Clone Name	rbags1d11
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_463925.1| Oryza sativa (japonica cultivar-group), mRNA	238	2e-59
2	tpg|BK000999.1| TPA: TPA_exp: Oryza sativa (indica cultivar-grou...	238	2e-59
3	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	141	3e-30
4	dbj|AP004885.3| Oryza sativa (japonica cultivar-group) genomic D...	141	3e-30
5	gb|AC127367.4| Mus musculus BAC clone RP23-19G15 from chromosome...	44	0.53
6	gb|AC123815.3| Mus musculus BAC clone RP24-238O19 from chromosom...	44	0.53
7	ref|XR_002568.1| PREDICTED: Mus musculus similar to Glyceraldehy...	42	2.1
8	gb|AC107030.3| Homo sapiens 3 BAC RP11-603J22 (Roswell Park Canc...	42	2.1
9	gb|AC129951.9| Mus musculus chromosome 15, clone RP23-127B14, co...	42	2.1
10	gb|AC151476.1| Mus musculus BAC clone RP23-287H13 from 8, comple...	42	2.1
11	gb|DQ234790.1| HIV-1 isolate HK001 from Hong Kong, complete genome	40	8.2
12	gb|AY669779.1| HIV-1 isolate CMU02 from Thailand envelope glycop...	40	8.2
13	gb|AY669778.1| HIV-1 isolate 92TH022 from Thailand envelope glyc...	40	8.2
14	gb|AY669776.1| HIV-1 isolate 92TH006 from Thailand envelope glyc...	40	8.2
15	gb|AY669775.1| HIV-1 isolate 92TH021 from Thailand envelope glyc...	40	8.2
16	gb|AY669774.1| HIV-1 isolate 92TH024 from Thailand envelope glyc...	40	8.2
17	gb|AY669772.1| HIV-1 isolate 92TH019 from Thailand envelope glyc...	40	8.2
18	gb|AY669771.1| HIV-1 isolate CMU06 from Thailand envelope glycop...	40	8.2
19	gb|AY669770.1| HIV-1 isolate 92TH001 from Thailand envelope glyc...	40	8.2
20	gb|DQ168576.1| HIV-1 isolate 01NGPL0669 from Nigeria gag protein...	40	8.2
21	gb|U51188.1|HIVU51188 HIV-1 clone 90cf402 from the Central Afric...	40	8.2
22	gb|U51189.1|HIVU51189 HIV-1 clone 93th253 from Thailand, complet...	40	8.2
23	gb|AY650001.1| Eucommia ulmoides isolate L45 18S ribosomal RNA g...	40	8.2
24	gb|AY649997.1| Eucommia ulmoides isolate L23 18S ribosomal RNA g...	40	8.2
25	gb|AY371166.1| HIV-1 isolate 01CM.0989MO from Cameroon gag prote...	40	8.2
26	gb|AY371165.1| HIV-1 isolate 02CM.1867LE from Cameroon gag prote...	40	8.2
27	gb|AY371121.1| HIV-1 isolate 01CM.4049HAN from Cameroon gag prot...	40	8.2
28	gb|AY358072.1| HIV-1 02TH.OUR846I from Thailand gag protein (gag...	40	8.2
29	gb|AY358071.1| HIV-1 01TH.OUR033I from Thailand gag protein (gag...	40	8.2
30	gb|AY358070.1| HIV-1 02TH.OUR840I from Thailand gag protein (gag...	40	8.2
31	gb|AY358068.1| HIV-1 01TH.OUR788I from Thailand gag protein (gag...	40	8.2
32	gb|AY358067.1| HIV-1 00TH.OUR721I from Thailand gag protein (gag...	40	8.2
33	gb|AY358065.1| HIV-1 99TH.OUR008I from Thailand gag protein (gag...	40	8.2
34	gb|AY358064.1| HIV-1 01TH.OUR830I from Thailand gag protein (gag...	40	8.2
35	gb|AY358061.1| HIV-1 00TH.OUR746I from Thailand nonfunctional ga...	40	8.2
36	gb|AY358060.1| HIV-1 00TH.OUR724I from Thailand gag protein (gag...	40	8.2
37	gb|AY358056.1| HIV-1 1TH.OUR647I from Thailand gag protein (gag)...	40	8.2
38	gb|AY358052.1| HIV-1 00TH.OUR595I from Thailand gag protein (gag...	40	8.2
39	gb|AY358051.1| HIV-1 99TH.OUR422I from Thailand gag protein (gag...	40	8.2
40	gb|AY358045.1| HIV-1 99TH.OUR164I from Thailand gag protein (gag...	40	8.2
41	gb|AY358042.1| HIV-1 99TH.OUR044I from Thailand gag protein (gag...	40	8.2
42	gb|AY358040.1| HIV-1 01TH.OUR609I from Thailand gag protein (gag...	40	8.2
43	gb|AY358038.1| HIV-1 01TH.OUR674I from Thailand gag protein (gag...	40	8.2
44	gb|AY358036.1| HIV-1 01TH.OUR786I from Thailand gag protein (gag...	40	8.2
45	gb|AE008919.1| Uncultured proteobacterium BAC EBAC000-65D09 comp...	40	8.2
46	gb|AY961592.1| HIV-1 isolate ThaiNIH01_C2w from Thailand vpu pro...	40	8.2
47	gb|AY961589.1| HIV-1 isolate ThaiNIH01_C1h from Thailand envelop...	40	8.2
48	gb|AY945734.1| HIV-1 isolate 00TH.R1741 from Thailand gag protei...	40	8.2
49	gb|AY945733.1| HIV-1 isolate 00TH.C2254_BE from Thailand gag pro...	40	8.2
50	gb|AY945730.1| HIV-1 isolate 01TH.R2184 from Thailand gag protei...	40	8.2
51	gb|AY945728.1| HIV-1 isolate 98TH.R1166 from Thailand gag protei...	40	8.2
52	gb|AY945726.1| HIV-1 isolate 99TH.C4460 from Thailand gag protei...	40	8.2
53	gb|AY945725.1| HIV-1 isolate 00TH.C4382 from Thailand gag protei...	40	8.2
54	gb|AY945724.1| HIV-1 isolate 00TH.C4151 from Thailand gag protei...	40	8.2
55	gb|AY945722.1| HIV-1 isolate 00TH.C4118 from Thailand gag protei...	40	8.2
56	gb|AY945720.1| HIV-1 isolate 01TH.C3256 from Thailand gag protei...	40	8.2
57	gb|AY945718.1| HIV-1 isolate 99TH.C2405 from Thailand gag protei...	40	8.2
58	gb|AY945717.1| HIV-1 isolate 00TH.C2257 from Thailand gag protei...	40	8.2
59	gb|AY945712.1| HIV-1 isolate 99TH.C1080 from Thailand gag protei...	40	8.2
60	gb|AC132256.3| Mus musculus BAC clone RP24-358I7 from chromosome...	40	8.2
61	gb|AF411964.1| HIV-1 isolate 99ZACM4 from South Africa, complete...	40	8.2
62	gb|AC127369.4| Mus musculus BAC clone RP23-26A15 from 8, complet...	40	8.2
63	gb|AC115120.4| Mus musculus BAC clone RP23-116M23 from 16, compl...	40	8.2
64	gb|AF457062.1| HIV-1 isolate 99KE_KNH1043 from Kenya, partial ge...	40	8.2
65	gb|AF070713.1| HIV-1 isolate NI1157 from Thailand, envelope glyc...	40	8.2
66	gb|AF070711.1| HIV-1 isolate NI1155 from Thailand, envelope glyc...	40	8.2
67	gb|AF070710.1| HIV-1 isolate NI1154 from Thailand, envelope glyc...	40	8.2
68	gb|AF070709.1| HIV-1 isolate NI1152 from Thailand, envelope glyc...	40	8.2
69	gb|AF070705.1| HIV-1 isolate NI1146 from Thailand, envelope glyc...	40	8.2
70	gb|AF070703.1| HIV-1 isolate NI1144 from Thailand, envelope glyc...	40	8.2
71	gb|AF070707.1| HIV-1 isolate NI1149 from Thailand, envelope glyc...	40	8.2
72	gb|AY082968.1| HIV-1 isolate TH 13-26 from Thailand, complete ge...	40	8.2
73	gb|AY535660.1| HIV-1 isolate EE0369 from Estonia, complete genome	40	8.2
74	gb|AY535659.1| HIV-1 isolate EE0359 from Estonia, complete genome	40	8.2
75	gb|AF490974.1| HIV-1 strain TH 9-95 from Thailand, complete genome	40	8.2
76	gb|AF490973.1| HIV-1 strain 12-69 from Thailand, complete genome	40	8.2
77	gb|AF468970.1| HIV-1 strain TH 2-83 from Thailand, complete genome	40	8.2
78	gb|AF530576.1| HIV-1 isolate 99TH.R2399 subtype CRF15_01B from T...	40	8.2
79	gb|AF529572.1| HIV-1 isolate 02TH.OUR1331 subtype CRF15_01B from...	40	8.2
80	gb|AF197341.1| HIV-1 isolate 90CF4071 from Central African Repub...	40	8.2
81	gb|AF197340.1| HIV-1 isolate 90CF11697 from Central African Repu...	40	8.2
82	gb|AF197339.1| HIV-1 isolate 93TH065 from Thailand, complete genome	40	8.2
83	gb|AF197338.1| HIV-1 isolate 93TH057 from Thailand, complete genome	40	8.2
84	emb|Z99105.2|BSUB0002 Bacillus subtilis complete genome (section...	40	8.2
85	gb|U08458.1|HIV1U08458 HIV-1 isolate 976 clone 17 from Thailand,...	40	8.2
86	gb|U08457.1|HIV1U08457 HIV-1 isolate 975 clone 15 from Thailand,...	40	8.2
87	gb|U08456.1|HIV1U08456 HIV-1 isolate 966 clone 8 from Thailand, ...	40	8.2
88	gb|AF423755.1| HIV-1 isolate X254 from Spain, complete genome	40	8.2
89	gb|AF423760.1| HIV-1 isolate X558 from Spain, complete genome	40	8.2
90	gb|AF423759.1| HIV-1 isolate X477 from Spain, complete genome	40	8.2
91	gb|AF423758.1| HIV-1 isolate X475 from Spain, complete genome	40	8.2
92	gb|AF423757.1| HIV-1 isolate X421 from Spain, complete genome	40	8.2
93	gb|AF423756.1| HIV-1 isolate X397 from Spain, complete genome	40	8.2
94	gb|AF450097.1| HIV-1 isolate X623 from Spain, complete genome	40	8.2
95	gb|AF450096.1| HIV-1 isolate X605 from Spain, complete genome	40	8.2
96	emb|AJ630581.1| Human immunodeficiency virus type 1 proviral par...	40	8.2
97	emb|AJ508597.1|HIM508597 Human immunodeficiency virus type 1 com...	40	8.2
98	emb|AJ508596.1|HIM508596 Human immunodeficiency virus type 1 com...	40	8.2
99	emb|AJ508595.1|HIM508595 Human immunodeficiency virus type 1 com...	40	8.2
100	emb|AJ401042.1|HIM401042 Human immunodeficiency virus type 1 pro...	40	8.2
101	emb|AJ288982.1|HIM288982 Human immunodeficiency virus type 1 com...	40	8.2
102	emb|AJ288981.1|HIM288981 Human immunodeficiency virus type 1 com...	40	8.2
103	emb|AJ277822.1|HIM277822 Human immunodeficiency virus type 1 pro...	40	8.2
104	emb|AJ276596.1|HIM276596 HIV-1 proviral gag gene, pol gene, vif ...	40	8.2
105	gb|AF460974.1| HIV-1 isolate 96CM-4164 from Cameroon, complete g...	40	8.2
106	gb|AF460972.1| HIV-1 isolate 96CM-1849 from Cameroon, complete g...	40	8.2
107	gb|AY125894.1| HIV-1 isolate 97TH6-107 from Thailand, complete g...	40	8.2
108	gb|AY586548.1| HIV-1 isolate Cu85 from Cuba, complete genome	40	8.2
109	gb|U08811.1|HIV1U08811 HIV-1 sample 011 clone 05 from Thailand (...	40	8.2
110	gb|U08810.1|HIV1U08810 HIV-1 sample 006 clone 05 from Thailand (...	40	8.2
111	gb|U09131.1|HIV1U09131 HIV-1 clone TH022.44 from Thailand, envel...	40	8.2
112	gb|AC097516.2| Homo sapiens BAC clone RP11-468A23 from 4, comple...	40	8.2
113	gb|AF127550.2| HIV-1 strain 97CG276 from Republic of the Congo t...	40	8.2
114	gb|AF127548.2| HIV-1 strain 96CG34 from Republic of the Congo ta...	40	8.2
115	gb|AF127547.2| HIV-1 strain 96CG21 from Republic of the Congo ta...	40	8.2
116	gb|AF127546.2| HIV-1 strain 96CG17 from Republic of the Congo ta...	40	8.2
117	gb|AF127544.2| HIV-1 strain 96CG11 from Republic of the Congo ta...	40	8.2
118	gb|AF410451.1| HIV-1 isolate 97CG313 from Democratic Republic of...	40	8.2
119	gb|AF410449.1| HIV-1 isolate 97CG305 from Democratic Republic of...	40	8.2
120	gb|AF410448.1| HIV-1 isolate 97CG284 from Democratic Republic of...	40	8.2
121	gb|AF410446.1| HIV-1 isolate 97CG275 from Democratic Republic of...	40	8.2
122	gb|AF410443.1| HIV-1 isolate 96CG30 from Democratic Republic of ...	40	8.2
123	gb|AF410440.1| HIV-1 isolate 96CG23 from Democratic Republic of ...	40	8.2
124	gb|AF410439.1| HIV-1 isolate 96CG22 from Democratic Republic of ...	40	8.2
125	gb|AC011260.8| Homo sapiens, clone RP11-1E21, complete sequence	40	8.2
126	gb|AF377958.1|AF377958 HIV-1 isolate CM52876 from Cameroon gag p...	40	8.2
127	gb|AF377957.1|AF377957 HIV-1 isolate CM53392 from Cameroon gag p...	40	8.2
128	gb|AY037285.1|AY037284S2 HIV-1 from Cameroon vpu protein (vpu) a...	40	8.2
