Clone Name	rbags1d10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation fact...	595	e-167
2	ref|NM_186038.2| Oryza sativa (japonica cultivar-group), mRNA	204	2e-49
3	ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group...	204	2e-49
4	dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clon...	204	2e-49
5	dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clon...	204	2e-49
6	dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clon...	204	2e-49
7	dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA...	204	2e-49
8	gb|BT016181.1| Zea mays clone Contig14 mRNA sequence	139	1e-29
9	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	121	2e-24
10	dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic D...	121	2e-24
11	gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence	109	9e-21
12	emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elong...	90	9e-15
13	gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence	74	5e-10
14	gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated...	70	8e-09
15	gb|AY480020.1| Capsicum annuum putative elongation factor 1B alp...	70	8e-09
16	gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulate...	70	8e-09
17	gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongatio...	62	2e-06
18	gb|DQ191626.1| Solanum tuberosum unknown mRNA	62	2e-06
19	dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongatio...	62	2e-06
20	emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5...	62	2e-06
21	gb|BT016424.1| Zea mays clone Contig257 mRNA sequence	60	8e-06
22	gb|BT016185.1| Zea mays clone Contig18 mRNA sequence	60	8e-06
23	ref|NM_121956.2| Arabidopsis thaliana translation elongation fac...	58	3e-05
24	emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongatio...	58	3e-05
25	gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1...	58	3e-05
26	gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1...	58	3e-05
27	emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
28	emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
29	emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
30	emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
31	emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
32	gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete s...	58	3e-05
33	ref|NM_127367.1| Arabidopsis thaliana translation elongation fac...	56	1e-04
34	emb|BX071583.1|CNS09REB Single read from an extremity of a full-...	56	1e-04
35	emb|BX071358.1|CNS09R82 Single read from an extremity of a full-...	56	1e-04
36	emb|BX071357.1|CNS09R81 Single read from an extremity of a full-...	56	1e-04
37	emb|BX068711.1|CNS09P6J Single read from an extremity of a full-...	56	1e-04
38	emb|BX068710.1|CNS09P6I Single read from an extremity of a full-...	56	1e-04
39	emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-...	56	1e-04
40	emb|BX063619.1|CNS09L93 Single read from an extremity of a full-...	56	1e-04
41	emb|BX063618.1|CNS09L92 Single read from an extremity of a full-...	56	1e-04
42	emb|BX063276.1|CNS09KZK Single read from an extremity of a full-...	56	1e-04
43	emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-...	56	1e-04
44	emb|BX053674.1|CNS09DKU Single read from an extremity of a full-...	56	1e-04
45	emb|BX053673.1|CNS09DKT Single read from an extremity of a full-...	56	1e-04
46	emb|BX052417.1|CNS09CLX Single read from an extremity of a full-...	56	1e-04
47	emb|BX052416.1|CNS09CLW Single read from an extremity of a full-...	56	1e-04
48	emb|BX052150.1|CNS09CEI Single read from an extremity of a full-...	56	1e-04
49	emb|BX052149.1|CNS09CEH Single read from an extremity of a full-...	56	1e-04
50	emb|BX052078.1|CNS09CCI Single read from an extremity of a full-...	56	1e-04
51	emb|BX052058.1|CNS09CBY Single read from an extremity of a full-...	56	1e-04
52	emb|BX047220.1|CNS098LK Single read from an extremity of a full-...	56	1e-04
53	emb|BX047219.1|CNS098LJ Single read from an extremity of a full-...	56	1e-04
54	emb|BX046233.1|CNS097U5 Single read from an extremity of a full-...	56	1e-04
55	emb|BX046232.1|CNS097U4 Single read from an extremity of a full-...	56	1e-04
56	emb|BX042348.1|CNS094U8 Single read from an extremity of a full-...	56	1e-04
57	emb|BX042347.1|CNS094U7 Single read from an extremity of a full-...	56	1e-04
58	emb|BX041605.1|CNS0949L Single read from an extremity of a full-...	56	1e-04
59	emb|BX041604.1|CNS0949K Single read from an extremity of a full-...	56	1e-04
60	emb|BX041307.1|CNS0941B Single read from an extremity of a full-...	56	1e-04
61	emb|BX039708.1|CNS092SW Single read from an extremity of a full-...	56	1e-04
62	emb|BX039707.1|CNS092SV Single read from an extremity of a full-...	56	1e-04
63	emb|BX037290.1|CNS090XQ Single read from an extremity of a full-...	56	1e-04
64	emb|BX036523.1|CNS090CF Single read from an extremity of a full-...	56	1e-04
65	emb|BX036522.1|CNS090CE Single read from an extremity of a full-...	56	1e-04
66	emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-...	56	1e-04
67	emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-...	56	1e-04
68	emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-...	56	1e-04
69	emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-...	56	1e-04
70	emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-...	56	1e-04
71	emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-...	56	1e-04
72	emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-...	56	1e-04
73	emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-...	56	1e-04
74	emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-...	56	1e-04
75	emb|BX032179.1|CNS08WZR Single read from an extremity of a full-...	56	1e-04
76	emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-...	56	1e-04
77	emb|BX032163.1|CNS08WZB Single read from an extremity of a full-...	56	1e-04
78	emb|BX029545.1|CNS08UYL Single read from an extremity of a full-...	56	1e-04
79	emb|BX029544.1|CNS08UYK Single read from an extremity of a full-...	56	1e-04
80	emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-...	56	1e-04
81	emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-...	56	1e-04
82	emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-...	56	1e-04
83	emb|BX027135.1|CNS08T3N Single read from an extremity of a full-...	56	1e-04
84	emb|BX027134.1|CNS08T3M Single read from an extremity of a full-...	56	1e-04
85	emb|BX026630.1|CNS08SPM Single read from an extremity of a full-...	56	1e-04
86	emb|BX026629.1|CNS08SPL Single read from an extremity of a full-...	56	1e-04
87	emb|BX026387.1|CNS08SIV Single read from an extremity of a full-...	56	1e-04
88	emb|BX026386.1|CNS08SIU Single read from an extremity of a full-...	56	1e-04
89	emb|BX025444.1|CNS08RSO Single read from an extremity of a full-...	56	1e-04
90	emb|BX025443.1|CNS08RSN Single read from an extremity of a full-...	56	1e-04
91	emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-...	56	1e-04
92	emb|BX024401.1|CNS08QZP Single read from an extremity of a full-...	56	1e-04
93	emb|BX024400.1|CNS08QZO Single read from an extremity of a full-...	56	1e-04
94	emb|BX023680.1|CNS08QFO Single read from an extremity of a full-...	56	1e-04
95	emb|BX023679.1|CNS08QFN Single read from an extremity of a full-...	56	1e-04
96	emb|BX019648.1|CNS08NBO Single read from an extremity of a full-...	56	1e-04
97	emb|BX019647.1|CNS08NBN Single read from an extremity of a full-...	56	1e-04
98	emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-...	56	1e-04
99	emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-...	56	1e-04
100	emb|BX018057.1|CNS08M3H Single read from an extremity of a full-...	56	1e-04
101	emb|BX018056.1|CNS08M3G Single read from an extremity of a full-...	56	1e-04
102	emb|BX016732.1|CNS08L2O Single read from an extremity of a full-...	56	1e-04
103	emb|BX016731.1|CNS08L2N Single read from an extremity of a full-...	56	1e-04
104	emb|BX016339.1|CNS08KRR Single read from an extremity of a full-...	56	1e-04
105	emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-...	56	1e-04
106	emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-...	56	1e-04
107	emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-...	56	1e-04
108	emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-...	56	1e-04
109	emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-...	56	1e-04
110	emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-...	56	1e-04
