds
          Length = 2275

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 384  aagagcaatgaccaaagataaca 406
            |||||||||||||||||||||||
Sbjct: 1444 aagagcaatgaccaaagataaca 1466
to top
>gb|AC004210.1|AC004210 Homo sapiens clone UWGC:y5c028 from 6p21, complete sequence
          Length = 42601

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 268   atgccatgatgcaaacaccattg 290
             |||||||||||||||||||||||
Sbjct: 39699 atgccatgatgcaaacaccattg 39677
to top
>dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21.3 region including HLA
              genes, complete sequence
          Length = 236822

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 268    atgccatgatgcaaacaccattg 290
              |||||||||||||||||||||||
Sbjct: 109129 atgccatgatgcaaacaccattg 109107
to top
>ref|XM_237623.3| PREDICTED: Rattus norvegicus general transcription factor IIIC,
            polypeptide 3, 102kDa (predicted) (Gtf3c3_predicted),
            mRNA
          Length = 2654

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 645  taggagaaggttccaccagtca 666
            ||||||||||||||||||||||
Sbjct: 1883 taggagaaggttccaccagtca 1862
to top
>gb|CP000167.1| Drosophila melanogaster genomic scaffold 211000022279099
          Length = 58766

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 599   atccaatgggtactgcaaaaactgat 624
             |||||||||||||| |||||||||||
Sbjct: 41972 atccaatgggtacttcaaaaactgat 41997



 Score = 44.1 bits (22), Expect = 0.63
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 599   atccaatgggtactgcaaaaactgat 624
             |||||||||||||| |||||||||||
Sbjct: 38483 atccaatgggtacttcaaaaactgat 38458



 Score = 44.1 bits (22), Expect = 0.63
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 599   atccaatgggtactgcaaaaactgat 624
             |||||||||||||| |||||||||||
Sbjct: 37237 atccaatgggtacttcaaaaactgat 37212
to top
>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome
          Length = 4222334

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 682     tttcaccagaaaaatcataag 702
               |||||||||||||||||||||
Sbjct: 1598898 tttcaccagaaaaatcataag 1598878
to top
>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome
          Length = 4222645

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 682     tttcaccagaaaaatcataag 702
               |||||||||||||||||||||
Sbjct: 1599743 tttcaccagaaaaatcataag 1599723
to top
>emb|AJ719639.1| Gallus gallus mRNA for hypothetical protein, clone 4n14
          Length = 3336

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 646  aggagaaggttccaccagtca 666
            |||||||||||||||||||||
Sbjct: 2014 aggagaaggttccaccagtca 1994
to top
>ref|NM_001006515.1| Gallus gallus general transcription factor IIIC, polypeptide 3,
            102kDa (GTF3C3), mRNA
          Length = 3336

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 646  aggagaaggttccaccagtca 666
            |||||||||||||||||||||
Sbjct: 2014 aggagaaggttccaccagtca 1994
to top
>gb|AC009785.8| Homo sapiens chromosome 7 clone RP11-198E23, complete sequence
          Length = 179145

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 366   gaaacagcagcaacttccaag 386
             |||||||||||||||||||||
Sbjct: 87475 gaaacagcagcaacttccaag 87495
to top
>gb|AC018714.4| Homo sapiens BAC clone RP11-382A18 from 8, complete sequence
          Length = 176760

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 683   ttcaccagaaaaatcataaga 703
             |||||||||||||||||||||
Sbjct: 59951 ttcaccagaaaaatcataaga 59971
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 357    accaaaccagaaacagcagca 377
              |||||||||||||||||||||
Sbjct: 931158 accaaaccagaaacagcagca 931178
to top
>dbj|AP002837.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0019F11
          Length = 123673

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 357    accaaaccagaaacagcagca 377
              |||||||||||||||||||||
Sbjct: 112053 accaaaccagaaacagcagca 112073
to top
>gb|AC092129.3| Homo sapiens chromosome 16 clone RP11-140O8, complete sequence
          Length = 190333

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 474   tttgcaggcttattggaaac 493
             ||||||||||||||||||||
Sbjct: 60890 tttgcaggcttattggaaac 60871
to top
>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
             sequence
          Length = 363675

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   atgccatgatgcaaacacca 287
             ||||||||||||||||||||
Sbjct: 86324 atgccatgatgcaaacacca 86305
to top
>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
             sequence
          Length = 336776

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   atgccatgatgcaaacacca 287
             ||||||||||||||||||||
Sbjct: 65428 atgccatgatgcaaacacca 65409
to top
>gb|AC145985.2| Pan troglodytes BAC clone RP43-17I24 from 7, complete sequence
          Length = 162953

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 249   cttcaaaagagcagcagcga 268
             ||||||||||||||||||||
Sbjct: 31068 cttcaaaagagcagcagcga 31087
to top
>gb|AC144928.17| Medicago truncatula clone mth2-8a18, complete sequence
          Length = 138948

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 417   tcaaaagttgctgtctaagagaat 440
             |||||||||| |||||||||||||
Sbjct: 36821 tcaaaagttgttgtctaagagaat 36798
to top
>emb|AL163249.2|HS21C049 Homo sapiens chromosome 21 segment HS21C049
          Length = 340000

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    ccaaaccagcagaaaacagt 169
              ||||||||||||||||||||
Sbjct: 107030 ccaaaccagcagaaaacagt 107049
to top
>emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chromosome 6, complete
             sequence
          Length = 116320