129	gb|AF387054.1|AF387054 HIV-1 isolate TWE/11013/00 from Taiwan vp...	40	8.2
130	gb|AF387048.1|AF387048 HIV-1 isolate TWE/11073/00 from Taiwan vp...	40	8.2
131	gb|AF387047.1|AF387047 HIV-1 isolate TWE/92612/00 from Taiwan vp...	40	8.2
132	gb|AF387046.1|AF387046 HIV-1 isolate TWE/92612/00 from Taiwan vp...	40	8.2
133	gb|AF387045.1|AF387045 HIV-1 isolate TWE/10172/00 from Taiwan vp...	40	8.2
134	gb|AF387044.1|AF387044 HIV-1 isolate TWE/8266/00 from Taiwan vpu...	40	8.2
135	gb|AY736838.1| HIV-1 isolate 90TH_CM240 from Thailand envelope g...	40	8.2
136	gb|AY736837.1| HIV-1 isolate 90TH_CM235 from Thailand envelope g...	40	8.2
137	gb|AY713426.1| HIV-1 isolate 96TH_NI1149 from Thailand gag prote...	40	8.2
138	gb|AY713425.1| HIV-1 isolate 90TH_CM244 from Thailand gag protei...	40	8.2
139	gb|AY713424.1| HIV-1 isolate 96TH_M02138 from Thailand gag prote...	40	8.2
140	gb|AY713423.1| HIV-1 isolate 99TH_NI1052 from Thailand gag gene,...	40	8.2
141	gb|AY713422.1| HIV-1 isolate 98TH_NP1251 from Thailand gag prote...	40	8.2
142	gb|AY713420.1| HIV-1 isolate 97TH_NP1525 from Thailand gag prote...	40	8.2
143	gb|AY713419.1| HIV-1 isolate 97TH_NP1695 from Thailand gag prote...	40	8.2
144	gb|AF064699.1|AF064699 HIV-1 isolate BFP90 from Burkina Faso, co...	40	8.2
145	gb|AF316544.1|AF316544 HIV-1 isolate 97CDKP58e from Republic of ...	40	8.2
146	gb|AF362995.1|AF362995 HIV-1 patient NP1623 from Thailand vpu pr...	40	8.2
147	gb|AF362994.1|AF362994 HIV-1 patient NP1623 from Thailand gag pr...	40	8.2
148	gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g...	40	8.2
149	gb|AY444807.1| HIV-1 isolate 98US.MSC1100 from USA gag protein (...	40	8.2
150	gb|AY444805.1| HIV-1 isolate 98US.MSC2008 from USA gag protein (...	40	8.2
151	gb|AY444804.1| HIV-1 isolate 00US.MSC1164 from USA gag protein (...	40	8.2
152	gb|AY444803.1| HIV-1 isolate 98US.MSC1120 from USA gag protein (...	40	8.2
153	gb|AF219268.1|AF219268 HIV-1 isolate FIN9257 from Finland vpu pr...	40	8.2
154	gb|AF219267.1|AF219267 HIV-1 isolate FIN92168 from Finland vpu p...	40	8.2
155	gb|AC021843.6|AC021843 Homo sapiens chromosome 18, clone RP11-71...	40	8.2
156	gb|AF321083.1|AF321083 HIV-1 isolate EFRA from France envelope g...	40	8.2
157	gb|AY588971.1| HIV-1 isolate CU29 from Cuba, complete genome	40	8.2
158	gb|AY588970.1| HIV-1 isolate CU38 from Cuba, complete genome	40	8.2
159	gb|AY894994.1| HIV-1 isolate CU7 from Cuba gag protein (gag) gen...	40	8.2
160	gb|AY894995.1| HIV-1 isolate Cu64 from Cuba gag protein (gag) ge...	40	8.2
161	gb|AY137652.1| HIV-1 isolate CRF01_AE-VPU579 from Taiwan vpu pro...	40	8.2
162	gb|AY137651.1| HIV-1 isolate CRF01_AE-VPU125 from Taiwan vpu pro...	40	8.2
163	gb|AY137650.1| HIV-1 isolate CRF01_AE-VPU432 from Taiwan vpu pro...	40	8.2
164	gb|AY137649.1| HIV-1 isolate CRF01_AE-VPU396 from Taiwan vpu pro...	40	8.2
165	gb|AY137648.1| HIV-1 isolate CRF01_AE-VPU529 from Taiwan vpu pro...	40	8.2
166	gb|AY137647.1| HIV-1 isolate CRF01_AE-VPU141 from Taiwan vpu pro...	40	8.2
167	dbj|AB126864.1| Human immunodeficiency virus 1 vpu pseudogene, c...	40	8.2
168	dbj|AB126861.1| Human immunodeficiency virus 1 proviral vpu gene...	40	8.2
169	dbj|AB126858.1| Human immunodeficiency virus 1 proviral vpu gene...	40	8.2
170	dbj|AB126857.1| Human immunodeficiency virus 1 vpu pseudogene, c...	40	8.2
171	dbj|AB126855.1| Human immunodeficiency virus 1 proviral vpu pseu...	40	8.2
172	dbj|AB126854.1| Human immunodeficiency virus 1 proviral vpu pseu...	40	8.2
173	dbj|AB126852.1| Human immunodeficiency virus 1 proviral vpu gene...	40	8.2
174	gb|AF164485.1|AF164485 HIV-1 isolate 93TH902.1 from Thailand, co...	40	8.2
175	gb|AF259955.1|AF259955 HIV-1 clone pCM235-4 from USA, complete g...	40	8.2
176	gb|AF259954.1|AF259954 HIV-1 clone pCM235-2 from Thailand, compl...	40	8.2
177	gb|AY008718.1| HIV-1 isolate 97CNGX-11F from China, complete genome	40	8.2
178	gb|AY008714.1| HIV-1 isolate 97CNGX-2F from China, complete genome	40	8.2
179	gb|AY217545.1| HIV-1 clone GX-E-14 from China envelope glycoprot...	40	8.2
180	gb|AF209208.1|AF209208 HIV-1 clone TH90160_2 from Thailand envel...	40	8.2
181	gb|AF209205.1|AF209205 HIV-1 clone TH91006_11 from Thailand enve...	40	8.2
182	gb|AF251194.1|AF251194 Simian-Human immunodeficiency virus clone...	40	8.2
183	gb|AC074284.1|AC074284 Arabidopsis thaliana chromosome 1 BAC F13...	40	8.2
184	gb|AY231155.1| HIV-1 isolate PHI355 from France, envelope glycop...	40	8.2
185	gb|AY857175.2| HIV-1 isolate 9420758 from Australia, partial genome	40	8.2
186	gb|AY857106.2| HIV-1 isolate 6830558 from Australia, partial genome	40	8.2
187	gb|AY857093.2| HIV-1 isolate 6357992 from Australia, partial genome	40	8.2
188	gb|AY857084.2| HIV-1 isolate 5920087 from Australia, partial genome	40	8.2
189	gb|AY857035.2| HIV-1 isolate 3860557 from Australia, partial genome	40	8.2
190	gb|AY856999.2| HIV-1 isolate 2126302 from Australia, partial genome	40	8.2
191	gb|AF220485.1|AF220485 HIV-1 TWE58 from Taiwan Vpu gene, complet...	40	8.2
192	gb|AF220484.1|AF220484 HIV-1 TWE57 from Taiwan Vpu gene, complet...	40	8.2
193	gb|AF220483.1|AF220483 HIV-1 TWE31 from Taiwan Vpu gene, complet...	40	8.2
194	gb|AF220482.1|AF220482 HIV-1 TWE30 from Taiwan Vpu gene, complet...	40	8.2
195	gb|AF220481.1|AF220481 HIV-1 TWE23 from Taiwan Vpu gene, complet...	40	8.2
196	gb|AF220478.1|AF220478 HIV-1 TWE6 from Taiwan Vpu gene, complete...	40	8.2
197	gb|AF220477.1|AF220477 HIV-1 TWE5 from Taiwan Vpu gene, complete...	40	8.2
198	gb|AF220476.1|AF220476 HIV-1 TWE2 from Taiwan Vpu gene, complete...	40	8.2
199	gb|AF143902.1|AF143902 HIV-1 isolate TWA2 from Taiwan vpu protei...	40	8.2
200	emb|AJ389740.1|HIM389740 Human immunodeficiency virus type 1 par...	40	8.2
201	dbj|AP002064.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	40	8.2
202	gb|AF516184.1| HIV-1 isolate CRF01_AE/B from Thailand gag protei...	40	8.2
203	gb|AF209209.1|AF209209 HIV-1 clone TH90160_6 from Thailand envel...	40	8.2
204	gb|AF209207.1|AF209207 HIV-1 clone TH90160_17 from Thailand enve...	40	8.2
205	gb|AF209206.1|AF209206 HIV-1 clone TH90160_11 from Thailand enve...	40	8.2
206	gb|AF084936.1|AF084936 HIV-1 subtype G from Democratic Republic ...	40	8.2
207	gb|AF069934.1|AF069934 HIV-1 isolate NG3670 from Nigeria, envelo...	40	8.2
208	gb|AY812751.1| HIV-1 isolate EST2001-163 from Estonia envelope g...	40	8.2
209	gb|AY494968.1| HIV-1 isolate C2-92TH001 from Thailand envelope g...	40	8.2
210	gb|AY494967.1| HIV-1 isolate C2-CMU02 from Thailand envelope gly...	40	8.2
211	gb|U88825.1|U88825 HIV-1 isolate 92NG003 from Nigeria complete g...	40	8.2
212	dbj|AB089262.1| Human immunodeficiency virus 1 proviral gene for...	40	8.2
213	dbj|AB089260.1| Human immunodeficiency virus 1 proviral gene for...	40	8.2
214	dbj|AB089259.1| Human immunodeficiency virus 1 proviral gene for...	40	8.2
215	gb|AF049337.1|AF049337 HIV-1 clone 94CY032-3 from Cyprus, comple...	40	8.2
216	gb|AF056186.1|AF056186 HIV-1 isolate CNG30.5 from the Congo, int...	40	8.2
217	gb|AF056185.1|AF056185 HIV-1 isolate GH8.2 from Ghana, integrase...	40	8.2
218	gb|U54771.1|HIVU54771 Human immunodeficiency virus type 1, strai...	40	8.2
219	gb|AE000520.1| Treponema pallidum subsp. pallidum str. Nichols c...	40	8.2
220	gb|AF061642.1|AF061642 HIV-1 isolate SE6165 from Sweden, complet...	40	8.2
221	gb|AF061641.1|AF061641 HIV-1 isolate HH8793 clone 12.1 from Finl...	40	8.2
222	gb|AF061640.1|AF061640 HIV-1 isolate HH8793 clone 1.1 from Finla...	40	8.2
223	gb|AF015921.1|AF015921 HIV-1 patient E11429 clone A3-3 from Thai...	40	8.2
224	gb|AF015920.1|AF015920 HIV-1 patient E11429 clone A3-2 from Thai...	40	8.2
225	gb|AF015919.1|AF015919 HIV-1 patient E11429 clone A3-1 from Thai...	40	8.2
226	gb|AF015918.1|AF015918 HIV-1 patient A01021 clone A8-3 from Thai...	40	8.2
227	gb|AF015917.1|AF015917 HIV-1 patient A01021 clone A8-2 from Thai...	40	8.2
228	gb|AF015916.1|AF015916 HIV-1 patient A01021 clone A8-1 from Thai...	40	8.2
229	dbj|AB052995.1| Human immunodeficiency virus 1 subtype E, comple...	40	8.2
230	dbj|AB032741.1| Human immunodeficiency virus 1 proviral DNA, com...	40	8.2
231	dbj|AB032740.1| Human immunodeficiency virus 1 proviral DNA, com...	40	8.2
232	dbj|AB097872.1| Human immunodeficiency virus 1 proviral DNA, com...	40	8.2
233	dbj|AB097868.1| Human immunodeficiency virus 1 proviral DNA, com...	40	8.2
234	dbj|AB097866.1| Human immunodeficiency virus 1 proviral DNA, nea...	40	8.2
235	gb|M15896.1|HIVZ321 Human immunodeficiency virus type 1, Zaire H...	40	8.2
236	gb|U39261.1|HIV1U39261 Human immunodeficiency virus type 1 isola...	40	8.2
237	gb|U39260.1|HIV1U39260 Human immunodeficiency virus type 1 isola...	40	8.2
238	gb|U39256.1|HIV1U39256 Human immunodeficiency virus type 1 isola...	40	8.2
239	gb|U39255.1|HIV1U39255 Human immunodeficiency virus type 1 isola...	40	8.2
240	gb|U43170.1|HIVU43170 HIV-1 isolate 4071-TG2, from Central Afric...	40	8.2
241	gb|U27426.1|HIVU27426 HIV-1 clone 92UG975.10 from Uganda, envelo...	40	8.2
242	gb|U48266.1|HIVU48266 Human immunodeficiency virus type 1 clade ...	40	8.2
243	gb|U48264.1|HIVU48264 Human immunodeficiency virus type 1 clade ...	40	8.2
244	gb|U43169.1|HIVU43169 Human immunodeficiency virus type 1, CAR i...	40	8.2
245	gb|U43174.1|HIVU43174 Human immunodeficiency virus type 1, CAR i...	40	8.2
246	gb|U43173.1|HIVU43173 Human immunodeficiency virus type 1, CAR i...	40	8.2
247	gb|U43110.1|HIVU43110 Human immunodeficiency virus type 1, CAR i...	40	8.2
248	gb|L03703.1|HIVTN2432 Human immunodeficiency virus type 1 (CM243...	40	8.2
249	gb|L22953.1|HIV1VI525A Human immunodeficiency virus type 1 (VI52...	40	8.2
250	gb|U09665.1|HIV1U09665 Human immunodeficiency virus type 1, isol...	40	8.2
251	gb|L14572.1|HIV1CM240X Human immunodeficiency virus type 1 (CM24...	40	8.2
252	gb|L14571.1|HIV1CM238X Human immunodeficiency virus type 1 (CM23...	40	8.2
253	dbj|AB043904.1| Human immunodeficiency virus type 1 vif, vpr, ta...	40	8.2
254	dbj|AB026050.1| Human immunodeficiency virus type 1 gene for env...	40	8.2
255	dbj|AB000617.1| Bacillus subtilis genomic DNA, 22 to 25 degree r...	40	8.2