111	emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-...	56	1e-04
112	emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-...	56	1e-04
113	emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-...	56	1e-04
114	emb|BX010493.1|CNS08G9D Single read from an extremity of a full-...	56	1e-04
115	emb|BX010492.1|CNS08G9C Single read from an extremity of a full-...	56	1e-04
116	emb|BX010211.1|CNS08G1J Single read from an extremity of a full-...	56	1e-04
117	emb|BX010113.1|CNS08FYT Single read from an extremity of a full-...	56	1e-04
118	emb|BX010112.1|CNS08FYS Single read from an extremity of a full-...	56	1e-04
119	emb|BX009646.1|CNS08FLU Single read from an extremity of a full-...	56	1e-04
120	emb|BX008302.1|CNS08EKI Single read from an extremity of a full-...	56	1e-04
121	emb|BX008301.1|CNS08EKH Single read from an extremity of a full-...	56	1e-04
122	gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map...	56	1e-04
123	gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma...	56	1e-04
124	gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1...	56	1e-04
125	gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1...	56	1e-04
126	emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
127	emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
128	emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
129	gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete s...	56	1e-04
130	ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448 ...	56	1e-04
131	gb|DQ191662.1| Solanum tuberosum elongation factor-like protein ...	54	5e-04
132	emb|BX037291.1|CNS090XR Single read from an extremity of a full-...	54	5e-04
133	emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation fa...	54	5e-04
134	gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1	54	5e-04
135	gb|AY111648.1| Zea mays CL2935_1 mRNA sequence	54	5e-04
136	gb|AY103717.1| Zea mays PCO098989 mRNA sequence	54	5e-04
137	ref|NM_102762.2| Arabidopsis thaliana translation elongation fac...	52	0.002
138	ref|XM_479153.1| Oryza sativa (japonica cultivar-group), mRNA	52	0.002
139	ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group...	52	0.002
140	gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi...	52	0.002
141	emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Co...	52	0.002
142	emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Co...	52	0.002
143	emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Co...	52	0.002
144	gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F1...	52	0.002
145	dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D...	52	0.002
146	dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongat...	52	0.002
147	dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
148	dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
149	dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
150	dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mR...	52	0.002
151	ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4...	50	0.007
152	ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD...	50	0.007
153	emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chr...	50	0.007
154	emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor ...	50	0.007
155	gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA...	50	0.007
156	dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534	50	0.007
157	emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library	50	0.007
158	emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library	50	0.007
159	emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library	50	0.007
160	emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library	50	0.007
161	emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library	50	0.007
162	emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library	50	0.007
163	emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library	50	0.007
164	emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library	50	0.007
165	gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA...	50	0.007
166	ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM011...	48	0.029
167	emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-...	48	0.029
168	emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-...	48	0.029
169	emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta	48	0.029
170	gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Can...	48	0.029
171	emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Co...	48	0.029
172	gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosom...	46	0.12
173	gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosom...	46	0.12
174	gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome...	46	0.12
175	gb|AY444796.1| Pisum sativum translational elongation factor 1 s...	46	0.12
176	gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNIN...	46	0.12
177	emb|BX029538.1|CNS08UYE Single read from an extremity of a full-...	46	0.12
178	ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation fa...	46	0.12
179	ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation fa...	46	0.12
180	gb|AY909456.1| Siniperca chuatsi clone C279 translation elongati...	46	0.12
181	gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complet...	46	0.12
182	gb|BC096865.1| Danio rerio cold inducible RNA binding protein, m...	46	0.12
183	ref|XM_532345.2| PREDICTED: Canis familiaris similar to eukaryot...	44	0.46
184	ref|XM_851661.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.46
185	ref|XM_851616.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.46
186	ref|XM_851583.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.46
187	ref|XM_851537.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.46
188	ref|XM_851498.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.46
189	ref|XM_851462.1| PREDICTED: Canis familiaris similar to eukaryot...	44	0.46
190	emb|AL353136.21| Human DNA sequence from clone RP11-133K18 on ch...	44	0.46
191	gb|AY321330.1| Rattus norvegicus Ac2-067 mRNA, complete cds	44	0.46
192	emb|AJ291984.1|PFL291984 Platichthys flesus partial mRNA for tra...	44	0.46
193	emb|AL645962.22| Mouse DNA sequence from clone RP23-217L7 on chr...	44	0.46
194	emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23	44	0.46
195	gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	44	0.46
196	emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7	44	0.46
197	emb|AL116212.1|CNS01D0C Botrytis cinerea strain T4 cDNA library	44	0.46
198	emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Co...	44	0.46
199	emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Co...	44	0.46
200	emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Co...	44	0.46
201	emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Co...	44	0.46
202	emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14	44	0.46
203	ref|XM_342043.2| PREDICTED: Rattus norvegicus similar to eukaryo...	44	0.46
204	ref|NM_210904.1| Eremothecium gossypii AFR003Cp (AFR003C), mRNA	44	0.46
205	gb|AC170424.1| Rhesus Macaque BAC CH250-53N5 (Children's Hospit...	42	1.8
206	ref|XM_524853.1| PREDICTED: Pan troglodytes similar to Elongatio...	42	1.8
207	ref|XM_414267.1| PREDICTED: Gallus gallus similar to ring finger...	42	1.8
208	gb|DQ440296.1| Aedes aegypti clone AET-374 elongation factor 1 b...	42	1.8
209	gb|AY543685.1| Balanus glandula translation elongation factor mR...	42	1.8
210	gb|BC021729.1| Homo sapiens similar to hypothetical protein FLJ2...	42	1.8
211	gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence	42	1.8
212	gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CI...	42	1.8
213	emb|AL731568.7| Human DNA sequence from clone RP11-367B6 on chro...	42	1.8
214	emb|AL590229.3| Human DNA sequence from clone RP11-192B18 on chr...	42	1.8
215	emb|AL512627.6| Human DNA sequence from clone RP11-21A16 on chro...	42	1.8
216	emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on ch...	42	1.8
217	gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome	42	1.8
218	emb|CR354438.9| Zebrafish DNA sequence from clone CH211-243G16 i...	42	1.8
219	emb|AL833768.1|HSM805081 Homo sapiens mRNA; cDNA DKFZp666K117 (f...	42	1.8
220	gb|AC022098.9| Homo sapiens chromosome 19 clone CTB-55O6, comple...	42	1.8
221	gb|AC099507.3| Homo sapiens chromosome 5 clone RP11-24H18, compl...	42	1.8
222	gb|AC087490.6| Homo sapiens chromosome 15, clone RP11-810H22, co...	42	1.8