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 268   atgccatgatgcaaacacca 287
             ||||||||||||||||||||
Sbjct: 42697 atgccatgatgcaaacacca 42716
to top
>emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chromosome 6 Contains the
             USP8P pseudogene for ubiquitin specific protease 8, the
             RPL3P2 pseudogene for ribosomal protein L3 pseudogene 2,
             the WASF5P pseudogene for WAS protein family, member 5,
             the HLA-B gene for major histocompatibility complex, class
             I, B, the DHFRP2 pseudogene for dihydrofolate reductase 2,
             the FGFR3P pseudogene for fibroblast growth factor
             receptor 3, the HLA-S gene for major histocompatibility
             complex, class I, S, the MICA gene for MHC class I
             polypeptide-related sequence A and 3 CpG islands, complete
             sequence
          Length = 148076

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 268   atgccatgatgcaaacacca 287
             ||||||||||||||||||||
Sbjct: 34124 atgccatgatgcaaacacca 34143
to top
>gb|AF129075.3| Homo sapiens chromosome 21 clone RP1-100J12, Rp1-P79E4 map q21.3-22.11,
              complete sequence
          Length = 190837

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    ccaaaccagcagaaaacagt 169
              ||||||||||||||||||||
Sbjct: 106866 ccaaaccagcagaaaacagt 106885
to top
>emb|AL354896.16| Human DNA sequence from clone RP11-512M17 on chromosome 13, complete
              sequence
          Length = 209743

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 682    tttcaccagaaaaatcataa 701
              ||||||||||||||||||||
Sbjct: 205435 tttcaccagaaaaatcataa 205416
to top
>emb|AL023807.6|HS525L6 Human DNA sequence from clone RP3-525L6 on chromosome 6p22.3-23 Contains
              the 5' end of a gene for a kinesin-like protein (RBKIN)
              protein, a ribosomal protein S12 (RPS12) pseudogene and a
              CpG Island, complete sequence
          Length = 168111

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 443    gtctttcatggttgggttca 462
              ||||||||||||||||||||
Sbjct: 165905 gtctttcatggttgggttca 165924
to top
>gb|AC092125.2| Homo sapiens chromosome 16 clone RP11-109D24, complete sequence
          Length = 173905

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 474   tttgcaggcttattggaaac 493
             ||||||||||||||||||||
Sbjct: 29997 tttgcaggcttattggaaac 30016
to top
>gb|AC148665.1| Macaca mulatta Major Histocompatibility Complex BAC MMU023M02, complete
             sequence
          Length = 182939

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 268   atgccatgatgcaaacacca 287
             ||||||||||||||||||||
Sbjct: 90021 atgccatgatgcaaacacca 90040
to top
>ref|XM_625139.1| PREDICTED: Apis mellifera similar to CG5971-PA (LOC552763), mRNA
          Length = 1650

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 362  accagaaacagcagcaactt 381
            ||||||||||||||||||||
Sbjct: 1122 accagaaacagcagcaactt 1103
to top
>gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, complete sequence
          Length = 198821

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 148    ttccaaaccagcagaaaacagttt 171
              ||||||| ||||||||||||||||
Sbjct: 195257 ttccaaagcagcagaaaacagttt 195234
to top
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 268    atgccatgatgcaaacacca 287
              ||||||||||||||||||||
Sbjct: 591735 atgccatgatgcaaacacca 591716
to top
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 268    atgccatgatgcaaacacca 287
              ||||||||||||||||||||
Sbjct: 187993 atgccatgatgcaaacacca 187974
to top
>emb|BX784029.5| Zebrafish DNA sequence from clone DKEY-21H14 in linkage group 4, complete
              sequence
          Length = 219903

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 23     ggttcaaagtattgctttga 42
              ||||||||||||||||||||
Sbjct: 194042 ggttcaaagtattgctttga 194061
to top
>emb|BX248111.7| Zebrafish DNA sequence from clone DKEY-22L11 in linkage group 4, complete
              sequence
          Length = 185023

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 256    agagcagcagcgatgccatg 275
              ||||||||||||||||||||
Sbjct: 130246 agagcagcagcgatgccatg 130227
to top
>gb|AC004205.1|AC004205 Homo sapiens clone UWGC:y3c071 from 6p21, complete sequence
          Length = 41506

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   atgccatgatgcaaacacca 287
             ||||||||||||||||||||
Sbjct: 36144 atgccatgatgcaaacacca 36125
to top
>gb|AC003688.1|AC003688 Homo sapiens chromosome 17, clone hRPC.4_G_17, complete sequence
          Length = 98117

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 148   ttccaaaccagcagaaaacagttt 171
             ||||||| ||||||||||||||||
Sbjct: 43509 ttccaaagcagcagaaaacagttt 43486
to top
>gb|AC133709.11| Medicago truncatula clone mth2-7b3, complete sequence
          Length = 138950

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 417    tcaaaagttgctgtctaagagaat 440
              |||||||||| |||||||||||||
Sbjct: 102129 tcaaaagttgttgtctaagagaat 102152


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,761,965
Number of Sequences: 3902068
Number of extensions: 7761965
Number of successful extensions: 228946
Number of sequences better than 10.0: 51
Number of HSP's better than 10.0 without gapping: 51
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 228464
Number of HSP's gapped (non-prelim): 482
length of query: 715
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 692
effective length of database: 17,143,297,704
effective search space: 11863162011168
effective search space used: 11863162011168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top