---

>ref|XM_463925.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2283

 Score =  238 bits (120), Expect = 2e-59
 Identities = 302/363 (83%)
 Strand = Plus / Minus

                                                                        
Query: 242  acgacttgaggactgcgccttcggttatcttccaccctcctggtccggtgaaggccatct 301
            |||||||||||||||| ||||| |||||||||||||||||| |   || |||||||||||
Sbjct: 2281 acgacttgaggactgctccttccgttatcttccaccctcctagcttggagaaggccatct 2222

                                                                        
Query: 302  cgtaccgggtggtgtacttagtgtcgtacaaatcatcgttcctggggtcggttgcgtcgg 361
            | |||||||| ||||| || ||||| ||  |||||| ||| ||||| || ||  | || |
Sbjct: 2221 cataccgggtagtgtattttgtgtcatatgaatcattgtttctgggctcagtaacatcag 2162

                                                                        
Query: 362  tgagctgacccgcctcctcaattgtcgcctccacggtcgcccgccgtccgtccagggaga 421
            | || || || ||||| ||||| || |||||||| ||||| || || || || |||||||
Sbjct: 2161 taagttggcctgcctcatcaatcgtagcctccacagtcgctcgtcgaccatctagggaga 2102

                                                                        
Query: 422  cggtgatgctgtcgatcgccacgttgaacagcgtgtagtcccagaaccagcctttgcgct 481
              |||||||| || |||| ||| | | | || || || ||||||||||| || |  ||||
Sbjct: 2101 tagtgatgctatcaatcgtcacatcggatagtgtatactcccagaaccacccatgacgct 2042

                                                                        
Query: 482  caatctctgctgctcggtctgtccataccttcagnatgttgccatcaagaacctcttgca 541
            ||||||| ||||||||||| ||||| ||||| || |||||||||||||||||||||||||
Sbjct: 2041 caatctccgctgctcggtcagtccacacctttagcatgttgccatcaagaacctcttgca 1982

                                                                        
Query: 542  atgatgcaacagaatgatctgatcccaaggccttggatttgatgctctgccacttgcgaa 601
            |||||||||| ||||| |||| |||||||||||| |||||||| ||||||||||||||||
Sbjct: 1981 atgatgcaaccgaatgttctggtcccaaggccttagatttgatactctgccacttgcgaa 1922

               
Query: 602  caa 604
            |||
Sbjct: 1921 caa 1919

---

>tpg|BK000999.1| TPA: TPA_exp: Oryza sativa (indica cultivar-group) plastid division
            protein precursor (Arc6) mRNA, complete cds; nuclear gene
            for chloroplast product
          Length = 2283

 Score =  238 bits (120), Expect = 2e-59
 Identities = 302/363 (83%)
 Strand = Plus / Minus

                                                                        
Query: 242  acgacttgaggactgcgccttcggttatcttccaccctcctggtccggtgaaggccatct 301
            |||||||||||||||| ||||| |||||||||||||||||| |   || |||||||||||
Sbjct: 2281 acgacttgaggactgctccttccgttatcttccaccctcctagcttggagaaggccatct 2222

