| Clone Name | rbags1e05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY534122.1|SEG_AY534122S1 Aegilops tauschii transposon XJ, complete sequence; putative Bowman Birk trypsin inhibitor gene, complete cds; Stowaway MITE, complete sequence; and insertion sequences xl_tt1a and xl_tt1b putative ripening related protein genes, complete cds Length = 26073 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 338 ggcagctcttgcaggtcggagcacactgctcgacctcgtc 377 ||||| ||||||||||||| || ||||||||||||||||| Sbjct: 8897 ggcaggtcttgcaggtcggggcgcactgctcgacctcgtc 8858 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 511 cctttgccttggctcggcaggag 533 ||||||||||||||||||||||| Sbjct: 8415 cctttgccttggctcggcaggag 8393 Score = 42.1 bits (21), Expect = 2.2 Identities = 41/48 (85%) Strand = Plus / Minus Query: 560 cggcgactaggagggcggactcnagggaaagcatcagcagcatgctag 607 ||||||| || |||| || ||| || |||||||||||||| ||||||| Sbjct: 8357 cggcgaccagaagggaggcctccagtgaaagcatcagcaggatgctag 8310
>gb|AC140244.3| Mus musculus BAC clone RP24-285J23 from 14, complete sequence Length = 171011 Score = 48.1 bits (24), Expect = 0.035 Identities = 24/24 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggcagcat 500 |||||||||||||||||||||||| Sbjct: 41969 cacgggcacgggcacgggcagcat 41946
>gb|AY103562.1| Zea mays PCO085487 mRNA sequence Length = 2258 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctct 445 ||||||||||||||||||||||| Sbjct: 2199 gtcgcagcatttccacggcctct 2177
>gb|AY104323.1| Zea mays PCO085485 mRNA sequence Length = 1303 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctct 445 ||||||||||||||||||||||| Sbjct: 579 gtcgcagcatttccacggcctct 557
>ref|NM_184202.2| Oryza sativa (japonica cultivar-group), mRNA Length = 876 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctc 444 |||||||||||||||||||||| Sbjct: 405 gtcgcagcatttccacggcctc 384
>emb|AL035454.18|HS1002M8 Human DNA sequence from clone RP5-1002M8 on chromosome 20p11.21-11.23 Contains the 3' end of the NAT5 gene for N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae), the CRNKL1 gene for crooked neck-like 1 (Drosophila) (Crn), the 5' end of the C20orf26 gene for chromosome 20 open reading frame 26 (C20orf26) and a CpG island, complete sequence Length = 111768 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 69 tgagcttccatttttattttattgtt 94 |||| ||||||||||||||||||||| Sbjct: 50578 tgagattccatttttattttattgtt 50603
>gb|AC154715.2| Mus musculus BAC clone RP24-361A22 from chromosome 16, complete sequence Length = 172362 Score = 44.1 bits (22), Expect = 0.55 Identities = 25/26 (96%) Strand = Plus / Plus Query: 69 tgagcttccatttttattttattgtt 94 ||||||| |||||||||||||||||| Sbjct: 82094 tgagcttgcatttttattttattgtt 82119
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctc 444 |||||||||||||||||||||| Sbjct: 1515243 gtcgcagcatttccacggcctc 1515222 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 42453074 cacgggcacgggcacgggca 42453093 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 gtcgcagcatttccacggcctctc 446 ||||||||| |||||||||||||| Sbjct: 1353366 gtcgcagcacttccacggcctctc 1353389
>dbj|AP002860.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0409B08 Length = 134673 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctc 444 |||||||||||||||||||||| Sbjct: 80891 gtcgcagcatttccacggcctc 80870
>dbj|AK105455.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-D07, full insert sequence Length = 876 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctc 444 |||||||||||||||||||||| Sbjct: 405 gtcgcagcatttccacggcctc 384
>dbj|AK102138.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033085I16, full insert sequence Length = 879 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctc 444 |||||||||||||||||||||| Sbjct: 408 gtcgcagcatttccacggcctc 387
>gb|M75136.1|IH1CG Ictalurid herpesvirus 1 strain Auburn 1, complete genome Length = 134226 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 476 ccacgggcacgggcacgggca 496 ||||||||||||||||||||| Sbjct: 62541 ccacgggcacgggcacgggca 62521
>gb|AC161383.5| Mus musculus BAC clone RP23-68C13 from chromosome 14, complete sequence Length = 195954 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggcag 497 ||||||||||||||||||||| Sbjct: 155210 cacgggcacgggcacgggcag 155230 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 155204 cacgggcacgggcacgggca 155223