223	gb|AC103750.2| Homo sapiens chromosome 15, clone RP11-494F2, com...	42	1.8
224	gb|AC010362.6| Homo sapiens chromosome 5 clone CTD-2037I18, comp...	42	1.8
225	gb|AC098976.2| Homo sapiens BAC clone RP11-751L19 from 4, comple...	42	1.8
226	ref|XM_944722.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.8
227	ref|XM_944719.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.8
228	ref|XM_944718.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.8
229	ref|XM_940654.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.8
230	ref|XM_934766.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.8
231	ref|XM_934764.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.8
232	ref|XM_934762.1| PREDICTED: Homo sapiens similar to Elongation f...	42	1.8
233	ref|XM_058967.12| PREDICTED: Homo sapiens similar to Elongation ...	42	1.8
234	ref|XM_695588.1| PREDICTED: Danio rerio similar to Elongation fa...	42	1.8
235	gb|AC009075.7| Homo sapiens chromosome 16 clone RP11-328J14, com...	42	1.8
236	dbj|AB169168.1| Macaca fascicularis testis cDNA, clone: QtsA-177...	42	1.8
237	dbj|AB179332.1| Macaca fascicularis testis cDNA clone: QtsA-1773...	42	1.8
238	gb|AC010429.6|AC010429 Homo sapiens chromosome 5 clone CTD-2199L...	42	1.8
239	gb|AC008220.5|AC008220 Drosophila melanogaster, chromosome 3R, r...	42	1.8
240	gb|AC007975.7|AC007975 Drosophila melanogaster, chromosome 3R, r...	42	1.8
241	ref|NM_145293.2| Homo sapiens similar to hypothetical protein FL...	42	1.8
242	dbj|BS000210.2| Pan troglodytes chromosome 22 clone:RP43-018H16,...	42	1.8
243	emb|AL590078.2|HS381K22 Homo sapiens chromosome 9 BAC RP11-381K2...	42	1.8
244	emb|CR848705.13| Zebrafish DNA sequence from clone DKEY-8O15 in ...	42	1.8
245	gb|AE003776.2| Drosophila melanogaster chromosome 3R, section 11...	42	1.8
246	dbj|AP001011.6| Homo sapiens genomic DNA, chromosome 18 clone:RP...	42	1.8
247	gb|AC002525.1|AC002525 Human PAC clone 257C22A from 13q12-q13, c...	42	1.8
248	ref|NM_121249.2| Arabidopsis thaliana translation elongation fac...	40	7.2
249	gb|AC102320.6| Mus musculus chromosome 1, clone RP24-459A11, com...	40	7.2
250	gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosom...	40	7.2
251	gb|BC081500.1| Danio rerio zgc:103635, mRNA (cDNA clone MGC:1036...	40	7.2
252	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	7.2
253	gb|BC097116.1| Danio rerio zgc:114052, mRNA (cDNA clone MGC:1140...	40	7.2
254	gb|AC119971.8| Mus musculus chromosome 16, clone RP24-480D8, com...	40	7.2
255	gb|AC140680.4| Mus musculus BAC clone RP24-548A12 from chromosom...	40	7.2
256	gb|AC141874.4| Mus musculus BAC clone RP24-327L10 from chromosom...	40	7.2
257	gb|AC145586.4| Mus musculus BAC clone RP24-167J1 from chromosome...	40	7.2
258	ref|XM_323108.1| Neurospora crassa OR74A hypothetical protein ( ...	40	7.2
259	ref|XM_956104.1| Neurospora crassa OR74A hypothetical protein ( ...	40	7.2
260	gb|AC145267.5| Mus musculus BAC clone RP24-161F7 from chromosome...	40	7.2
261	gb|AC129209.4| Mus musculus BAC clone RP24-318B5 from chromosome...	40	7.2
262	gb|L25599.1| Caenorhabditis elegans cosmid F54H12, complete sequ...	40	7.2
263	gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chrom...	40	7.2
264	gb|AC145346.3| Mus musculus BAC clone RP24-76G8 from chromosome ...	40	7.2
265	gb|AC140401.4| Mus musculus BAC clone RP24-89O8 from chromosome ...	40	7.2
266	gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosom...	40	7.2
267	gb|AC145742.3| Mus musculus BAC clone RP24-225F21 from chromosom...	40	7.2
268	gb|AC142265.4| Mus musculus BAC clone RP24-360F24 from chromosom...	40	7.2
269	gb|AC183681.2| Pan troglodytes BAC clone CH251-278I15 from chrom...	40	7.2
270	gb|AC184101.1| Mus musculus BAC clone RP24-534I7 from chromosome...	40	7.2
271	gb|AC102333.10| Mus musculus chromosome 18, clone RP24-542P12, c...	40	7.2
272	emb|AJ249596.1|ATH249596 Arabidopsis thaliana mRNA for elongatio...	40	7.2
273	ref|NM_001030147.1| Danio rerio zgc:114052 (zgc:114052), mRNA	40	7.2
274	gb|AC116503.17| Mus musculus chromosome 9, clone RP24-302M3, com...	40	7.2
275	gb|AC147126.2| Mus musculus BAC clone RP24-561J22 from chromosom...	40	7.2
276	gb|AC141875.4| Mus musculus BAC clone RP24-316O22 from chromosom...	40	7.2
277	gb|AC144582.3| Mus musculus BAC clone RP24-323J22 from chromosom...	40	7.2
278	gb|AC140678.2| Mus musculus BAC clone RP24-553I16 from chromosom...	40	7.2
279	gb|AC142412.3| Mus musculus BAC clone RP24-75E18 from chromosome...	40	7.2
280	gb|AC130834.4| Mus musculus BAC clone RP24-119M1 from chromosome...	40	7.2
281	gb|AC140439.3| Mus musculus BAC clone RP24-172C23 from chromosom...	40	7.2
282	gb|AC140427.3| Mus musculus BAC clone RP24-173G7 from chromosome...	40	7.2
283	gb|AC144855.3| Mus musculus BAC clone RP24-179H2 from chromosome...	40	7.2
284	gb|AC140394.3| Mus musculus BAC clone RP24-181E19 from chromosom...	40	7.2
285	gb|AC147159.2| Mus musculus BAC clone RP24-259B7 from chromosome...	40	7.2
286	gb|AC144552.3| Mus musculus BAC clone RP24-271M6 from chromosome...	40	7.2
287	gb|AC145564.4| Mus musculus BAC clone RP24-482K19 from chromosom...	40	7.2
288	gb|AC140474.3| Mus musculus BAC clone RP24-406O7 from chromosome...	40	7.2
289	gb|AC144409.3| Mus musculus BAC clone RP24-302I24 from chromosom...	40	7.2
290	gb|AC135808.4| Mus musculus BAC clone RP24-316N5 from chromosome...	40	7.2
291	gb|AC141470.4| Mus musculus BAC clone RP24-566E24 from chromosom...	40	7.2
292	emb|CT009556.7| Mouse DNA sequence from clone RP23-87H19 on chro...	40	7.2
293	ref|XM_570842.1| Cryptococcus neoformans var. neoformans JEC21 h...	40	7.2
294	gb|AC106738.3| Homo sapiens chromosome 16 clone CTD-3032H12, com...	40	7.2
295	gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complet...	40	7.2
296	emb|CR733792.2|CNS0GSZ3 Tetraodon nigroviridis full-length cDNA	40	7.2
297	emb|CR728524.2|CNS0GP2Q Tetraodon nigroviridis full-length cDNA	40	7.2
298	emb|CR720100.2|CNS0GIKQ Tetraodon nigroviridis full-length cDNA	40	7.2
299	emb|CR722642.2|CNS0GKJC Tetraodon nigroviridis full-length cDNA	40	7.2
300	emb|CR719902.2|CNS0GIF8 Tetraodon nigroviridis full-length cDNA	40	7.2
301	emb|CR703454.2|CNS0G5QI Tetraodon nigroviridis full-length cDNA	40	7.2
302	emb|CR701463.2|CNS0G477 Tetraodon nigroviridis full-length cDNA	40	7.2
303	emb|CR698877.2|CNS0G27D Tetraodon nigroviridis full-length cDNA	40	7.2
304	emb|CR693558.2|CNS0FY3M Tetraodon nigroviridis full-length cDNA	40	7.2
305	emb|CR691105.2|CNS0FW7H Tetraodon nigroviridis full-length cDNA	40	7.2
306	emb|CR688433.2|CNS0FU59 Tetraodon nigroviridis full-length cDNA	40	7.2
307	emb|CR687149.2|CNS0FT5L Tetraodon nigroviridis full-length cDNA	40	7.2
308	emb|CR687009.2|CNS0FT1P Tetraodon nigroviridis full-length cDNA	40	7.2
309	emb|CR686677.2|CNS0FSSH Tetraodon nigroviridis full-length cDNA	40	7.2
310	emb|CR685114.3|CNS0FRL2 Tetraodon nigroviridis full-length cDNA	40	7.2
311	emb|CR683419.2|CNS0FQ9Z Tetraodon nigroviridis full-length cDNA	40	7.2
312	emb|CR681006.2|CNS0FOEY Tetraodon nigroviridis full-length cDNA	40	7.2
313	emb|CR680575.2|CNS0FO2Z Tetraodon nigroviridis full-length cDNA	40	7.2
314	emb|CR680242.2|CNS0FNTQ Tetraodon nigroviridis full-length cDNA	40	7.2
315	emb|CR679939.2|CNS0FNLB Tetraodon nigroviridis full-length cDNA	40	7.2
316	emb|CR677929.1|CNS0FM1T Tetraodon nigroviridis full-length cDNA	40	7.2
317	emb|CR677980.2|CNS0FM38 Tetraodon nigroviridis full-length cDNA	40	7.2
318	emb|CR677281.2|CNS0FLJX Tetraodon nigroviridis full-length cDNA	40	7.2
319	emb|CR677181.2|CNS0FLH5 Tetraodon nigroviridis full-length cDNA	40	7.2
320	emb|CR676468.2|CNS0FKXC Tetraodon nigroviridis full-length cDNA	40	7.2
321	emb|CR676870.2|CNS0FL8I Tetraodon nigroviridis full-length cDNA	40	7.2
322	emb|CR674225.2|CNS0FJ7B Tetraodon nigroviridis full-length cDNA	40	7.2
323	emb|CR673965.2|CNS0FJ03 Tetraodon nigroviridis full-length cDNA	40	7.2
324	emb|CR673115.2|CNS0FICH Tetraodon nigroviridis full-length cDNA	40	7.2
325	emb|CR672809.2|CNS0FI3Z Tetraodon nigroviridis full-length cDNA	40	7.2
326	emb|CR672714.2|CNS0FI1C Tetraodon nigroviridis full-length cDNA	40	7.2
327	emb|CR672557.2|CNS0FHWZ Tetraodon nigroviridis full-length cDNA	40	7.2
328	emb|CR672233.2|CNS0FHNZ Tetraodon nigroviridis full-length cDNA	40	7.2
329	emb|CR671039.2|CNS0FGQT Tetraodon nigroviridis full-length cDNA	40	7.2
330	emb|CR671013.2|CNS0FGQ3 Tetraodon nigroviridis full-length cDNA	40	7.2
331	emb|CR671520.2|CNS0FH46 Tetraodon nigroviridis full-length cDNA	40	7.2