                                                                        
Query: 302  cgtaccgggtggtgtacttagtgtcgtacaaatcatcgttcctggggtcggttgcgtcgg 361
            | |||||||| ||||| || ||||| ||  |||||| ||| ||||| || ||  | || |
Sbjct: 2221 cataccgggtagtgtattttgtgtcatatgaatcattgtttctgggctcagtaacatcag 2162

                                                                        
Query: 362  tgagctgacccgcctcctcaattgtcgcctccacggtcgcccgccgtccgtccagggaga 421
            | || || || ||||| ||||| || |||||||| ||||| || || || || |||||||
Sbjct: 2161 taagttggcctgcctcatcaatcgtagcctccacagtcgctcgtcgaccatctagggaga 2102

                                                                        
Query: 422  cggtgatgctgtcgatcgccacgttgaacagcgtgtagtcccagaaccagcctttgcgct 481
              |||||||| || |||| ||| | | | || || || ||||||||||| || |  ||||
Sbjct: 2101 tagtgatgctatcaatcgtcacatcggatagtgtatactcccagaaccacccatgacgct 2042

                                                                        
Query: 482  caatctctgctgctcggtctgtccataccttcagnatgttgccatcaagaacctcttgca 541
            ||||||| ||||||||||| ||||| ||||| || |||||||||||||||||||||||||
Sbjct: 2041 caatctccgctgctcggtcagtccacacctttagcatgttgccatcaagaacctcttgca 1982

                                                                        
Query: 542  atgatgcaacagaatgatctgatcccaaggccttggatttgatgctctgccacttgcgaa 601
            |||||||||| ||||| |||| |||||||||||| |||||||| ||||||||||||||||
Sbjct: 1981 atgatgcaaccgaatgttctggtcccaaggccttagatttgatactctgccacttgcgaa 1922

               
Query: 602  caa 604
            |||
Sbjct: 1921 caa 1919

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  141 bits (71), Expect = 3e-30
 Identities = 238/294 (80%)
 Strand = Plus / Plus

                                                                           
Query: 242     acgacttgaggactgcgccttcggttatcttccaccctcctggtccggtgaaggccatct 301
               |||||||||||||||| ||||| |||||||||||||||||| |   || |||||||||||
Sbjct: 1179097 acgacttgaggactgctccttccgttatcttccaccctcctagcttggagaaggccatct 1179156

                                                                           
Query: 302     cgtaccgggtggtgtacttagtgtcgtacaaatcatcgttcctggggtcggttgcgtcgg 361
               | |||||||| ||||| || ||||| ||  |||||| ||| ||||| || ||  | || |
Sbjct: 1179157 cataccgggtagtgtattttgtgtcatatgaatcattgtttctgggctcagtaacatcag 1179216

                                                                           
Query: 362     tgagctgacccgcctcctcaattgtcgcctccacggtcgcccgccgtccgtccagggaga 421
               | || || || ||||| ||||| || |||||||| ||||| || || || || |||||||
Sbjct: 1179217 taagttggcctgcctcatcaatcgtagcctccacagtcgctcgtcgaccatctagggaga 1179276

                                                                           
Query: 422     cggtgatgctgtcgatcgccacgttgaacagcgtgtagtcccagaaccagcctttgcgct 481
                 |||||||| || |||| ||| | | | || || || ||||||||||| || |  ||||
Sbjct: 1179277 tagtgatgctatcaatcgtcacatcggatagtgtatactcccagaaccacccatgacgct 1179336

                                                                     
Query: 482     caatctctgctgctcggtctgtccataccttcagnatgttgccatcaagaacct 535
               ||||||| ||||||||||| ||||| ||||| || |||||||||||||||||||
Sbjct: 1179337 caatctccgctgctcggtcagtccacacctttagcatgttgccatcaagaacct 1179390



 Score =  105 bits (53), Expect = 2e-19
 Identities = 68/73 (93%)
 Strand = Plus / Plus

                                                                           
Query: 532     acctcttgcaatgatgcaacagaatgatctgatcccaaggccttggatttgatgctctgc 591
               |||||||||||||||||||| ||||| |||| |||||||||||| |||||||| ||||||
Sbjct: 1179666 acctcttgcaatgatgcaaccgaatgttctggtcccaaggccttagatttgatactctgc 1179725

                            
Query: 592     cacttgcgaacaa 604
               |||||||||||||
Sbjct: 1179726 cacttgcgaacaa 1179738

---

>dbj|AP004885.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0575F10
          Length = 150462

 Score =  141 bits (71), Expect = 3e-30
 Identities = 238/294 (80%)
 Strand = Plus / Plus

                                                                         
Query: 242   acgacttgaggactgcgccttcggttatcttccaccctcctggtccggtgaaggccatct 301
             |||||||||||||||| ||||| |||||||||||||||||| |   || |||||||||||
Sbjct: 10188 acgacttgaggactgctccttccgttatcttccaccctcctagcttggagaaggccatct 10247

                                                                         
Query: 302   cgtaccgggtggtgtacttagtgtcgtacaaatcatcgttcctggggtcggttgcgtcgg 361
             | |||||||| ||||| || ||||| ||  |||||| ||| ||||| || ||  | || |
Sbjct: 10248 cataccgggtagtgtattttgtgtcatatgaatcattgtttctgggctcagtaacatcag 10307

                                                                         
Query: 362   tgagctgacccgcctcctcaattgtcgcctccacggtcgcccgccgtccgtccagggaga 421
             | || || || ||||| ||||| || |||||||| ||||| || || || || |||||||
Sbjct: 10308 taagttggcctgcctcatcaatcgtagcctccacagtcgctcgtcgaccatctagggaga 10367

                                                                         
Query: 422   cggtgatgctgtcgatcgccacgttgaacagcgtgtagtcccagaaccagcctttgcgct 481
               |||||||| || |||| ||| | | | || || || ||||||||||| || |  ||||
Sbjct: 10368 tagtgatgctatcaatcgtcacatcggatagtgtatactcccagaaccacccatgacgct 10427

                                                                   
Query: 482   caatctctgctgctcggtctgtccataccttcagnatgttgccatcaagaacct 535
             ||||||| ||||||||||| ||||| ||||| || |||||||||||||||||||
Sbjct: 10428 caatctccgctgctcggtcagtccacacctttagcatgttgccatcaagaacct 10481



 Score =  105 bits (53), Expect = 2e-19
 Identities = 68/73 (93%)
 Strand = Plus / Plus

                                                                         
Query: 532   acctcttgcaatgatgcaacagaatgatctgatcccaaggccttggatttgatgctctgc 591
             |||||||||||||||||||| ||||| |||| |||||||||||| |||||||| ||||||
Sbjct: 10757 acctcttgcaatgatgcaaccgaatgttctggtcccaaggccttagatttgatactctgc 10816

                          
Query: 592   cacttgcgaacaa 604
             |||||||||||||
Sbjct: 10817 cacttgcgaacaa 10829

---

>gb|AC127367.4| Mus musculus BAC clone RP23-19G15 from chromosome 9, complete sequence
          Length = 176541

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 569    aggccttggatttgatgctctg 590
              ||||||||||||||||||||||
Sbjct: 133403 aggccttggatttgatgctctg 133424

---

>gb|AC123815.3| Mus musculus BAC clone RP24-238O19 from chromosome 9, complete sequence
          Length = 136592

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 569   aggccttggatttgatgctctg 590
             ||||||||||||||||||||||
Sbjct: 24099 aggccttggatttgatgctctg 24120

---

>ref|XR_002568.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC384831), mRNA
          Length = 1002

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 518 tgttgccatcaagaacctctt 538
           |||||||||||||||||||||
Sbjct: 90  tgttgccatcaagaacctctt 110

---

>gb|AC107030.3| Homo sapiens 3 BAC RP11-603J22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 171343

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 571   gccttggatttgatgctctgc 591
             |||||||||||||||||||||
Sbjct: 88359 gccttggatttgatgctctgc 88339

---

>gb|AC129951.9| Mus musculus chromosome 15, clone RP23-127B14, complete sequence
          Length = 211987

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 573   cttggatttgatgctctgccacttg 597
             ||||||||| |||||||||||||||
Sbjct: 81911 cttggatttcatgctctgccacttg 81887

---

>gb|AC151476.1| Mus musculus BAC clone RP23-287H13 from 8, complete sequence
          Length = 155220

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 518   tgttgccatcaagaacctctt 538
             |||||||||||||||||||||
Sbjct: 12031 tgttgccatcaagaacctctt 12051

---

>gb|DQ234790.1| HIV-1 isolate HK001 from Hong Kong, complete genome
          Length = 9056

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5673 ttatcaccaacccaaggatc 5654

---

>gb|AY669779.1| HIV-1 isolate CMU02 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2594

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>gb|AY669778.1| HIV-1 isolate 92TH022 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY669776.1| HIV-1 isolate 92TH006 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2562

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY669775.1| HIV-1 isolate 92TH021 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY669774.1| HIV-1 isolate 92TH024 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2568

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY669772.1| HIV-1 isolate 92TH019 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2589

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY669771.1| HIV-1 isolate CMU06 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2571

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY669770.1| HIV-1 isolate 92TH001 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|DQ168576.1| HIV-1 isolate 01NGPL0669 from Nigeria gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8837

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5514 ttatcaccaacccaaggatc 5495

---

>gb|U51188.1|HIVU51188 HIV-1 clone 90cf402 from the Central African Republic, complete
            genome
          Length = 9843

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6339 ttatcaccaacccaaggatc 6320

---

>gb|U51189.1|HIVU51189 HIV-1 clone 93th253 from Thailand, complete genome
          Length = 9720

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6290 ttatcaccaacccaaggatc 6271

---

>gb|AY650001.1| Eucommia ulmoides isolate L45 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 25S ribosomal RNA gene, partial sequence
          Length = 675

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 394 acggtcgcccgccgtccgtc 413
           ||||||||||||||||||||
Sbjct: 115 acggtcgcccgccgtccgtc 96

---

>gb|AY649997.1| Eucommia ulmoides isolate L23 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 25S ribosomal RNA gene, partial sequence
          Length = 675

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 394 acggtcgcccgccgtccgtc 413
           ||||||||||||||||||||
Sbjct: 115 acggtcgcccgccgtccgtc 96

---

>gb|AY371166.1| HIV-1 isolate 01CM.0989MO from Cameroon gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8428

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5511 ttatcaccaacccaaggatc 5492

---

>gb|AY371165.1| HIV-1 isolate 02CM.1867LE from Cameroon gag protein (gag) and pol
            protein (pol) genes, partial cds; nonfunctional vif
            protein (vif) gene, complete sequence; vpr protein (vpr),
            tat protein (tat), rev protein (rev), vpu protein (vpu),
            and envelope glycoprotein (env) genes, complete cds; and
            nef protein (nef) gene, partial cds
          Length = 8401