>ref|NM_009900.1| Mus musculus chloride channel 2 (Clcn2), mRNA Length = 3148 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 1112 ggctggcagctcttgcaggtc 1092
>emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete genome; segment 4/29 Length = 298450 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ccacgggcacgggcacgggca 496 ||||||||||||||||||||| Sbjct: 254547 ccacgggcacgggcacgggca 254567
>dbj|AK141656.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030011H03 product:chloride channel 2, full insert sequence Length = 3945 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 2270 ggctggcagctcttgcaggtc 2250
>dbj|AK171231.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630312D12 product:chloride channel 2, full insert sequence Length = 2934 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 928 ggctggcagctcttgcaggtc 908
>dbj|AK155104.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630201N06 product:chloride channel 2, full insert sequence Length = 2934 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 928 ggctggcagctcttgcaggtc 908
>dbj|AK165000.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130114N01 product:chloride channel 2, full insert sequence Length = 3513 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 1162 ggctggcagctcttgcaggtc 1142
>dbj|AK172148.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830048E20 product:chloride channel 2, full insert sequence Length = 3757 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 1617 ggctggcagctcttgcaggtc 1597
>gb|AF332141.1|AF332141 Mus musculus receptor activator of NF-kappaB ligand (Tnfsf11) gene, 5' flanking and promoter regions Length = 2344 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggcag 497 ||||||||||||||||||||| Sbjct: 1302 cacgggcacgggcacgggcag 1322
>gb|AC126690.5| Mus musculus BAC clone RP23-189K24 from chromosome 14, complete sequence Length = 212894 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggcag 497 ||||||||||||||||||||| Sbjct: 41707 cacgggcacgggcacgggcag 41727 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 41701 cacgggcacgggcacgggca 41720
>gb|AF097415.1|AF097415 Mus musculus chloride channel CLC-2 (Clcn2) mRNA, complete cds Length = 3148 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 1112 ggctggcagctcttgcaggtc 1092
>gb|AF139724.1|AF139724 Mus musculus voltage-regulated and volume-regulated chloride channel ClC-2 mRNA, complete cds Length = 3107 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 1063 ggctggcagctcttgcaggtc 1043
>emb|CT010490.10| Mouse DNA sequence from clone RP23-148P12 on chromosome 16, complete sequence Length = 206348 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 334 ggctggcagctcttgcaggtc 354 ||||||||||||||||||||| Sbjct: 57146 ggctggcagctcttgcaggtc 57166
>gb|AY968582.1| Expression vector pKLAC1, complete sequence Length = 9091 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 4538 cacgggcacgggcacgggca 4557
>ref|XM_549980.1| Oryza sativa (japonica cultivar-group), mRNA Length = 411 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctctc 446 ||||||||| |||||||||||||| Sbjct: 27 gtcgcagcacttccacggcctctc 4
>ref|NM_189380.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 549 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 82 cacgggcacgggcacgggca 101
>gb|AC130666.9| Mus musculus chromosome 5, clone RP24-79O7, complete sequence Length = 172995 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 159887 cacgggcacgggcacgggca 159906
>gb|AC134605.5| Mus musculus BAC clone RP23-42E17 from chromosome 14, complete sequence Length = 216097 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 156267 cacgggcacgggcacgggca 156286
>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence Length = 179931 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 145652 cacgggcacgggcacgggca 145633
>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence Length = 176969 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 31054 cacgggcacgggcacgggca 31035
>gb|AC131719.5| Mus musculus BAC clone RP23-151H15 from chromosome 19, complete sequence Length = 216902 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 cacacactgcaggctgctgc 120 |||||||||||||||||||| Sbjct: 2622 cacacactgcaggctgctgc 2603