332	emb|CR670534.2|CNS0FGCS Tetraodon nigroviridis full-length cDNA	40	7.2
333	emb|CR668627.2|CNS0FEVT Tetraodon nigroviridis full-length cDNA	40	7.2
334	emb|CR668461.2|CNS0FER7 Tetraodon nigroviridis full-length cDNA	40	7.2
335	emb|CR668249.2|CNS0FELB Tetraodon nigroviridis full-length cDNA	40	7.2
336	emb|CR667660.2|CNS0FE4Y Tetraodon nigroviridis full-length cDNA	40	7.2
337	emb|CR666943.2|CNS0FDL1 Tetraodon nigroviridis full-length cDNA	40	7.2
338	emb|CR666424.2|CNS0FD6M Tetraodon nigroviridis full-length cDNA	40	7.2
339	emb|CR666052.2|CNS0FCWA Tetraodon nigroviridis full-length cDNA	40	7.2
340	emb|CR665436.2|CNS0FCF6 Tetraodon nigroviridis full-length cDNA	40	7.2
341	emb|CR664496.2|CNS0FBP2 Tetraodon nigroviridis full-length cDNA	40	7.2
342	emb|CR664813.2|CNS0FBXV Tetraodon nigroviridis full-length cDNA	40	7.2
343	emb|CR664774.2|CNS0FBWS Tetraodon nigroviridis full-length cDNA	40	7.2
344	emb|CR663967.2|CNS0FBAD Tetraodon nigroviridis full-length cDNA	40	7.2
345	emb|CR663903.2|CNS0FB8L Tetraodon nigroviridis full-length cDNA	40	7.2
346	emb|CR663679.2|CNS0FB2D Tetraodon nigroviridis full-length cDNA	40	7.2
347	emb|CR663217.2|CNS0FAPJ Tetraodon nigroviridis full-length cDNA	40	7.2
348	emb|CR662504.2|CNS0FA5Q Tetraodon nigroviridis full-length cDNA	40	7.2
349	emb|CR662807.2|CNS0FAE5 Tetraodon nigroviridis full-length cDNA	40	7.2
350	emb|CR661271.2|CNS0F97H Tetraodon nigroviridis full-length cDNA	40	7.2
351	emb|CR658047.2|CNS0F6PX Tetraodon nigroviridis full-length cDNA	40	7.2
352	emb|CR659461.2|CNS0F7T7 Tetraodon nigroviridis full-length cDNA	40	7.2
353	emb|CR659404.2|CNS0F7RM Tetraodon nigroviridis full-length cDNA	40	7.2
354	emb|CR658737.2|CNS0F793 Tetraodon nigroviridis full-length cDNA	40	7.2
355	emb|CR658693.2|CNS0F77V Tetraodon nigroviridis full-length cDNA	40	7.2
356	emb|CR657178.2|CNS0F61S Tetraodon nigroviridis full-length cDNA	40	7.2
357	emb|CR657080.2|CNS0F5Z2 Tetraodon nigroviridis full-length cDNA	40	7.2
358	emb|CR657622.2|CNS0F6E4 Tetraodon nigroviridis full-length cDNA	40	7.2
359	emb|CR657582.2|CNS0F6D0 Tetraodon nigroviridis full-length cDNA	40	7.2
360	emb|CR657548.2|CNS0F6C2 Tetraodon nigroviridis full-length cDNA	40	7.2
361	emb|CR655077.2|CNS0F4FF Tetraodon nigroviridis full-length cDNA	40	7.2
362	gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, c...	40	7.2
363	emb|CR652367.2|CNS0F2C5 Tetraodon nigroviridis full-length cDNA	40	7.2
364	emb|CR652169.2|CNS0F26N Tetraodon nigroviridis full-length cDNA	40	7.2
365	emb|CR649960.2|CNS0F0HA Tetraodon nigroviridis full-length cDNA	40	7.2
366	emb|CR649944.2|CNS0F0GU Tetraodon nigroviridis full-length cDNA	40	7.2
367	emb|CR648239.2|CNS0EZ5H Tetraodon nigroviridis full-length cDNA	40	7.2
368	emb|CR645624.2|CNS0EX4U Tetraodon nigroviridis full-length cDNA	40	7.2
369	emb|CR642727.2|CNS0EUWD Tetraodon nigroviridis full-length cDNA	40	7.2
370	emb|CR642517.2|CNS0EUQJ Tetraodon nigroviridis full-length cDNA	40	7.2
371	emb|CR642045.2|CNS0EUDF Tetraodon nigroviridis full-length cDNA	40	7.2
372	emb|CR641777.2|CNS0EU5Z Tetraodon nigroviridis full-length cDNA	40	7.2
373	emb|CR637840.2|CNS0ER4M Tetraodon nigroviridis full-length cDNA	40	7.2
374	emb|CR636750.2|CNS0EQAC Tetraodon nigroviridis full-length cDNA	40	7.2
375	emb|CR635662.2|CNS0EPG4 Tetraodon nigroviridis full-length cDNA	40	7.2
376	emb|CR634289.2|CNS0EODZ Tetraodon nigroviridis full-length cDNA	40	7.2
377	emb|CR634173.2|CNS0EOAR Tetraodon nigroviridis full-length cDNA	40	7.2
378	gb|AC175493.3| Mus musculus BAC clone RP24-70B12 from chromosome...	40	7.2
379	emb|AL158080.21| Human DNA sequence from clone RP13-399N6 on chr...	40	7.2
380	gb|AC175667.3| Mus musculus BAC clone RP24-372I14 from chromosom...	40	7.2
381	gb|AC046185.14| Homo sapiens chromosome 17, clone RP11-51F16, co...	40	7.2
382	emb|AL080315.18|HSDJ6P5 Human DNA sequence from clone RP1-6P5 on...	40	7.2
383	emb|AL078602.14|HSJ360M22 Human DNA sequence from clone RP3-360M...	40	7.2
384	gb|AC161175.5| Mus musculus chromosome 18, clone RP23-2J13, comp...	40	7.2
385	emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome	40	7.2
386	gb|AC142409.4| Mus musculus BAC clone RP24-185L20 from chromosom...	40	7.2
387	emb|AL513466.1|NCB18D24 Neurospora crassa DNA linkage group V BA...	40	7.2
388	emb|AL451018.1|NC99H12 Neurospora crassa DNA linkage group V Cos...	40	7.2
389	gb|AC098614.3| Homo sapiens chromosome 3 clone RP11-222K16, comp...	40	7.2
390	gb|AC184103.1| Mus musculus chromosome UNK clone CH35-73N5, comp...	40	7.2
391	gb|AC182253.3| Mus musculus BAC clone RP24-320A8 from chromosome...	40	7.2
392	gb|AC103579.10| Mus Musculus Strain C57BL6/J Chromosome 14 BAC C...	40	7.2
393	gb|AC182448.2| Mus musculus BAC clone RP24-490J20 from chromosom...	40	7.2
394	gb|AC179922.3| Mus musculus BAC clone RP24-571K5 from chromosome...	40	7.2
395	gb|AC103706.2| Homo sapiens chromosome 8, clone RP11-629O1, comp...	40	7.2
396	gb|AC182761.2| Mus musculus BAC clone RP24-91P5 from chromosome ...	40	7.2
397	gb|AC175744.2| Mus musculus BAC clone RP24-163J18 from chromosom...	40	7.2
398	gb|AC093608.3| Homo sapiens BAC clone RP11-700C8 from 4, complet...	40	7.2
399	gb|AC079925.6| Homo sapiens BAC clone RP11-544E17 from 4, comple...	40	7.2
400	gb|BT024774.1| Arabidopsis thaliana At5g12110 mRNA, complete cds	40	7.2
401	gb|AC175818.2| Mus musculus BAC clone RP24-566J3 from chromosome...	40	7.2
402	gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255...	40	7.2
403	gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome...	40	7.2
404	ref|NM_066336.2| Caenorhabditis elegans F54H12.6 (F54H12.6) mRNA...	40	7.2
405	gb|AC175461.3| Mus musculus BAC clone RP24-64J17 from chromosome...	40	7.2
406	gb|AC175710.2| Mus musculus BAC clone RP24-44O16 from chromosome...	40	7.2
407	emb|BX908741.7| Mouse DNA sequence from clone RP23-189F6 on chro...	40	7.2
408	gb|AC090524.1|AC090524 Caenorhabditis briggsae cosmid CB019H23, ...	40	7.2
409	gb|AC159235.2| Mus musculus BAC clone RP24-432L4 from chromosome...	40	7.2
410	gb|AC145572.4| Mus musculus BAC clone RP24-95P13 from chromosome...	40	7.2
411	gb|AC009107.11| Homo sapiens chromosome 16 clone RP11-459F6, com...	40	7.2
412	gb|AC139712.1| Homo sapiens BAC clone RP11-754G3 from 2, complet...	40	7.2
413	ref|XM_343580.2| PREDICTED: Rattus norvegicus eukaryotic transla...	40	7.2
414	gb|BT002990.1| Arabidopsis thaliana clone RAFL15-16-K06 (R20516)...	40	7.2
415	gb|AC173708.4| Mus musculus BAC clone RP24-140O8 from chromosome...	40	7.2
416	gb|AC175389.2| Mus musculus BAC clone RP24-152N3 from chromosome...	40	7.2
417	ref|NM_001005596.1| Danio rerio zgc:103635 (zgc:103635), mRNA	40	7.2
418	gb|AC175033.2| Mus musculus BAC clone RP24-283I7 from chromosome...	40	7.2
419	dbj|AP004006.5| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
420	dbj|AP004259.2| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
421	dbj|AP005454.4| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
422	emb|BX255896.4| Zebrafish DNA sequence from clone CH211-249O11 i...	40	7.2
423	gb|BC081476.1| Danio rerio im:7233939, mRNA (cDNA clone IMAGE:72...	40	7.2
424	emb|AL954170.4| Mouse DNA sequence from clone RP23-467H15 on chr...	40	7.2
425	dbj|AB007727.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	7.2
426	gb|AF212832.5| Homo sapiens chromosome 8 clone CTC-806C5 map 8q2...	40	7.2
427	gb|AF155238.4| Homo sapiens chromosome 8 clone GS1-180I23 map 8q...	40	7.2
428	emb|AJ249598.1|ATH249598 Arabidopsis thaliana mRNA for elongatio...	40	7.2
429	gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete se...	40	7.2
430	gb|AC005877.3|AC005877 citb_19_o_18, complete sequence	40	7.2
431	emb|AL929003.17| Zebrafish DNA sequence from clone DKEY-235D18 i...	40	7.2
432	dbj|AP003847.3| Oryza sativa (japonica cultivar-group) genomic D...	40	7.2
433	emb|CR388084.7| Zebrafish DNA sequence from clone CH211-234D12 i...	40	7.2
434	gb|AC007073.2|AC007073 Homo sapiens chromosome 4 clone C0310G15 ...	40	7.2
435	dbj|AP000642.5| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	7.2
436	gb|AC142490.3| Mus musculus BAC clone RP24-362J19 from Y, comple...	40	7.2
437	gb|AC145575.3| Mus musculus BAC clone RP24-103M14 from Y, comple...	40	7.2
438	gb|AC140421.4| Mus musculus BAC clone RP24-441H14 from Y, comple...	40	7.2
439	gb|AC131661.4| Mus musculus BAC clone RP23-251N10 from 1, comple...	40	7.2
440	emb|AL772282.9| Mouse DNA sequence from clone RP23-328F3 on chro...	40	7.2