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY371121.1| HIV-1 isolate 01CM.4049HAN from Cameroon gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8367

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5510 ttatcaccaacccaaggatc 5491

---

>gb|AY358072.1| HIV-1 02TH.OUR846I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8386

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5514 ttatcaccaacccaaggatc 5495

---

>gb|AY358071.1| HIV-1 01TH.OUR033I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8386

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5508 ttatcaccaacccaaggatc 5489

---

>gb|AY358070.1| HIV-1 02TH.OUR840I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), and vpu
            protein (vpu) genes, complete cds; nonfunctional envelope
            glycoprotein (env) gene, complete sequence; and nef
            protein (nef) gene, partial cds
          Length = 8376

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY358068.1| HIV-1 01TH.OUR788I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8419

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5499 ttatcaccaacccaaggatc 5480

---

>gb|AY358067.1| HIV-1 00TH.OUR721I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8377

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5511 ttatcaccaacccaaggatc 5492

---

>gb|AY358065.1| HIV-1 99TH.OUR008I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8395

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5508 ttatcaccaacccaaggatc 5489

---

>gb|AY358064.1| HIV-1 01TH.OUR830I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8419

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5517 ttatcaccaacccaaggatc 5498

---

>gb|AY358061.1| HIV-1 00TH.OUR746I from Thailand nonfunctional gag protein (gag) and
            nonfunctional pol protein (pol) genes, partial sequence;
            vif protein (vif), vpr protein (vpr), tat protein (tat),
            rev protein (rev), vpu protein (vpu), and env protein
            (env) genes, complete cds; and nef protein (nef) gene,
            partial cds
          Length = 8401

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY358060.1| HIV-1 00TH.OUR724I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8377

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY358056.1| HIV-1 1TH.OUR647I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8401

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5499 ttatcaccaacccaaggatc 5480

---

>gb|AY358052.1| HIV-1 00TH.OUR595I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8413

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5490 ttatcaccaacccaaggatc 5471

---

>gb|AY358051.1| HIV-1 99TH.OUR422I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8365

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY358045.1| HIV-1 99TH.OUR164I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8356

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5493 ttatcaccaacccaaggatc 5474

---

>gb|AY358042.1| HIV-1 99TH.OUR044I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8401

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY358040.1| HIV-1 01TH.OUR609I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8389

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY358038.1| HIV-1 01TH.OUR674I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8365

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5499 ttatcaccaacccaaggatc 5480

---

>gb|AY358036.1| HIV-1 01TH.OUR786I from Thailand gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and env protein (env) genes, complete cds; and nef
            protein (nef) gene, partial cds
          Length = 8363

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5500 ttatcaccaacccaaggatc 5481

---

>gb|AE008919.1| Uncultured proteobacterium BAC EBAC000-65D09 complete sequence
          Length = 86564

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   tggtgtacttagtgtcgtac 330
             ||||||||||||||||||||
Sbjct: 13421 tggtgtacttagtgtcgtac 13402

---

>gb|AY961592.1| HIV-1 isolate ThaiNIH01_C2w from Thailand vpu protein (vpu) gene,
          partial cds; nonfunctional envelope glycoprotein (env)
          gene, complete sequence; rev protein (rev) gene,
          partial cds; and nonfunctional tat protein (tat) gene,
          partial sequence
          Length = 2395

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 79 ttatcaccaacccaaggatc 60

---

>gb|AY961589.1| HIV-1 isolate ThaiNIH01_C1h from Thailand envelope glycoprotein
          (env) gene, complete cds; and vpu protein (vpu), rev
          protein (rev), and tat protein (tat) genes, partial cds
          Length = 2574

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY945734.1| HIV-1 isolate 00TH.R1741 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8395

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5511 ttatcaccaacccaaggatc 5492

---

>gb|AY945733.1| HIV-1 isolate 00TH.C2254_BE from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8380

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY945730.1| HIV-1 isolate 01TH.R2184 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8408

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5503 ttatcaccaacccaaggatc 5484

---

>gb|AY945728.1| HIV-1 isolate 98TH.R1166 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8383

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5493 ttatcaccaacccaaggatc 5474

---

>gb|AY945726.1| HIV-1 isolate 99TH.C4460 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8376

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5483 ttatcaccaacccaaggatc 5464

---

>gb|AY945725.1| HIV-1 isolate 00TH.C4382 from Thailand gag protein (gag) gene,
            partial cds; pol gene, partial sequence; vif protein
            (vif) and vpr protein (vpr) genes, complete cds; tat and
            rev genes, complete sequence; vpu protein (vpu) gene,
            complete cds; env gene, complete sequence; and nef
            protein (nef) gene, partial cds
          Length = 8305

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5438 ttatcaccaacccaaggatc 5419

---

>gb|AY945724.1| HIV-1 isolate 00TH.C4151 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8359

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5493 ttatcaccaacccaaggatc 5474

---

>gb|AY945722.1| HIV-1 isolate 00TH.C4118 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8416

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5535 ttatcaccaacccaaggatc 5516

---

>gb|AY945720.1| HIV-1 isolate 01TH.C3256 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8374

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY945718.1| HIV-1 isolate 99TH.C2405 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8359

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5496 ttatcaccaacccaaggatc 5477

---

>gb|AY945717.1| HIV-1 isolate 00TH.C2257 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8398

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY945712.1| HIV-1 isolate 99TH.C1080 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8392

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5493 ttatcaccaacccaaggatc 5474

---

>gb|AC132256.3| Mus musculus BAC clone RP24-358I7 from chromosome 8, complete sequence
          Length = 163897

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 565    cccaaggccttggatttgat 584
              ||||||||||||||||||||
Sbjct: 139999 cccaaggccttggatttgat 140018

---

>gb|AF411964.1| HIV-1 isolate 99ZACM4 from South Africa, complete genome
          Length = 9764

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6311 ttatcaccaacccaaggatc 6292

---

>gb|AC127369.4| Mus musculus BAC clone RP23-26A15 from 8, complete sequence
          Length = 211411

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 565    cccaaggccttggatttgat 584
              ||||||||||||||||||||
Sbjct: 204847 cccaaggccttggatttgat 204828

---

>gb|AC115120.4| Mus musculus BAC clone RP23-116M23 from 16, complete sequence
          Length = 222066

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 109    ctgactaactgactaaccaa 128
              ||||||||||||||||||||
Sbjct: 122659 ctgactaactgactaaccaa 122678

---

>gb|AF457062.1| HIV-1 isolate 99KE_KNH1043 from Kenya, partial genome
          Length = 8820

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5505 ttatcaccaacccaaggatc 5486

---

>gb|AF070713.1| HIV-1 isolate NI1157 from Thailand, envelope glycoprotein (env)
          gene, complete cds
          Length = 2550

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF070711.1| HIV-1 isolate NI1155 from Thailand, envelope glycoprotein (env)
          gene, complete cds
          Length = 2568

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF070710.1| HIV-1 isolate NI1154 from Thailand, envelope glycoprotein (env)
          gene, complete cds
          Length = 2571

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF070709.1| HIV-1 isolate NI1152 from Thailand, envelope glycoprotein (env)
          gene, complete cds
          Length = 2571

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF070705.1| HIV-1 isolate NI1146 from Thailand, envelope glycoprotein (env)
          gene, complete cds
          Length = 2553

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF070703.1| HIV-1 isolate NI1144 from Thailand, envelope glycoprotein (env)
          gene, complete cds
          Length = 2589

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF070707.1| HIV-1 isolate NI1149 from Thailand, envelope glycoprotein (env)
          pseudogene, partial sequence
          Length = 2561

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY082968.1| HIV-1 isolate TH 13-26 from Thailand, complete genome
          Length = 8797

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5513 ttatcaccaacccaaggatc 5494

---

>gb|AY535660.1| HIV-1 isolate EE0369 from Estonia, complete genome
          Length = 9229

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5944 ttatcaccaacccaaggatc 5925

---

>gb|AY535659.1| HIV-1 isolate EE0359 from Estonia, complete genome
          Length = 9262

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5965 ttatcaccaacccaaggatc 5946

---

>gb|AF490974.1| HIV-1 strain TH 9-95 from Thailand, complete genome
          Length = 8815

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5520 ttatcaccaacccaaggatc 5501

---

>gb|AF490973.1| HIV-1 strain 12-69 from Thailand, complete genome
          Length = 8814

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5517 ttatcaccaacccaaggatc 5498

---

>gb|AF468970.1| HIV-1 strain TH 2-83 from Thailand, complete genome
          Length = 8820

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5514 ttatcaccaacccaaggatc 5495

---

>gb|AF530576.1| HIV-1 isolate 99TH.R2399 subtype CRF15_01B from Thailand, complete
            genome
          Length = 9017

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5676 ttatcaccaacccaaggatc 5657

---

>gb|AF529572.1| HIV-1 isolate 02TH.OUR1331 subtype CRF15_01B from Thailand, complete
            genome
          Length = 8842

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5535 ttatcaccaacccaaggatc 5516

---

>gb|AF197341.1| HIV-1 isolate 90CF4071 from Central African Republic, complete genome
          Length = 9597

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6235 ttatcaccaacccaaggatc 6216

---

>gb|AF197340.1| HIV-1 isolate 90CF11697 from Central African Republic, complete
            genome
          Length = 9628

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6252 ttatcaccaacccaaggatc 6233

---

>gb|AF197339.1| HIV-1 isolate 93TH065 from Thailand, complete genome
          Length = 9612

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6246 ttatcaccaacccaaggatc 6227

---

>gb|AF197338.1| HIV-1 isolate 93TH057 from Thailand, complete genome
          Length = 9645

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6256 ttatcaccaacccaaggatc 6237

---

>emb|Z99105.2|BSUB0002 Bacillus subtilis complete genome (section 2 of 21): from 213031 to
              415798
          Length = 202768

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 420    gacggtgatgctgtcgatcg 439
              ||||||||||||||||||||
Sbjct: 104894 gacggtgatgctgtcgatcg 104913

---

>gb|U08458.1|HIV1U08458 HIV-1 isolate 976 clone 17 from Thailand, envelope glycoprotein
          (env) gene, partial cds
          Length = 2833

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>gb|U08457.1|HIV1U08457 HIV-1 isolate 975 clone 15 from Thailand, envelope glycoprotein
          (env) gene, partial cds
          Length = 2830