>gb|AC137901.7| Mus musculus chromosome 6, clone RP23-81E17, complete sequence Length = 158419 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 61729 cacgggcacgggcacgggca 61710
>gb|AC118476.15| Mus musculus chromosome 9, clone RP23-242K3, complete sequence Length = 197683 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 135384 cacgggcacgggcacgggca 135365 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 135378 cacgggcacgggcacgggca 135359
>gb|BC043995.1| Xenopus laevis ACTN1 protein, mRNA (cDNA clone MGC:53955 IMAGE:5570582), complete cds Length = 3658 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 ctgcaggctgctgcagcgac 126 |||||||||||||||||||| Sbjct: 25 ctgcaggctgctgcagcgac 44
>gb|AC134591.4| Mus musculus BAC clone RP23-376L4 from chromosome 19, complete sequence Length = 222814 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 acatgcacacactgcaggct 115 |||||||||||||||||||| Sbjct: 168624 acatgcacacactgcaggct 168605 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 acatgcacacactgcaggct 115 |||||||||||||||||||| Sbjct: 168546 acatgcacacactgcaggct 168527
>ref|XM_863655.1| PREDICTED: Canis familiaris hypothetical protein LOC612479 (LOC612479), mRNA Length = 1548 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 1197 cacgggcacgggcacgggca 1178
>ref|XM_757193.1| Ustilago maydis 521 hypothetical protein (UM06139.1) partial mRNA Length = 2751 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 1909 cacgggcacgggcacgggca 1928
>emb|CT010434.8| Mouse DNA sequence from clone RP23-225H9 on chromosome 17, complete sequence Length = 218000 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 6475 cacgggcacgggcacgggca 6456 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 6469 cacgggcacgggcacgggca 6450 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 6463 cacgggcacgggcacgggca 6444
>gb|AC125075.4| Mus musculus BAC clone RP23-468P13 from chromosome 19, complete sequence Length = 188709 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 cacacactgcaggctgctgc 120 |||||||||||||||||||| Sbjct: 151285 cacacactgcaggctgctgc 151266
>gb|AC124534.4| Mus musculus BAC clone RP23-316G7 from chromosome 1, complete sequence Length = 177675 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cttccatttttattttattg 92 |||||||||||||||||||| Sbjct: 91699 cttccatttttattttattg 91680
>gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete sequence Length = 171124 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 440 gcctctcttcgtctcccccc 459 |||||||||||||||||||| Sbjct: 122749 gcctctcttcgtctcccccc 122768
>gb|AC164563.4| Mus musculus BAC clone RP23-130D15 from chromosome 6, complete sequence Length = 202948 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 64699 cacgggcacgggcacgggca 64718
>gb|AC144503.17| Medicago truncatula clone mth2-13f22, complete sequence Length = 116810 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 94949 cacgggcacgggcacgggca 94968
>gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (CG10013), CG31217 (CG31217), and ultrabithorax (Ubx) genes, complete cds Length = 308092 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 125518 cacgggcacgggcacgggca 125537
>ref|NM_009289.1| Mus musculus STE20-like kinase (yeast) (Slk), mRNA Length = 4279 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 cacacactgcaggctgctgc 120 |||||||||||||||||||| Sbjct: 2023 cacacactgcaggctgctgc 2004
>emb|AL031430.2|HS406M12 Human DNA sequence from clone RP3-406M12 on chromosome 1p34.1-34.3 Contains a CpG island, complete sequence Length = 159281 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cttccatttttattttattg 92 |||||||||||||||||||| Sbjct: 56246 cttccatttttattttattg 56227
>emb|Z48179.1|SC9302X S.cerevisiae chromosome IV cosmid 9302 Length = 37552 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 72 gcttccatttttattttatt 91 |||||||||||||||||||| Sbjct: 35613 gcttccatttttattttatt 35632
>emb|Y18818.1|SLI18818 Streptomyces lividans transcriptional regulator and actinorhodin biosynthetic genes, strain TK21 Length = 2947 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 2273 cacgggcacgggcacgggca 2254
>emb|X94549.1|ACPCPNTER A.carterae precursor of peridinin-chlorophylla-protein (PCP) gene Length = 1272 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 503 ctgcttggcctttgccttgg 522 |||||||||||||||||||| Sbjct: 535 ctgcttggcctttgccttgg 554