---

>dbj|D13147.1|WHTNANBU Triticum aestivum mRNA for elongation factor 1 beta', complete cds
          Length = 884

 Score =  595 bits (300), Expect = e-167
 Identities = 372/395 (94%), Gaps = 6/395 (1%)
 Strand = Plus / Minus

                                                                       
Query: 136 accaatcccagtaccaagaatccagcagcaacaggtgagcggacaaagattctagatctt 195
           ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 704 accaatcccagtaccaagaatccagcagcaacaggtgggcgaacaaagattctagatctt 645

                                                                       
Query: 196 gttgaaggcnncgatgtcacacgactggacgtactcgttgatgggcgcctngcagagcac 255
           |||||||||  ||||||||||||||||||| |||||||||||||||||||  ||||||||
Sbjct: 644 gttgaaggcaacgatgtcacacgactggacatactcgttgatgggcgcctcacagagcac 585

                                                                       
Query: 256 ttcctcaangagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggag 315
           ||||||||  || ||||||||  |    ||||| || |||||||||||||||||||||||
Sbjct: 584 ttcctcaat-ag-gtgtcgacgca----aggtcgtcgatgatcgtcagcatgatctggag 531

                                                                       
Query: 316 cttnntgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccat 375
           |||  |||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 530 cttcttgatgccataacccacaggcataagcttagatgcaccccaggtgagaccctccat 471

                                                                       
Query: 376 ttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 470 ttgaacactgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 411

                                                                       
Query: 436 gatgtccatgaggacagaggatttgccactttctttcttctttgcaggcttggcagcctc 495
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 gatgtccatgaggacggaggatttgccactttctttcttctttgcaggcttggcagcctc 351

                                              
Query: 496 acgctcagctgctgctttcttgtcctcctcggtct 530
           |||||||||||||||||||||||||||||||||||
Sbjct: 350 acgctcagctgctgctttcttgtcctcctcggtct 316



 Score =  190 bits (96), Expect = 3e-45
 Identities = 121/128 (94%), Gaps = 1/128 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgttttgccattacaaactgctcagacaattcaactatttaaaggtaacagacattcaa 60
           |||||| |||||||||||| |||||| ||||||||||||||||||||| ||| |||||||
Sbjct: 848 atgtttcgccattacaaaccgctcag-caattcaactatttaaaggtagcaggcattcaa 790

                                                                       
Query: 61  gaccagggcttgactcaaaaacaaaaccagtagcatttctgtaagaggggtaactaaatg 120
           ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 789 gaccagggcatcactcaaaaacaaaaccagtagcatttctgtaagaggggtaactaaatg 730

                   
Query: 121 ggacgaca 128
           ||||||||
Sbjct: 729 ggacgaca 722

---

>ref|NM_186038.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 998

 Score =  204 bits (103), Expect = 2e-49
 Identities = 220/259 (84%), Gaps = 3/259 (1%)
 Strand = Plus / Minus

                                                                       
Query: 275 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
           |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 335 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 394
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                                       
Query: 395 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 454
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 501

                                                                       
Query: 455 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 511
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 500 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 441

                              
Query: 512 ttcttgtcctcctcggtct 530
           |||||||| ||||||||||
Sbjct: 440 ttcttgtcttcctcggtct 422

---

>ref|XM_506540.1| PREDICTED Oryza sativa (japonica cultivar-group), P0453E03.111 mRNA
          Length = 1000

 Score =  204 bits (103), Expect = 2e-49
 Identities = 220/259 (84%), Gaps = 3/259 (1%)
 Strand = Plus / Minus

                                                                       
Query: 275 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
           |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 335 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 394
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                                       
Query: 395 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 454
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 503

                                                                       
Query: 455 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 511
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 502 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 443

                              
Query: 512 ttcttgtcctcctcggtct 530
           |||||||| ||||||||||
Sbjct: 442 ttcttgtcttcctcggtct 424

---

>dbj|AK121942.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107E20, full
           insert sequence
          Length = 1028

 Score =  204 bits (103), Expect = 2e-49
 Identities = 220/259 (84%), Gaps = 3/259 (1%)
 Strand = Plus / Minus

                                                                       
Query: 275 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
           |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 683 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 624

                                                                       
Query: 335 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 394
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 623 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 564

                                                                       
Query: 395 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 454
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 563 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 504

                                                                       
Query: 455 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 511
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 503 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 444

                              
Query: 512 ttcttgtcctcctcggtct 530
           |||||||| ||||||||||
Sbjct: 443 ttcttgtcttcctcggtct 425

---

>dbj|AK098892.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001M09, full
           insert sequence
          Length = 998

 Score =  204 bits (103), Expect = 2e-49
 Identities = 220/259 (84%), Gaps = 3/259 (1%)
 Strand = Plus / Minus

                                                                       
Query: 275 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
           |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 680 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 621

                                                                       
Query: 335 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 394
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 620 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 561

                                                                       
Query: 395 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 454
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 560 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 501

                                                                       
Query: 455 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 511
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 500 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 441

                              
Query: 512 ttcttgtcctcctcggtct 530
           |||||||| ||||||||||
Sbjct: 440 ttcttgtcttcctcggtct 422

---

>dbj|AK061761.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-B01, full
           insert sequence
          Length = 1000

 Score =  204 bits (103), Expect = 2e-49
 Identities = 220/259 (84%), Gaps = 3/259 (1%)
 Strand = Plus / Minus

                                                                       
Query: 275 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
           |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 682 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 623

                                                                       
Query: 335 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 394
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 622 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 563

                                                                       
Query: 395 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 454
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 562 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 503

                                                                       
Query: 455 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 511
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 502 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 443

                              
Query: 512 ttcttgtcctcctcggtct 530
           |||||||| ||||||||||
Sbjct: 442 ttcttgtcttcctcggtct 424

---

>dbj|D12821.1|RICEF1B Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta', complete cds
          Length = 956

 Score =  204 bits (103), Expect = 2e-49
 Identities = 220/259 (84%), Gaps = 3/259 (1%)
 Strand = Plus / Minus

                                                                       
Query: 275 acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
           |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 641 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 582

                                                                       
Query: 335 acaggcatgagcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcc 394
           |||||||  ||||| ||||| |||||||||||||||||||| || |||| ||||||||||
Sbjct: 581 acaggcacaagctttgatgctccccaggtgagaccctccatctgcacactgcggacagcc 522

                                                                       
Query: 395 tcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagag 454
           ||||||||||||||||| |||||||| ||||||||||| ||||  ||||  |||||||| 
Sbjct: 521 tcctccaacttcttcatatcagtctcgtcgtcccatggtttgacatccaacaggacagat 462

                                                                       
Query: 455 gatttgccactttctttcttctttgca---ggcttggcagcctcacgctcagctgctgct 511
           ||||| || |||||||||||||||| |   | ||||| |||  |||||||| ||||||||
Sbjct: 461 gattttccgctttctttcttctttgaagaggccttggaagctgcacgctcatctgctgct 402

                              
Query: 512 ttcttgtcctcctcggtct 530
           |||||||| ||||||||||
Sbjct: 401 ttcttgtcttcctcggtct 383

---

>gb|BT016181.1| Zea mays clone Contig14 mRNA sequence
          Length = 1084

 Score =  139 bits (70), Expect = 1e-29
 Identities = 133/154 (86%)
 Strand = Plus / Minus

                                                                       
Query: 321 tgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccatttgaa 380
           ||||||| || || |||||||  ||||| ||||| ||||| || ||||||||||| || |
Sbjct: 623 tgatgccgtatccaacaggcacaagctttgatgctccccaagtcagaccctccatctgga 564

                                                                       
Query: 381 caccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgt 440
           ||| ||||||||||||||||| ||||||||| |||||||||||||||||||| || |  |
Sbjct: 563 cactgcggacagcctcctccagcttcttcatatcagtctcatcgtcccatggttttacat 504

                                             
Query: 441 ccatgaggacagaggatttgccactttctttctt 474
           |||| ||||| |||||||| ||||||||||||||
Sbjct: 503 ccataaggacggaggatttaccactttctttctt 470



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 186 tctagatcttgttgaaggcnncgatgtcacacgactggacgtactcgttgatgggc 241
           |||||||||||||||| ||  | ||||| ||   |||||||||||| |||||||||
Sbjct: 758 tctagatcttgttgaaagccacaatgtcgcaactctggacgtactcattgatgggc 703

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                            
Query: 351      atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 410
                |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 27890071 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 27890012

                                                                 
Query: 411      tgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggattt 459
                | |||||||| ||||||||||| ||||  ||||  |||||||| |||||
Sbjct: 27890011 tatcagtctcgtcgtcccatggtttgacatccaacaggacagatgattt 27889963



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 61/71 (85%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                            
Query: 463      actttctttcttctttgcagg---cttggcagcctcacgctcagctgctgctttcttgtc 519
                ||||||||||||||||| ||    ||||| |||  |||||||| ||||||||||||||||
Sbjct: 27889823 actttctttcttctttgaagaggccttggaagctgcacgctcatctgctgctttcttgtc 27889764

                           
Query: 520      ctcctcggtct 530
                 ||||||||||
Sbjct: 27889763 ttcctcggtct 27889753



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 408      tcatgtcagtctcatcgtcccatggcttga 437
                ||||||||||||||||||||||||| ||||
Sbjct: 25261256 tcatgtcagtctcatcgtcccatggtttga 25261285



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 55/67 (82%)
 Strand = Plus / Minus

                                                                            
Query: 275      acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
                |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 27890238 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 27890179

                       
Query: 335      acaggca 341
                |||||||
Sbjct: 27890178 acaggca 27890172



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 457      tttgccactttctttcttct 476
                ||||||||||||||||||||
Sbjct: 18633489 tttgccactttctttcttct 18633470



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 1       atgttttgccattacaaactgctc 24
               ||||||||||||||||||| ||||
Sbjct: 3209605 atgttttgccattacaaaccgctc 3209628