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>gb|U08456.1|HIV1U08456 HIV-1 isolate 966 clone 8 from Thailand, envelope glycoprotein
          (env) gene, partial cds
          Length = 2836

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>gb|AF423755.1| HIV-1 isolate X254 from Spain, complete genome
          Length = 8963

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5755 ttatcaccaacccaaggatc 5736

---

>gb|AF423760.1| HIV-1 isolate X558 from Spain, complete genome
          Length = 8950

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5747 ttatcaccaacccaaggatc 5728

---

>gb|AF423759.1| HIV-1 isolate X477 from Spain, complete genome
          Length = 8901

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5750 ttatcaccaacccaaggatc 5731

---

>gb|AF423758.1| HIV-1 isolate X475 from Spain, complete genome
          Length = 8945

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5747 ttatcaccaacccaaggatc 5728

---

>gb|AF423757.1| HIV-1 isolate X421 from Spain, complete genome
          Length = 8980

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5747 ttatcaccaacccaaggatc 5728

---

>gb|AF423756.1| HIV-1 isolate X397 from Spain, complete genome
          Length = 8997

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5750 ttatcaccaacccaaggatc 5731

---

>gb|AF450097.1| HIV-1 isolate X623 from Spain, complete genome
          Length = 8983

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5749 ttatcaccaacccaaggatc 5730

---

>gb|AF450096.1| HIV-1 isolate X605 from Spain, complete genome
          Length = 8989

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5747 ttatcaccaacccaaggatc 5728

---

>emb|AJ630581.1| Human immunodeficiency virus type 1 proviral partial env gene for
          envelope polyprotein gp160, patient 98CG922
          Length = 1713

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>emb|AJ508597.1|HIM508597 Human immunodeficiency virus type 1 complete proviral genome, isolate
            00NE36
          Length = 9730

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6303 ttatcaccaacccaaggatc 6284

---

>emb|AJ508596.1|HIM508596 Human immunodeficiency virus type 1 complete proviral genome, isolate
            00NE95
          Length = 9698

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6334 ttatcaccaacccaaggatc 6315

---

>emb|AJ508595.1|HIM508595 Human immunodeficiency virus type 1 complete proviral genome, isolate
            97NE03
          Length = 9794

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6311 ttatcaccaacccaaggatc 6292

---

>emb|AJ401042.1|HIM401042 Human immunodeficiency virus type 1 proviral partial gp160 gene
          for envelope protein, strain 97DC.KTB22
          Length = 2499

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>emb|AJ288982.1|HIM288982 Human immunodeficiency virus type 1 complete proviral genome, strain
            95ML127 (form Mali)
          Length = 9719

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6326 ttatcaccaacccaaggatc 6307

---

>emb|AJ288981.1|HIM288981 Human immunodeficiency virus type 1 complete proviral genome, strain
            97SE1078 (from Senegal)
          Length = 9808

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6368 ttatcaccaacccaaggatc 6349

---

>emb|AJ277822.1|HIM277822 Human immunodeficiency virus type 1 proviral mRNA for Env
          protein, isolate VI525_1
          Length = 2592

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>emb|AJ276596.1|HIM276596 HIV-1 proviral gag gene, pol gene, vif gene, vpr gene, vpu gene, env
            gene, nef gene, tat gene and rev gene, isolate VI1197,
            genomic RNA
          Length = 8914

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5615 ttatcaccaacccaaggatc 5596

---

>gb|AF460974.1| HIV-1 isolate 96CM-4164 from Cameroon, complete genome
          Length = 8854

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5713 ttatcaccaacccaaggatc 5694

---

>gb|AF460972.1| HIV-1 isolate 96CM-1849 from Cameroon, complete genome
          Length = 8916

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5713 ttatcaccaacccaaggatc 5694

---

>gb|AY125894.1| HIV-1 isolate 97TH6-107 from Thailand, complete genome
          Length = 8832

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5503 ttatcaccaacccaaggatc 5484

---

>gb|AY586548.1| HIV-1 isolate Cu85 from Cuba, complete genome
          Length = 9093

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5885 ttatcaccaacccaaggatc 5866

---

>gb|U08811.1|HIV1U08811 HIV-1 sample 011 clone 05 from Thailand (E2TH011W.01052rED),
          envelope glycoprotein (env) gene, partial cds
          Length = 1536

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U08810.1|HIV1U08810 HIV-1 sample 006 clone 05 from Thailand (E2TH006W.01053hED),
          envelope glycoprotein (env) gene, partial cds
          Length = 2346

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>gb|U09131.1|HIV1U09131 HIV-1 clone TH022.44 from Thailand, envelope glycoprotein (env)
          gene, complete cds and nef protein gene, partial cds
          Length = 2830

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>gb|AC097516.2| Homo sapiens BAC clone RP11-468A23 from 4, complete sequence
          Length = 159064

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    tttacacaccagaaaaacac 195
              ||||||||||||||||||||
Sbjct: 135384 tttacacaccagaaaaacac 135403

---

>gb|AF127550.2| HIV-1 strain 97CG276 from Republic of the Congo tat gene, partial
           sequence; protein (tat) gene, partial cds, alternatively
           spliced; vpu protein (vpu) gene, complete cds; and
           envelope glycoprotein (env) gene, partial cds
          Length = 352

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 320 ttatcaccaacccaaggatc 301

---

>gb|AF127548.2| HIV-1 strain 96CG34 from Republic of the Congo tat gene, partial
           sequence; protein (tat) gene, partial cds, alternatively
           spliced; vpu protein (vpu) gene, complete cds; and
           envelope glycoprotein (env) gene, partial cds
          Length = 356

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AF127547.2| HIV-1 strain 96CG21 from Republic of the Congo tat gene, partial
           sequence; protein (tat) gene, partial cds, alternatively
           spliced; vpu protein (vpu) gene, complete cds; and
           envelope glycoprotein (env) gene, partial cds
          Length = 356

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AF127546.2| HIV-1 strain 96CG17 from Republic of the Congo tat gene, partial
           sequence; protein (tat) gene, partial cds, alternatively
           spliced; vpu protein (vpu) gene, complete cds; and
           envelope glycoprotein (env) gene, partial cds
          Length = 359

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AF127544.2| HIV-1 strain 96CG11 from Republic of the Congo tat gene, partial
           sequence; protein (tat) gene, partial cds, alternatively
           spliced; vpu protein (vpu) gene, complete cds; and
           envelope glycoprotein (env) gene, partial cds
          Length = 360

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 331 ttatcaccaacccaaggatc 312

---

>gb|AF410451.1| HIV-1 isolate 97CG313 from Democratic Republic of the Congo tat
           protein and rev protein genes, partial cds; vpu protein
           gene, complete cds; and envelope glycoprotein gene,
           partial cds
          Length = 362

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 330 ttatcaccaacccaaggatc 311

---

>gb|AF410449.1| HIV-1 isolate 97CG305 from Democratic Republic of the Congo tat
           protein and rev protein genes, partial cds; vpu protein
           gene, complete cds; and envelope glycoprotein gene,
           partial cds
          Length = 350

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 315 ttatcaccaacccaaggatc 296

---

>gb|AF410448.1| HIV-1 isolate 97CG284 from Democratic Republic of the Congo tat
           protein and rev protein genes, partial cds; vpu protein
           gene, complete cds; and envelope glycoprotein gene,
           partial cds
          Length = 359

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AF410446.1| HIV-1 isolate 97CG275 from Democratic Republic of the Congo tat
           protein and rev protein genes, partial cds; vpu protein
           gene, complete cds; and envelope glycoprotein gene,
           partial cds
          Length = 356

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AF410443.1| HIV-1 isolate 96CG30 from Democratic Republic of the Congo tat
           protein and rev protein genes, partial cds; vpu protein
           gene, complete cds; and envelope glycoprotein gene,
           partial cds
          Length = 356

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AF410440.1| HIV-1 isolate 96CG23 from Democratic Republic of the Congo tat
           protein and rev protein genes, partial cds; vpu protein
           gene, complete cds; and envelope glycoprotein gene,
           partial cds
          Length = 359

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AF410439.1| HIV-1 isolate 96CG22 from Democratic Republic of the Congo tat
           protein and rev protein genes, partial cds; vpu protein
           gene, complete cds; and envelope glycoprotein gene,
           partial cds
          Length = 356

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 324 ttatcaccaacccaaggatc 305

---

>gb|AC011260.8| Homo sapiens, clone RP11-1E21, complete sequence
          Length = 168476

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     ttctagcctagcaataatcc 76
              ||||||||||||||||||||
Sbjct: 117510 ttctagcctagcaataatcc 117491

---

>gb|AF377958.1|AF377958 HIV-1 isolate CM52876 from Cameroon gag protein (gag) and pol protein
            (pol) genes, partial cds; and vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds
          Length = 8827

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5514 ttatcaccaacccaaggatc 5495

---

>gb|AF377957.1|AF377957 HIV-1 isolate CM53392 from Cameroon gag protein (gag) and pol protein
            (pol) genes, partial cds; and vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds
          Length = 8896

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5523 ttatcaccaacccaaggatc 5504

---

>gb|AY037285.1|AY037284S2 HIV-1 from Cameroon vpu protein (vpu) and envelope glycoprotein
           (env) genes, complete cds; and tat protein (tat), rev
           protein (rev), and nef protein (nef) genes, partial cds
          Length = 3011

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 305 ttatcaccaacccaaggatc 286

---

>gb|AF387054.1|AF387054 HIV-1 isolate TWE/11013/00 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF387048.1|AF387048 HIV-1 isolate TWE/11073/00 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF387047.1|AF387047 HIV-1 isolate TWE/92612/00 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF387046.1|AF387046 HIV-1 isolate TWE/92612/00 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF387045.1|AF387045 HIV-1 isolate TWE/10172/00 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF387044.1|AF387044 HIV-1 isolate TWE/8266/00 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AY736838.1| HIV-1 isolate 90TH_CM240 from Thailand envelope glycoprotein
          (env) gene, complete cds
          Length = 2574

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY736837.1| HIV-1 isolate 90TH_CM235 from Thailand envelope glycoprotein
          (env) gene, complete cds
          Length = 2580

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY713426.1| HIV-1 isolate 96TH_NI1149 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), and rev protein (rev)
            genes, complete cds; vpu gene, complete sequence; and
            envelope glycoprotein (env) and nef protein (nef) genes,
            complete cds
          Length = 8748

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5493 ttatcaccaacccaaggatc 5474

---

>gb|AY713425.1| HIV-1 isolate 90TH_CM244 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), and rev protein (rev)
            genes, complete cds; vpu gene, complete sequence; and
            envelope glycoprotein (env) and nef protein (nef) genes,
            complete cds
          Length = 8796