>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1320834 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 1308785 cacgggcacgggcacgggca 1308804
>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence Length = 1302002 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 529085 cacgggcacgggcacgggca 529066
>emb|BX572594.1| Rhodopseudomonas palustris CGA009 complete genome; segment 2/16 Length = 348971 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 358 gcacactgctcgacctcgtc 377 |||||||||||||||||||| Sbjct: 92006 gcacactgctcgacctcgtc 91987
>emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete genome; segment 12/29 Length = 276800 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 142041 cacgggcacgggcacgggca 142022 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 142035 cacgggcacgggcacgggca 142016
>emb|AL031024.1|DMC196F3 Drosophila melanogaster cosmid clone 196F3 Length = 35835 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 26043 cacgggcacgggcacgggca 26024
>emb|AJ277469.1|OSA277469 Oryza sativa rbbi3-3 gene for rice Bowman Birk trypsin inhibitor Length = 4624 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctctc 446 ||||||||| |||||||||||||| Sbjct: 3063 gtcgcagcacttccacggcctctc 3040
>emb|AL663065.9| Mouse DNA sequence from clone RP23-248G11 on chromosome 11 Contains a heterogeneous nuclear ribonucleoprotein pseudogene and a CpG island, complete sequence Length = 210386 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 tgagcttccatttttatttt 88 |||||||||||||||||||| Sbjct: 17642 tgagcttccatttttatttt 17661
>gb|DQ099244.1| Arachis hypogaea clone Ah-028 microsatellite sequence Length = 246 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 211 cacgggcacgggcacgggca 192
>emb|X06997.1|KLLAC12 Kluyveromyces lactis LAC12 gene for lactose permease Length = 7127 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 521 cacgggcacgggcacgggca 502
>gb|AC011492.8| Homo sapiens chromosome 19 clone CTB-187L3, complete sequence Length = 153064 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 gcttccatttttattttatt 91 |||||||||||||||||||| Sbjct: 70090 gcttccatttttattttatt 70071
>dbj|AK135715.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length enriched library, clone:7420405M03 product:unclassifiable, full insert sequence Length = 2113 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 80 cacgggcacgggcacgggca 61 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 74 cacgggcacgggcacgggca 55 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 68 cacgggcacgggcacgggca 49
>gb|AF351191.1| Zea mays cultivar Hi-II D-type cyclin (cycD4) mRNA, complete cds Length = 1638 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 1116 cacgggcacgggcacgggca 1097
>gb|AC083837.4| Homo sapiens chromosome 8, clone RP11-79H23, complete sequence Length = 166114 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 430 catttccacggcctctcttc 449 |||||||||||||||||||| Sbjct: 88381 catttccacggcctctcttc 88362
>dbj|AK165145.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN full-length enriched library, clone:E330037N21 product:hypothetical protein, full insert sequence Length = 1401 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 79 cacgggcacgggcacgggca 60 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 73 cacgggcacgggcacgggca 54 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 67 cacgggcacgggcacgggca 48
>emb|BX322612.8| Zebrafish DNA sequence from clone RP71-80O10 in linkage group 23, complete sequence Length = 158403 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 88978 cacgggcacgggcacgggca 88997 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 88972 cacgggcacgggcacgggca 88991 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 88966 cacgggcacgggcacgggca 88985
>gb|AC156609.8| Mus musculus chromosome 15, clone RP23-56E21, complete sequence Length = 118659 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 84214 cacgggcacgggcacgggca 84195 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 84208 cacgggcacgggcacgggca 84189 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 84202 cacgggcacgggcacgggca 84183 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 84196 cacgggcacgggcacgggca 84177 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 84190 cacgggcacgggcacgggca 84171