---

>dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E03
          Length = 159980

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Minus

                                                                         
Query: 351   atgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttcttca 410
             |||| |||||||||||||||||||| || |||| ||||||||||||||||||||||||||
Sbjct: 53429 atgctccccaggtgagaccctccatctgcacactgcggacagcctcctccaacttcttca 53370

                                                              
Query: 411   tgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggattt 459
             | |||||||| ||||||||||| ||||  ||||  |||||||| |||||
Sbjct: 53369 tatcagtctcgtcgtcccatggtttgacatccaacaggacagatgattt 53321



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 61/71 (85%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                         
Query: 463   actttctttcttctttgcagg---cttggcagcctcacgctcagctgctgctttcttgtc 519
             ||||||||||||||||| ||    ||||| |||  |||||||| ||||||||||||||||
Sbjct: 53181 actttctttcttctttgaagaggccttggaagctgcacgctcatctgctgctttcttgtc 53122

                        
Query: 520   ctcctcggtct 530
              ||||||||||
Sbjct: 53121 ttcctcggtct 53111



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 55/67 (82%)
 Strand = Plus / Minus

                                                                         
Query: 275   acagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatgccataaccc 334
             |||||||| | ||||||||  || |||| ||||||||| | |||  |||| || ||||||
Sbjct: 53596 acagacaccaagtcatcaacaatggtcaacatgatctgcaacttcttgatcccgtaaccc 53537

                    
Query: 335   acaggca 341
             |||||||
Sbjct: 53536 acaggca 53530

---

>gb|BT017490.1| Zea mays clone EL01N0413C10.c mRNA sequence
          Length = 951

 Score =  109 bits (55), Expect = 9e-21
 Identities = 112/131 (85%)
 Strand = Plus / Minus

                                                                       
Query: 344 agcttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaac 403
           ||||| ||||| ||||| || ||||||||||| || |||| | ||||||||||||||| |
Sbjct: 587 agctttgatgctccccaagtcagaccctccatctggacactggggacagcctcctccagc 528

                                                                       
Query: 404 ttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgcca 463
           |||||||| |||||||||||||||||||| || |  ||||| ||| | |||||||| |||
Sbjct: 527 ttcttcatatcagtctcatcgtcccatggttttacatccataaggccggaggatttccca 468

                      
Query: 464 ctttctttctt 474
           || ||||||||
Sbjct: 467 ctctctttctt 457

---

>emb|AJ277799.1|HVU277799 Hordeum vulgare mRNA for putative elongation factor 1 beta
           (eEF1Bbeta 25 gene)
          Length = 1000

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                       
Query: 266 agagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagcttnntgatg 325
           |||||||| ||||| || |||||||||||||| |||| ||| |||||||||||  |||||
Sbjct: 695 agagtgtcaacagagacaaggtcatcaatgatggtcatcataatctggagcttcttgatg 636

                                              
Query: 326 ccataacccacaggcatgagcttagatgcacccca 360
           ||||| || || ||||||||||| || ||||||||
Sbjct: 635 ccatatccaactggcatgagcttggaagcacccca 601

---

>gb|DQ226877.1| Boechera divaricarpa isolate SLW-C-G10 mRNA sequence
          Length = 459

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||| |||||||||||||   |||||||||| |||||||| ||||||||||| | 
Sbjct: 308 aacactgcgaacagcctcctccagtctcttcatgtcggtctcatcatcccatggcttaac 249

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| |||||||| || ||||| |||||
Sbjct: 248 atccatgagcacagaggactttccactctcttt 216

---

>gb|DQ235167.1| Solanum tuberosum clone 154B05 ripening regulated protein
           DDTFR10-like mRNA, complete cds
          Length = 928

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 407 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 466
           ||||| ||||||||||| |||||||||||||  |||||||| || ||||| ||||||  |
Sbjct: 541 ttcatatcagtctcatcatcccatggcttgacatccatgagaactgaggacttgccagat 482

                      
Query: 467 tctttcttctt 477
           |||||||||||
Sbjct: 481 tctttcttctt 471

---

>gb|AY480020.1| Capsicum annuum putative elongation factor 1B alpha-subunit mRNA,
           partial sequence
          Length = 728

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 347 ttagatgcaccccaggtgagaccctccatttgaacaccgcggacagcctcctccaacttc 406
           |||||||| ||||||   ||||| ||||| | ||||| ||| ||||||||||| |  |||
Sbjct: 577 ttagatgctccccagagaagaccttccatctcaacactgcgaacagcctcctcaagtttc 518

                                                                       
Query: 407 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 466
           ||||||||||| || || ||||| ||||| | |||||| || ||||| || || ||||| 
Sbjct: 517 ttcatgtcagtttcgtcatcccaaggcttaacgtccataagaacagatgactttccactc 458

                      
Query: 467 tctttcttctt 477
           |||||||||||
Sbjct: 457 tctttcttctt 447

---

>gb|AF204787.1|AF204787 Lycopersicon esculentum ripening regulated protein DDTFR10
           (DDTFR10) mRNA, complete cds
          Length = 988

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 407 ttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagaggatttgccactt 466
           ||||| || |||||||| |||||||||||||  |||||||| |||||||| ||||||  |
Sbjct: 523 ttcatatcggtctcatcatcccatggcttgacatccatgagaacagaggacttgccagat 464

                      
Query: 467 tctttcttctt 477
           |||||||||||
Sbjct: 463 tctttcttctt 453

---

>gb|DQ207867.1| Solanum tuberosum clone 085E09 putative elongation factor 1B
           alpha-subunit0like mRNA, complete cds
          Length = 957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 430
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 545 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 486

                                                          
Query: 431 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 477
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 485 ggcttaacgtccataagaacggatgactttccactctctttcttctt 439

---

>gb|DQ191626.1| Solanum tuberosum unknown mRNA
          Length = 1088

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 371 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 430
           ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 529 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 470

                                                          
Query: 431 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 477
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 469 ggcttaacgtccataagaacggatgactttccactctctttcttctt 423

---

>dbj|AB254814.1| Cryptomeria japonica mRNA for putative elongation factor, complete
           cds
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 388 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgag 447
           |||||||||||| |  |||| |||||| |||||||| |||||||| ||||  ||||  ||
Sbjct: 538 gacagcctcctcaagtttctgcatgtccgtctcatcatcccatggtttgacatccaatag 479

                                      
Query: 448 gacagaggatttgccactttctttctt 474
            ||||| ||||| ||||||||||||||
Sbjct: 478 aacagaagattttccactttctttctt 452

---

>emb|CR954185.2| Medicago truncatula chromosome 5 clone mth4-20m5, COMPLETE SEQUENCE
          Length = 210708

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 389    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
              |||||||| |||| |||||||||||| |||||||| |||||||||||
Sbjct: 171387 acagcctcttccagcttcttcatgtctgtctcatcatcccatggctt 171433



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 389    acagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
              ||||| || |||| ||||||||| || |||||||| |||||||||||
Sbjct: 158087 acagcttcttccagcttcttcatatctgtctcatcatcccatggctt 158133

---

>gb|BT016424.1| Zea mays clone Contig257 mRNA sequence
          Length = 1064

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 141/179 (78%)
 Strand = Plus / Minus

                                                                       
Query: 257 tcctcaangagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 316
           ||||||| ||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 723 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 664

                                                                       
Query: 317 ttnntgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccatt 376
           ||  |||| ||||| || || || |  ||||| ||||| ||||||   || || ||||| 
Sbjct: 663 ttcttgataccatatccaactgggacaagcttggatgcgccccagagcagcccttccatc 604

                                                                      
Query: 377 tgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           || ||||  |  ||||| ||||| | |||   |||||||||||||||||||||||||||
Sbjct: 603 tggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcccatggctt 545

---

>gb|BT016185.1| Zea mays clone Contig18 mRNA sequence
          Length = 1070

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 141/179 (78%)
 Strand = Plus / Minus

                                                                       
Query: 257 tcctcaangagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 316
           ||||||| ||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 751 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 692

                                                                       
Query: 317 ttnntgatgccataacccacaggcatgagcttagatgcaccccaggtgagaccctccatt 376
           ||  |||| ||||| || || || |  ||||| ||||| ||||||   || || ||||| 
Sbjct: 691 ttcttgataccatatccaactgggacaagcttggatgcgccccagagcagcccttccatc 632

                                                                      
Query: 377 tgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           || ||||  |  ||||| ||||| | |||   |||||||||||||||||||||||||||
Sbjct: 631 tggacactcctaacagcttcctcgagcttggccatgtcagtctcatcgtcccatggctt 573

---

>ref|NM_121956.2| Arabidopsis thaliana translation elongation factor AT5G19510 mRNA,
           complete cds
          Length = 945

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 557 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 498

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 497 atccatgagcacagaagactttccactctcttt 465

---

>emb|AJ249597.1|ATH249597 Arabidopsis thaliana mRNA for elongation factor 1B alpha-subunit
           (eEF1Balpha2 gene)
          Length = 680

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 485 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 426

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 425 atccatgagcacagaagactttccactctcttt 393

---

>gb|AY056354.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 706

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 483 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 424

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 423 atccatgagcacagaagactttccactctcttt 391

---

>gb|AF360304.1| Arabidopsis thaliana putative elongation factor 1B alpha-subunit
           (At5g19510) mRNA, complete cds
          Length = 881