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY713424.1| HIV-1 isolate 96TH_M02138 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), and rev protein (rev)
            genes, complete cds; vpu gene, complete sequence; and
            envelope glycoprotein (env) and nef protein (nef) genes,
            complete cds
          Length = 8731

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5467 ttatcaccaacccaaggatc 5448

---

>gb|AY713423.1| HIV-1 isolate 99TH_NI1052 from Thailand gag gene, partial sequence;
            pol protein (pol) gene, partial cds; vif protein (vif)
            gene, complete cds; vpr gene, complete sequence; and tat
            protein (tat), rev protein (rev), vpu protein (vpu),
            envelope glycoprotein (env), and nef protein (nef) genes,
            complete cds
          Length = 8773

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5458 ttatcaccaacccaaggatc 5439

---

>gb|AY713422.1| HIV-1 isolate 98TH_NP1251 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8748

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY713420.1| HIV-1 isolate 97TH_NP1525 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8793

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5493 ttatcaccaacccaaggatc 5474

---

>gb|AY713419.1| HIV-1 isolate 97TH_NP1695 from Thailand gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8784

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5499 ttatcaccaacccaaggatc 5480

---

>gb|AF064699.1|AF064699 HIV-1 isolate BFP90 from Burkina Faso, complete genome
          Length = 9775

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6339 ttatcaccaacccaaggatc 6320

---

>gb|AF316544.1|AF316544 HIV-1 isolate 97CDKP58e from Republic of the Congo, complete genome
          Length = 8843

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5537 ttatcaccaacccaaggatc 5518

---

>gb|AF362995.1|AF362995 HIV-1 patient NP1623 from Thailand vpu protein (vpu) gene, complete
           cds; and nonfunctional envelope glycoprotein (env) gene,
           complete sequence
          Length = 2767

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 344 ttatcaccaacccaaggatc 325

---

>gb|AF362994.1|AF362994 HIV-1 patient NP1623 from Thailand gag protein (gag) gene, pol
            protein (pol) gene, vif protein (vif), vpr protein (vpr),
            and tat protein (tat) genes, complete cds; nonfunctional
            rev protein (rev) gene, complete sequence; vpu protein
            (vpu) gene, complete cds; and nonfunctional envelope
            glycoprotein (env) and nonfunctional nef protein (nef)
            genes, complete sequence
          Length = 8860

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5531 ttatcaccaacccaaggatc 5512

---

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 428    tgctgtcgatcgccacgttgaaca 451
              ||||||||||||||| ||||||||
Sbjct: 394973 tgctgtcgatcgccaagttgaaca 394950

---

>gb|AY444807.1| HIV-1 isolate 98US.MSC1100 from USA gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), and vpu
            protein (vpu) genes, complete cds; env gene, complete
            sequence; and nef protein (nef) gene, partial cds
          Length = 8100

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5232 ttatcaccaacccaaggatc 5213

---

>gb|AY444805.1| HIV-1 isolate 98US.MSC2008 from USA gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and envelope glycoprotein (env) genes, complete
            cds; and nef protein (nef) gene, partial cds
          Length = 8349

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AY444804.1| HIV-1 isolate 00US.MSC1164 from USA gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and envelope glycoprotein (env) genes, complete
            cds; and nef protein (nef) gene, partial cds
          Length = 8395

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5508 ttatcaccaacccaaggatc 5489

---

>gb|AY444803.1| HIV-1 isolate 98US.MSC1120 from USA gag protein (gag) and pol protein
            (pol) genes, partial cds; vif protein (vif), vpr protein
            (vpr), tat protein (tat), rev protein (rev), vpu protein
            (vpu), and envelope glycoprotein (env) genes, complete
            cds; and nef protein (nef) gene, partial cds
          Length = 8398

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5502 ttatcaccaacccaaggatc 5483

---

>gb|AF219268.1|AF219268 HIV-1 isolate FIN9257 from Finland vpu protein (vpu) and envelope
           glycoprotein (env) genes, complete cds; and nef protein
           (nef) gene, partial cds
          Length = 3090

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 345 ttatcaccaacccaaggatc 326

---

>gb|AF219267.1|AF219267 HIV-1 isolate FIN92168 from Finland vpu protein (vpu) and envelope
           glycoprotein (env) genes, complete cds; and nef protein
           (nef) gene, partial cds
          Length = 3084

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 345 ttatcaccaacccaaggatc 326

---

>gb|AC021843.6|AC021843 Homo sapiens chromosome 18, clone RP11-713C1, complete sequence
          Length = 159480

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 57   ttctagcctagcaataatcc 76
            ||||||||||||||||||||
Sbjct: 3563 ttctagcctagcaataatcc 3544

---

>gb|AF321083.1|AF321083 HIV-1 isolate EFRA from France envelope glycoprotein (env) gene,
          complete cds
          Length = 2568

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY588971.1| HIV-1 isolate CU29 from Cuba, complete genome
          Length = 9098

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5925 ttatcaccaacccaaggatc 5906

---

>gb|AY588970.1| HIV-1 isolate CU38 from Cuba, complete genome
          Length = 8693

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5547 ttatcaccaacccaaggatc 5528

---

>gb|AY894994.1| HIV-1 isolate CU7 from Cuba gag protein (gag) gene, complete cds; pol
            protein (pol) gene, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8512

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5525 ttatcaccaacccaaggatc 5506

---

>gb|AY894995.1| HIV-1 isolate Cu64 from Cuba gag protein (gag) gene, complete cds;
            pol protein (pol) gene, partial cds; and vif protein
            (vif), vpr protein (vpr), tat protein (tat), rev protein
            (rev), vpu protein (vpu), envelope glycoprotein (env),
            and nef protein (nef) genes, complete cds
          Length = 8879

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5769 ttatcaccaacccaaggatc 5750

---

>gb|AY137652.1| HIV-1 isolate CRF01_AE-VPU579 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AY137651.1| HIV-1 isolate CRF01_AE-VPU125 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AY137650.1| HIV-1 isolate CRF01_AE-VPU432 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AY137649.1| HIV-1 isolate CRF01_AE-VPU396 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AY137648.1| HIV-1 isolate CRF01_AE-VPU529 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AY137647.1| HIV-1 isolate CRF01_AE-VPU141 from Taiwan vpu protein (vpu) gene,
           complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB126864.1| Human immunodeficiency virus 1 vpu pseudogene, clone:0-92-1-RNA22
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB126861.1| Human immunodeficiency virus 1 proviral vpu gene, complete cds,
           clone:0-92-1
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB126858.1| Human immunodeficiency virus 1 proviral vpu gene, complete cds,
           clone:17-27-1
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB126857.1| Human immunodeficiency virus 1 vpu pseudogene, clone:0-60-8-RNA29
          Length = 245

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 238 ttatcaccaacccaaggatc 219

---

>dbj|AB126855.1| Human immunodeficiency virus 1 proviral vpu pseudogene,
           clone:0-60-8-DNA7
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB126854.1| Human immunodeficiency virus 1 proviral vpu pseudogene,
           clone:0-60-8-DNA5
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB126852.1| Human immunodeficiency virus 1 proviral vpu gene, complete cds,
           clone:0-60-8
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF164485.1|AF164485 HIV-1 isolate 93TH902.1 from Thailand, complete genome
          Length = 9738

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6317 ttatcaccaacccaaggatc 6298

---

>gb|AF259955.1|AF259955 HIV-1 clone pCM235-4 from USA, complete genome
          Length = 9734

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6313 ttatcaccaacccaaggatc 6294

---

>gb|AF259954.1|AF259954 HIV-1 clone pCM235-2 from Thailand, complete genome
          Length = 9734

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6313 ttatcaccaacccaaggatc 6294

---

>gb|AY008718.1| HIV-1 isolate 97CNGX-11F from China, complete genome
          Length = 8806

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5503 ttatcaccaacccaaggatc 5484

---

>gb|AY008714.1| HIV-1 isolate 97CNGX-2F from China, complete genome
          Length = 8859

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5529 ttatcaccaacccaaggatc 5510

---

>gb|AY217545.1| HIV-1 clone GX-E-14 from China envelope glycoprotein (env) gene,
          complete cds
          Length = 2574

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF209208.1|AF209208 HIV-1 clone TH90160_2 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 1530

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF209205.1|AF209205 HIV-1 clone TH91006_11 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF251194.1|AF251194 Simian-Human immunodeficiency virus clone pSHIV-E-CAR tat protein
           (tat), rev protein (rev), and envelope glycoprotein
           (env) genes, complete cds
          Length = 3034

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 507 ttatcaccaacccaaggatc 488

---

>gb|AC074284.1|AC074284 Arabidopsis thaliana chromosome 1 BAC F13E17 genomic sequence, complete
             sequence
          Length = 77290

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 145   aaactgacaagagcctagactaga 168
             |||||||||| |||||||||||||
Sbjct: 26224 aaactgacaacagcctagactaga 26201

---

>gb|AY231155.1| HIV-1 isolate PHI355 from France, envelope glycoprotein (env)
          gene, complete cds
          Length = 2595

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY857175.2| HIV-1 isolate 9420758 from Australia, partial genome
          Length = 7908

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5612 ttatcaccaacccaaggatc 5593

---

>gb|AY857106.2| HIV-1 isolate 6830558 from Australia, partial genome
          Length = 5273

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5015 ttatcaccaacccaaggatc 4996

---

>gb|AY857093.2| HIV-1 isolate 6357992 from Australia, partial genome
          Length = 7372

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5629 ttatcaccaacccaaggatc 5610

---

>gb|AY857084.2| HIV-1 isolate 5920087 from Australia, partial genome
          Length = 7198

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5582 ttatcaccaacccaaggatc 5563

---

>gb|AY857035.2| HIV-1 isolate 3860557 from Australia, partial genome
          Length = 5334

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5076 ttatcaccaacccaaggatc 5057

---

>gb|AY856999.2| HIV-1 isolate 2126302 from Australia, partial genome
          Length = 7415

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5062 ttatcaccaacccaaggatc 5043

---

>gb|AF220485.1|AF220485 HIV-1 TWE58 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF220484.1|AF220484 HIV-1 TWE57 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF220483.1|AF220483 HIV-1 TWE31 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF220482.1|AF220482 HIV-1 TWE30 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF220481.1|AF220481 HIV-1 TWE23 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF220478.1|AF220478 HIV-1 TWE6 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF220477.1|AF220477 HIV-1 TWE5 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF220476.1|AF220476 HIV-1 TWE2 from Taiwan Vpu gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF143902.1|AF143902 HIV-1 isolate TWA2 from Taiwan vpu protein (vpu) gene, complete cds
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>emb|AJ389740.1|HIM389740 Human immunodeficiency virus type 1 partial env gene for exterior
          membrane protein gp120, isolate 96-LCSW189
          Length = 1602