>dbj|AK029491.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4921503G23 product:serine/threonine kinase 2, full insert sequence Length = 2396 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 cacacactgcaggctgctgc 120 |||||||||||||||||||| Sbjct: 1885 cacacactgcaggctgctgc 1866
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III, complete sequence Length = 907057 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 551 ggcggccggcggcgactaggaggg 574 |||||||||||||||||| ||||| Sbjct: 298668 ggcggccggcggcgactacgaggg 298691
>gb|AC153649.4| Mus musculus BAC clone RP24-93B8 from chromosome 1, complete sequence Length = 162838 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 440 gcctctcttcgtctcccccc 459 |||||||||||||||||||| Sbjct: 152173 gcctctcttcgtctcccccc 152192
>gb|AC131772.4| Mus musculus BAC clone RP24-300K9 from chromosome 5, complete sequence Length = 161015 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 74 ttccatttttattttattgt 93 |||||||||||||||||||| Sbjct: 73554 ttccatttttattttattgt 73573
>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483G10 Length = 190721 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 112412 cacgggcacgggcacgggca 112431
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 5196974 cacgggcacgggcacgggca 5196993 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 5196968 cacgggcacgggcacgggca 5196987
>gb|AC087738.13| Homo sapiens chromosome 15, clone RP11-365F16, complete sequence Length = 181511 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cttccatttttattttattg 92 |||||||||||||||||||| Sbjct: 100303 cttccatttttattttattg 100322
>gb|AF112855.1|AF112855 Mus musculus Ste20-related kinase SMAK (SMAK) mRNA, complete cds Length = 5253 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 cacacactgcaggctgctgc 120 |||||||||||||||||||| Sbjct: 1907 cacacactgcaggctgctgc 1888
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 gcaggctgctgcagcgactc 128 |||||||||||||||||||| Sbjct: 3413388 gcaggctgctgcagcgactc 3413369
>dbj|AP003233.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0037C04 Length = 137879 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 gtcgcagcatttccacggcctctc 446 ||||||||| |||||||||||||| Sbjct: 51417 gtcgcagcacttccacggcctctc 51440
>emb|AL935299.11| Zebrafish DNA sequence from clone DKEY-38M5, complete sequence Length = 229574 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 75 tccatttttattttattgtt 94 |||||||||||||||||||| Sbjct: 43736 tccatttttattttattgtt 43717
>dbj|AK104613.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D08, full insert sequence Length = 913 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 159 cacgggcacgggcacgggca 178
>ref|NM_208720.1| Eremothecium gossypii ACL037Wp (ACL037W), mRNA Length = 864 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 551 ggcggccggcggcgactaggaggg 574 |||||||||||||||||| ||||| Sbjct: 282 ggcggccggcggcgactacgaggg 305
>dbj|AK065858.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013041E22, full insert sequence Length = 859 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 163 cacgggcacgggcacgggca 182
>gb|AC140363.3| Mus musculus BAC clone RP23-212M11 from 9, complete sequence Length = 217832 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 93798 cacgggcacgggcacgggca 93817 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 93792 cacgggcacgggcacgggca 93811 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 93786 cacgggcacgggcacgggca 93805
>dbj|AK060804.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-F08, full insert sequence Length = 957 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 162 cacgggcacgggcacgggca 181
>gb|AY104381.1| Zea mays PCO099508 mRNA sequence Length = 875 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 543 cacgggcacgggcacgggca 562
>gb|AF088189.1|AF088189 Mus musculus CD4 antigen (Cd4) gene, partial sequence Length = 23108 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 14343 cacgggcacgggcacgggca 14324
>dbj|AB098712.1| Oryza sativa (japonica cultivar-group) ti mRNA for trypsin inhibitor, complete cds Length = 1061 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 gtcgcagcatttccacggcctctc 446 ||||||||| |||||||||||||| Sbjct: 386 gtcgcagcacttccacggcctctc 363
>gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 of 74 of the complete sequence Length = 323840 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 180726 cacgggcacgggcacgggca 180707
>dbj|AK122218.1| Mus musculus mRNA for mKIAA0204 protein Length = 5840 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 cacacactgcaggctgctgc 120 |||||||||||||||||||| Sbjct: 2359 cacacactgcaggctgctgc 2340
>emb|AL954843.8| Zebrafish DNA sequence from clone DKEY-149K8 in linkage group 15, complete sequence Length = 204599 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cttccatttttattttattg 92 |||||||||||||||||||| Sbjct: 156618 cttccatttttattttattg 156599
>emb|AL928812.11| Mouse DNA sequence from clone RP23-321B23 on chromosome 2, complete sequence Length = 199019 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 31783 cacgggcacgggcacgggca 31802
>gb|AC002397.1|AC002397 Mouse chromosome 6 BAC-284H12 (Research Genetics mouse BAC library) complete sequence Length = 227538 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 8433 cacgggcacgggcacgggca 8414
>emb|AL935326.13| Mouse DNA sequence from clone RP23-10L17 on chromosome 2, complete sequence Length = 224044 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 68 ctgagcttccatttttattttatt 91 ||||||||||| |||||||||||| Sbjct: 209887 ctgagcttccaattttattttatt 209864
>gb|AC154304.1| Mus musculus BAC clone RP24-491H15 from 16, complete sequence Length = 169500 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 95777 cacgggcacgggcacgggca 95758 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 95771 cacgggcacgggcacgggca 95752 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 95765 cacgggcacgggcacgggca 95746 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 95759 cacgggcacgggcacgggca 95740 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 95753 cacgggcacgggcacgggca 95734
>gb|AC142254.4| Mus musculus BAC clone RP24-545G7 from 6, complete sequence Length = 159818 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 45608 cacgggcacgggcacgggca 45589
>gb|AF039574.1|AF039574 Mus musculus serine/threonine protein kinase mRNA, complete cds Length = 4279 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 cacacactgcaggctgctgc 120 |||||||||||||||||||| Sbjct: 2023 cacacactgcaggctgctgc 2004
>gb|AC118593.6| Mus musculus chromosome 19, clone RP24-464I2, complete sequence Length = 126059 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 acatgcacacactgcaggct 115 |||||||||||||||||||| Sbjct: 17417 acatgcacacactgcaggct 17398 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 acatgcacacactgcaggct 115 |||||||||||||||||||| Sbjct: 17339 acatgcacacactgcaggct 17320
>dbj|AP006364.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT28B04, TM0170, complete sequence Length = 101172 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 74938 cacgggcacgggcacgggca 74919
>gb|AC172751.1| Mus musculus BAC clone RP23-341F9 from chromosome 14, complete sequence Length = 200222 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 139440 cacgggcacgggcacgggca 139421
>gb|M17075.1|MUSCD41 Mouse T-cell differentiation antigen CD4 (L3T4) gene, exon 1 Length = 839 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 cacgggcacgggcacgggca 496 |||||||||||||||||||| Sbjct: 191 cacgggcacgggcacgggca 172
>dbj|AP002909.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0044F08 Length = 141528 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 gtcgcagcatttccacggcctctc 446 ||||||||| |||||||||||||| Sbjct: 2987 gtcgcagcacttccacggcctctc 3010 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,238,402 Number of Sequences: 3902068 Number of extensions: 6238402 Number of successful extensions: 145274 Number of sequences better than 10.0: 100 Number of HSP's better than 10.0 without gapping: 101 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 144705 Number of HSP's gapped (non-prelim): 543 length of query: 626 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 603 effective length of database: 17,143,297,704 effective search space: 10337408515512 effective search space used: 10337408515512 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)