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 522 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 463

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 462 atccatgagcacagaagactttccactctcttt 430

---

>emb|BX830320.1|CNS0A1AJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB73ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 820

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 453 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 394

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 393 atccatgagtacagaagactttccactctcttt 361

---

>emb|BX830295.1|CNS0A1LL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZA05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 883

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 481

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 480 atccatgagcacagaagactttccactctcttt 448

---

>emb|BX832129.1|CNS0A0XD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 498 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 439

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 438 atccatgagcacagaagactttccactctcttt 406

---

>emb|BX831615.1|CNS0A14O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH19ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 868

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 540 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 481

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 480 atccatgagcacagaagactttccactctcttt 448

---

>emb|BX830589.1|CNS0A17N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZF03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 712

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 369 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttcac 310

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 309 atccatgagcacagaagactttccactctcttt 277

---

>gb|AY089071.1| Arabidopsis thaliana clone 26936 mRNA, complete sequence
          Length = 849

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 497 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 438

                                            
Query: 439 gtccatgaggacagaggatttgccactttcttt 471
            |||||||| ||||| || || ||||| |||||
Sbjct: 437 atccatgagcacagaagactttccactctcttt 405

---

>ref|NM_127367.1| Arabidopsis thaliana translation elongation factor AT2G18110 mRNA,
           complete cds
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522

---

>emb|BX071583.1|CNS09REB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 366 cttcatgtcggtttcatcgtcccatggcttgatgtc 401

---

>emb|BX071358.1|CNS09R82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 490 cttcatgtcggtttcatcgtcccatggcttgatgtc 525

---

>emb|BX071357.1|CNS09R81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 776 cttcatgtcggtttcatcgtcccatggcttgatgtc 741

---

>emb|BX068711.1|CNS09P6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 529

---

>emb|BX068710.1|CNS09P6I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746

---

>emb|BX065206.1|CNS09MH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 775 cttcatgtcggtttcatcgtcccatggcttgatgtc 740

---

>emb|BX063619.1|CNS09L93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 301 cttcatgtcggtttcatcgtcccatggcttgatgtc 336

---

>emb|BX063618.1|CNS09L92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 85  cttcatgtcggtttcatcgtcccatggcttgatgtc 50

---

>emb|BX063276.1|CNS09KZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 363 cttcatgtcggtttcatcgtcccatggcttgatgtc 398

---

>emb|BX063275.1|CNS09KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX053674.1|CNS09DKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX053673.1|CNS09DKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX052417.1|CNS09CLX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 352 cttcatgtcggtttcatcgtcccatggcttgatgtc 387

---

>emb|BX052416.1|CNS09CLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 760 cttcatgtcggtttcatcgtcccatggcttgatgtc 725

---

>emb|BX052150.1|CNS09CEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 323 cttcatgtcggtttcatcgtcccatggcttgatgtc 358

---

>emb|BX052149.1|CNS09CEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 736 cttcatgtcggtttcatcgtcccatggcttgatgtc 701

---

>emb|BX052078.1|CNS09CCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 498 cttcatgtcggtttcatcgtcccatggcttgatgtc 533

---

>emb|BX052058.1|CNS09CBY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 813 cttcatgtcggtttcatcgtcccatggcttgatgtc 778

---

>emb|BX047220.1|CNS098LK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 140 cttcatgtcggtttcatcgtcccatggcttgatgtc 175

---

>emb|BX047219.1|CNS098LJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 743 cttcatgtcggtttcatcgtcccatggcttgatgtc 708

---

>emb|BX046233.1|CNS097U5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 615 cttcatgtcggtttcatcgtcccatggcttgatgtc 650

---

>emb|BX046232.1|CNS097U4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 786 cttcatgtcggtttcatcgtcccatggcttgatgtc 751

---

>emb|BX042348.1|CNS094U8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 598 cttcatgtcggtttcatcgtcccatggcttgatgtc 633

---

>emb|BX042347.1|CNS094U7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 521 cttcatgtcggtttcatcgtcccatggcttgatgtc 486

---

>emb|BX041605.1|CNS0949L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 245 cttcatgtcggtttcatcgtcccatggcttgatgtc 280

---

>emb|BX041604.1|CNS0949K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX041307.1|CNS0941B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 572

---

>emb|BX039708.1|CNS092SW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 258 cttcatgtcggtttcatcgtcccatggcttgatgtc 293

---

>emb|BX039707.1|CNS092SV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 279 cttcatgtcggtttcatcgtcccatggcttgatgtc 244

---

>emb|BX037290.1|CNS090XQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX036523.1|CNS090CF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 112

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 9   cttcatgtcggtttcatcgtcccatggcttgatgtc 44

---

>emb|BX036522.1|CNS090CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 102

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 61  cttcatgtcggtttcatcgtcccatggcttgatgtc 26

---

>emb|BX035983.1|CNS08ZXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 494 cttcatgtcggtttcatcgtcccatggcttgatgtc 459

---

>emb|BX035891.1|CNS08ZUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 479 cttcatgtcggtttcatcgtcccatggcttgatgtc 514

---

>emb|BX035890.1|CNS08ZUU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX035827.1|CNS08ZT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562

---

>emb|BX035826.1|CNS08ZT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX035202.1|CNS08ZBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 594 cttcatgtcggtttcatcgtcccatggcttgatgtc 629

---

>emb|BX034842.1|CNS08Z1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 469 cttcatgtcggtttcatcgtcccatggcttgatgtc 504

---

>emb|BX034841.1|CNS08Z1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 752 cttcatgtcggtttcatcgtcccatggcttgatgtc 717

---

>emb|BX034961.1|CNS08Z51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|BX032179.1|CNS08WZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 599 cttcatgtcggtttcatcgtcccatggcttgatgtc 634

---

>emb|BX032178.1|CNS08WZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 586 cttcatgtcggtttcatcgtcccatggcttgatgtc 551

---

>emb|BX032163.1|CNS08WZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 555 cttcatgtcggtttcatcgtcccatggcttgatgtc 590

---

>emb|BX029545.1|CNS08UYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 550 cttcatgtcggtttcatcgtcccatggcttgatgtc 585

---

>emb|BX029544.1|CNS08UYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 781 cttcatgtcggtttcatcgtcccatggcttgatgtc 746

---

>emb|BX022261.1|CNS08PC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 81  cttcatgtcggtttcatcgtcccatggcttgatgtc 116

---

>emb|BX022260.1|CNS08PC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX027369.1|CNS08TA5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 309 cttcatgtcggtttcatcgtcccatggcttgatgtc 344

---

>emb|BX027135.1|CNS08T3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638

---

>emb|BX027134.1|CNS08T3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX026630.1|CNS08SPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 600 cttcatgtcggtttcatcgtcccatggcttgatgtc 635

---

>emb|BX026629.1|CNS08SPL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 758 cttcatgtcggtttcatcgtcccatggcttgatgtc 723

---

>emb|BX026387.1|CNS08SIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 607 cttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|BX026386.1|CNS08SIU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 445 cttcatgtcggtttcatcgtcccatggcttgatgtc 410

---

>emb|BX025444.1|CNS08RSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 500 cttcatgtcggtttcatcgtcccatggcttgatgtc 535

---

>emb|BX025443.1|CNS08RSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 728 cttcatgtcggtttcatcgtcccatggcttgatgtc 693

---

>emb|BX024844.1|CNS08RC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753

---

>emb|BX024401.1|CNS08QZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640

---

>emb|BX024400.1|CNS08QZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 780 cttcatgtcggtttcatcgtcccatggcttgatgtc 745

---

>emb|BX023680.1|CNS08QFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 527 cttcatgtcggtttcatcgtcccatggcttgatgtc 562

---

>emb|BX023679.1|CNS08QFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 806 cttcatgtcggtttcatcgtcccatggcttgatgtc 771

---

>emb|BX019648.1|CNS08NBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 380 cttcatgtcggtttcatcgtcccatggcttgatgtc 415

---

>emb|BX019647.1|CNS08NBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 797 cttcatgtcggtttcatcgtcccatggcttgatgtc 762

---

>emb|BX019885.1|CNS08NI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX019884.1|CNS08NI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 788 cttcatgtcggtttcatcgtcccatggcttgatgtc 753

---

>emb|BX018057.1|CNS08M3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 437 cttcatgtcggtttcatcgtcccatggcttgatgtc 472

---

>emb|BX018056.1|CNS08M3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 288 cttcatgtcggtttcatcgtcccatggcttgatgtc 253

---

>emb|BX016732.1|CNS08L2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 618 cttcatgtcggtttcatcgtcccatggcttgatgtc 653

---

>emb|BX016731.1|CNS08L2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 624 cttcatgtcggtttcatcgtcccatggcttgatgtc 589

---

>emb|BX016339.1|CNS08KRR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 518 cttcatgtcggtttcatcgtcccatggcttgatgtc 553

---

>emb|BX016338.1|CNS08KRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743

---

>emb|BX015846.1|CNS08KE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 298 cttcatgtcggtttcatcgtcccatggcttgatgtc 333

---

>emb|BX015845.1|CNS08KE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759

---

>emb|BX015954.1|CNS08KH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 264 cttcatgtcggtttcatcgtcccatggcttgatgtc 299

---

>emb|BX015953.1|CNS08KH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 655 cttcatgtcggtttcatcgtcccatggcttgatgtc 620