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 50 ttatcaccaacccaaggatc 31

---

>dbj|AP002064.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T26G12
          Length = 84785

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 145   aaactgacaagagcctagactaga 168
             |||||||||| |||||||||||||
Sbjct: 76675 aaactgacaacagcctagactaga 76698

---

>gb|AF516184.1| HIV-1 isolate CRF01_AE/B from Thailand gag protein (gag) gene,
            complete cds; pol protein (pol) gene, partial cds; and
            vif protein (vif), vpr protein (vpr), tat protein (tat),
            rev protein (rev), vpu protein (vpu), envelope
            glycoprotein (env), and nef protein (nef) genes, complete
            cds
          Length = 8999

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5699 ttatcaccaacccaaggatc 5680

---

>gb|AF209209.1|AF209209 HIV-1 clone TH90160_6 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 1530

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF209207.1|AF209207 HIV-1 clone TH90160_17 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 1530

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF209206.1|AF209206 HIV-1 clone TH90160_11 from Thailand envelope glycoprotein (env)
          gene, partial cds
          Length = 1530

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF084936.1|AF084936 HIV-1 subtype G from Democratic Republic of the Congo, complete
            genome
          Length = 9707

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6266 ttatcaccaacccaaggatc 6247

---

>gb|AF069934.1|AF069934 HIV-1 isolate NG3670 from Nigeria, envelope glycoprotein (env)
          gene, complete cds
          Length = 2523

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY812751.1| HIV-1 isolate EST2001-163 from Estonia envelope glycoprotein (env)
           gene, complete cds
          Length = 3011

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 350 ttatcaccaacccaaggatc 331

---

>gb|AY494968.1| HIV-1 isolate C2-92TH001 from Thailand envelope glycoprotein
          (env) gene, complete cds
          Length = 2556

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AY494967.1| HIV-1 isolate C2-CMU02 from Thailand envelope glycoprotein (env)
          gene, complete cds
          Length = 2601

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U88825.1|U88825 HIV-1 isolate 92NG003 from Nigeria complete genome
          Length = 8966

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5647 ttatcaccaacccaaggatc 5628

---

>dbj|AB089262.1| Human immunodeficiency virus 1 proviral gene for vpu protein,
           complete cds, isolate:CU98-31
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB089260.1| Human immunodeficiency virus 1 proviral gene for vpu protein,
           complete cds, isolate:CU98-26
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>dbj|AB089259.1| Human immunodeficiency virus 1 proviral gene for vpu protein,
           complete cds, isolate:CU98-28
          Length = 246

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 239 ttatcaccaacccaaggatc 220

---

>gb|AF049337.1|AF049337 HIV-1 clone 94CY032-3 from Cyprus, complete genome
          Length = 9050

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5673 ttatcaccaacccaaggatc 5654

---

>gb|AF056186.1|AF056186 HIV-1 isolate CNG30.5 from the Congo, integrase (pol) gene, partial
            cds; vif protein (vif) and vpr protein (vpr) genes,
            complete cds; tat protein (tat) and rev protein (rev)
            genes, partial cds; vpu protein (vpu) pseudogene,
            complete sequence; and envelope glycoprotein (env) gene,
            partial cds
          Length = 3217

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 1916 ttatcaccaacccaaggatc 1897

---

>gb|AF056185.1|AF056185 HIV-1 isolate GH8.2 from Ghana, integrase (pol) gene, partial cds;
            vif protein (vif) and vpr protein (vpr) genes, complete
            cds; tat protein (tat) and rev protein (rev) genes,
            partial cds; vpu protein (vpu) gene, complete cds; and
            envelope glycoprotein (env) gene, partial cds
          Length = 3211

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 1916 ttatcaccaacccaaggatc 1897

---

>gb|U54771.1|HIVU54771 Human immunodeficiency virus type 1, strain CM240, complete proviral
            genome
          Length = 9203

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5871 ttatcaccaacccaaggatc 5852

---

>gb|AE000520.1| Treponema pallidum subsp. pallidum str. Nichols complete genome
          Length = 1138011

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 247    ttgaggactgcgccttcggt 266
              ||||||||||||||||||||
Sbjct: 236274 ttgaggactgcgccttcggt 236255

---

>gb|AF061642.1|AF061642 HIV-1 isolate SE6165 from Sweden, complete genome
          Length = 9074

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5706 ttatcaccaacccaaggatc 5687

---

>gb|AF061641.1|AF061641 HIV-1 isolate HH8793 clone 12.1 from Finland, complete genome
          Length = 9047

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5709 ttatcaccaacccaaggatc 5690

---

>gb|AF061640.1|AF061640 HIV-1 isolate HH8793 clone 1.1 from Finland, complete genome
          Length = 9048

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5711 ttatcaccaacccaaggatc 5692

---

>gb|AF015921.1|AF015921 HIV-1 patient E11429 clone A3-3 from Thailand, gp160 (env) gene,
          complete cds
          Length = 2577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF015920.1|AF015920 HIV-1 patient E11429 clone A3-2 from Thailand, gp160 (env) gene,
          complete cds
          Length = 2577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF015919.1|AF015919 HIV-1 patient E11429 clone A3-1 from Thailand, gp160 (env) gene,
          complete cds
          Length = 2577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF015918.1|AF015918 HIV-1 patient A01021 clone A8-3 from Thailand, gp160 (env) gene,
          complete cds
          Length = 2586

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF015917.1|AF015917 HIV-1 patient A01021 clone A8-2 from Thailand, gp160 (env) gene,
          complete cds
          Length = 2589

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|AF015916.1|AF015916 HIV-1 patient A01021 clone A8-1 from Thailand, gp160 (env) gene,
          complete cds
          Length = 2589

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>dbj|AB052995.1| Human immunodeficiency virus 1 subtype E, complete genome,
            isolate:93JP-NH1
          Length = 9720

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6305 ttatcaccaacccaaggatc 6286

---

>dbj|AB032741.1| Human immunodeficiency virus 1 proviral DNA, complete genome,
            isolate: 95TNIH047
          Length = 9430

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6263 ttatcaccaacccaaggatc 6244

---

>dbj|AB032740.1| Human immunodeficiency virus 1 proviral DNA, complete genome,
            isolate: 95TNIH022
          Length = 9427

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6266 ttatcaccaacccaaggatc 6247

---

>dbj|AB097872.1| Human immunodeficiency virus 1 proviral DNA, complete genome,
            isolate:mCSW105
          Length = 9645

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6292 ttatcaccaacccaaggatc 6273

---

>dbj|AB097868.1| Human immunodeficiency virus 1 proviral DNA, complete genome,
            isolate:mIDU107
          Length = 9589

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 6284 ttatcaccaacccaaggatc 6265

---

>dbj|AB097866.1| Human immunodeficiency virus 1 proviral DNA, nearly complete genome,
            isolate:mCSW503
          Length = 8998

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 35   ttatcaccaacccaaggatc 54
            ||||||||||||||||||||
Sbjct: 5605 ttatcaccaacccaaggatc 5586

---

>gb|M15896.1|HIVZ321 Human immunodeficiency virus type 1, Zaire HZ321 isolate, env
          Length = 3457

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 35  ttatcaccaacccaaggatc 54
           ||||||||||||||||||||
Sbjct: 172 ttatcaccaacccaaggatc 153

---

>gb|U39261.1|HIV1U39261 Human immunodeficiency virus type 1 isolate TH/92/11, envelope
          glycoprotein (env) gene, complete cds
          Length = 2586

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U39260.1|HIV1U39260 Human immunodeficiency virus type 1 isolate TH/92/01, envelope
          glycoprotein (env) gene, complete cds
          Length = 2556

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U39256.1|HIV1U39256 Human immunodeficiency virus type 1 isolate TH/92/01, envelope
          glycoprotein (env) gene, complete cds
          Length = 2556

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U39255.1|HIV1U39255 Human immunodeficiency virus type 1 isolate TH/92/11, envelope
          glycoprotein (env) gene, complete cds
          Length = 2586

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U43170.1|HIVU43170 HIV-1 isolate 4071-TG2, from Central African Republic, envelope
          glycoprotein gp120 (env) gene, partial cds
          Length = 1492

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U27426.1|HIVU27426 HIV-1 clone 92UG975.10 from Uganda, envelope glycoprotein (env)
          and nef protein (nef) genes, partial cds
          Length = 2928

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 72 ttatcaccaacccaaggatc 53

---

>gb|U48266.1|HIVU48266 Human immunodeficiency virus type 1 clade E, strain KH08,
          envelope gene, complete cds
          Length = 2604

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U48264.1|HIVU48264 Human immunodeficiency virus type 1 clade E, strain KH03,
          envelope gene, complete cds
          Length = 2577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U43169.1|HIVU43169 Human immunodeficiency virus type 1, CAR isolate 4067, clone 68,
          envelope glycoprotein (env) gene, partial cds
          Length = 1498

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U43174.1|HIVU43174 Human immunodeficiency virus type 1, CAR isolate 4081, envelope
          glycoprotein gp120 (env) gene, partial cds
          Length = 1486

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U43173.1|HIVU43173 Human immunodeficiency virus type 1, CAR isolate MBA, envelope
          glycoprotein gp120 (env) gene, partial cds
          Length = 1471

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U43110.1|HIVU43110 Human immunodeficiency virus type 1, CAR isolate ELO, envelope
          glycoprotein gp120 (env) gene, partial cds
          Length = 1510

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|L03703.1|HIVTN2432 Human immunodeficiency virus type 1 (CM243) envelope glycoprotein
          (env) gene, 5' end
          Length = 2577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|L22953.1|HIV1VI525A Human immunodeficiency virus type 1 (VI525) proviral envelope
          glycoprotein (env) gene
          Length = 2604

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57

---

>gb|U09665.1|HIV1U09665 Human immunodeficiency virus type 1, isolate VI525 from Gabon,
          envelope glycoprotein (env) gene, complete cds
          Length = 2604

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 35 ttatcaccaacccaaggatc 54
          ||||||||||||||||||||
Sbjct: 76 ttatcaccaacccaaggatc 57


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,198,453
Number of Sequences: 3902068
Number of extensions: 4198453
Number of successful extensions: 67660
Number of sequences better than 10.0: 259
Number of HSP's better than 10.0 without gapping: 259
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67319
Number of HSP's gapped (non-prelim): 333
length of query: 604
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 581
effective length of database: 17,143,297,704
effective search space: 9960255966024
effective search space used: 9960255966024
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---