---

>emb|BX015235.1|CNS08JX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 503 cttcatgtcggtttcatcgtcccatggcttgatgtc 538

---

>emb|BX015234.1|CNS08JX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 787 cttcatgtcggtttcatcgtcccatggcttgatgtc 752

---

>emb|BX012178.1|CNS08HK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 606 cttcatgtcggtttcatcgtcccatggcttgatgtc 641

---

>emb|BX012177.1|CNS08HK5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 785 cttcatgtcggtttcatcgtcccatggcttgatgtc 750

---

>emb|BX010493.1|CNS08G9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 603 cttcatgtcggtttcatcgtcccatggcttgatgtc 638

---

>emb|BX010492.1|CNS08G9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579

---

>emb|BX010211.1|CNS08G1J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 778 cttcatgtcggtttcatcgtcccatggcttgatgtc 743

---

>emb|BX010113.1|CNS08FYT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 605 cttcatgtcggtttcatcgtcccatggcttgatgtc 640

---

>emb|BX010112.1|CNS08FYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 614 cttcatgtcggtttcatcgtcccatggcttgatgtc 579

---

>emb|BX009646.1|CNS08FLU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 727 cttcatgtcggtttcatcgtcccatggcttgatgtc 692

---

>emb|BX008302.1|CNS08EKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 496 cttcatgtcggtttcatcgtcccatggcttgatgtc 531

---

>emb|BX008301.1|CNS08EKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 794 cttcatgtcggtttcatcgtcccatggcttgatgtc 759

---

>gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map PhyB, complete
             sequence
          Length = 57550

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 389   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
             ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 54608 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 54663

---

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
            sequence
          Length = 88149

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 389  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 2484 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 2539

---

>gb|AY081568.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110)
           mRNA, complete cds
          Length = 805

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 494 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 439

---

>gb|AY065159.1| Arabidopsis thaliana putative elongation factor 1-beta (At2g18110;
           F8D23.11) mRNA, complete cds
          Length = 928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 575 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 520

---

>emb|BX820727.1|CNS0A8QL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 920

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 564 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 509

---

>emb|BX820611.1|CNS0A8PL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH52ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 544 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 489

---

>emb|BX842001.1|CNS09Y84 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 824

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 523 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 468

---

>gb|AY087429.1| Arabidopsis thaliana clone 35337 mRNA, complete sequence
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| |||||
Sbjct: 577 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatccat 522

---

>ref|XM_313149.2| Anopheles gambiae str. PEST ENSANGP00000013448
           (ENSANGG00000010959), partial mRNA
          Length = 717

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || |||||||||||||||||||||||
Sbjct: 507 cttcatgtcggtttcatcgtcccatggcttgatgtc 472

---

>gb|DQ191662.1| Solanum tuberosum elongation factor-like protein mRNA, complete cds
          Length = 903

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 371 tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 430
           ||||| |||||||| || ||| |||||||||  |||||||| || || ||||| ||||| 
Sbjct: 552 tccatctgaacaccacgaacaacctcctccagtttcttcatatcggtttcatcatcccaa 493

                                                          
Query: 431 ggcttgatgtccatgaggacagaggatttgccactttctttcttctt 477
           ||||| | |||||| || || || || || ||||| |||||||||||
Sbjct: 492 ggcttaacgtccataagaacggatgactttccactctctttcttctt 446

---

>emb|BX037291.1|CNS090XR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 743

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 407 ttcatgtcagtctcatcgtcccatggcttgatgtc 441
           |||||||| || |||||||||||||||||||||||
Sbjct: 608 ttcatgtcggtttcatcgtcccatggcttgatgtc 642

---

>emb|X74734.1|ATHEFBI Arabidopsis thaliana gene for elongation factor 1 beta
          Length = 1996

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 389  acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 443
            ||||| ||||| | |||||||||||| |||||||| ||||| |||||||| ||||
Sbjct: 1632 acagcttcctctagcttcttcatgtccgtctcatcatcccacggcttgatatcca 1578

---

>gb|AF296830.1|T20D1 Arabidopsis thaliana BAC T20D1
          Length = 35369

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                        
Query: 379  aacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
            |||||| || |||||||| ||||  ||||||||||| || ||||| ||||||||||| | 
Sbjct: 6435 aacaccacgaacagcctcttccagtttcttcatgtcggtttcatcatcccatggcttaac 6494

                           
Query: 439  gtccatgaggacaga 453
             |||||||| |||||
Sbjct: 6495 atccatgagcacaga 6509

---

>gb|AY111648.1| Zea mays CL2935_1 mRNA sequence
          Length = 1119

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 409 catgtcagtctcatcgtcccatggctt 435
           |||||||||||||||||||||||||||
Sbjct: 543 catgtcagtctcatcgtcccatggctt 569

---

>gb|AY103717.1| Zea mays PCO098989 mRNA sequence
          Length = 1312

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 409 catgtcagtctcatcgtcccatggctt 435
           |||||||||||||||||||||||||||
Sbjct: 765 catgtcagtctcatcgtcccatggctt 739



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 tcctcaangagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctggagc 316
           ||||||| ||||||||||||||| || ||||| || | ||| |||| |||||| || |||
Sbjct: 917 tcctcaatgagagtgtcgacagagacaaggtcgtcgacgatggtcatcatgatttgcagc 858

                         
Query: 317 ttnntgatgccata 330
           ||  |||| |||||
Sbjct: 857 ttcttgataccata 844

---

>ref|NM_102762.2| Arabidopsis thaliana translation elongation factor AT1G30230 mRNA,
           complete cds
          Length = 1028

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 568 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 519

---

>ref|XM_479153.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 408 tcatgtcagtctcatcgtcccatggcttga 437
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547

---

>ref|XM_506463.1| PREDICTED Oryza sativa (japonica cultivar-group), P0616D06.117 mRNA
          Length = 1363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 408 tcatgtcagtctcatcgtcccatggcttga 437
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542

---

>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 371   tccatttgaacaccgcggacagcctcctccaacttcttcatgtcagtctcatcgtcccat 430
             ||||| |||||||| || |||||||||||||  |||||||| || || ||||| ||||| 
Sbjct: 11090 tccatctgaacaccacgaacagcctcctccagtttcttcatatcggtttcatcatcccaa 11149

                           
Query: 431   ggcttgatgtccat 444
             ||||| | ||||||
Sbjct: 11150 ggcttaacgtccat 11163



 Score = 44.1 bits (22), Expect = 0.46
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 256   ttcctcaangagagtgtcgacagacacgaggtcatcaatgatcgtcagcatgatctg 312
             |||||||| ||| || || ||||| || |||||||| ||||| || |||||||||||
Sbjct: 10878 ttcctcaatgagggtatccacagagacaaggtcatcgatgatggtaagcatgatctg 10934

---

>emb|BX816984.1|CNS0AE2C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 728

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 353 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 304

---

>emb|BX817009.1|CNS0ABWL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 908

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 546 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 497

---

>emb|BX817138.1|CNS0ABNH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH89ZB09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 559 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 510

---

>gb|AC073506.11|AC073506 Arabidopsis thaliana chromosome 1 BAC F12P21 genomic sequence, complete
             sequence
          Length = 55095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 389   acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
             ||||| ||||| | ||||||||||||||||||||| ||||| || |||||
Sbjct: 19386 acagcttcctcaagcttcttcatgtcagtctcatcatcccacggtttgat 19337

---

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0616D06
          Length = 153800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 408   tcatgtcagtctcatcgtcccatggcttga 437
             ||||||||||||||||||||||||| ||||
Sbjct: 77927 tcatgtcagtctcatcgtcccatggtttga 77956

---

>dbj|AB180443.1| Plutella xylostella eEF-1 beta' mRNA for elongation factor 1 beta',
           complete cds
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtcca 443
           |||||||||||| ||||||||||| ||||||| |||||
Sbjct: 520 cttcatgtcagtttcatcgtcccagggcttgacgtcca 483

---

>dbj|AK071736.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023109L04, full
           insert sequence
          Length = 1364

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 408 tcatgtcagtctcatcgtcccatggcttga 437
           ||||||||||||||||||||||||| ||||
Sbjct: 571 tcatgtcagtctcatcgtcccatggtttga 542

---

>dbj|AK061069.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C03, full
           insert sequence
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 408 tcatgtcagtctcatcgtcccatggcttga 437
           ||||||||||||||||||||||||| ||||
Sbjct: 576 tcatgtcagtctcatcgtcccatggtttga 547

---

>dbj|AK059384.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-G07, full
           insert sequence
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 408 tcatgtcagtctcatcgtcccatggcttga 437
           ||||||||||||||||||||||||| ||||
Sbjct: 193 tcatgtcagtctcatcgtcccatggtttga 164

---

>dbj|D23674.1|RICEF1BRB Oryza sativa (japonica cultivar-group) mRNA for elongation factor 1
           beta, complete cds
          Length = 1420

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 408 tcatgtcagtctcatcgtcccatggcttga 437
           ||||||||||||||||||||||||| ||||
Sbjct: 556 tcatgtcagtctcatcgtcccatggtttga 527

---

>ref|XM_520696.1| PREDICTED: Pan troglodytes similar to bA526D8.4 (novel KRAB box
            containing C2H2 type zinc finger protein) (LOC465235),
            mRNA
          Length = 3627

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            ||||||||||||||||||||| |||||||
Sbjct: 3492 catgtcagtctcatcgtcccaaggcttga 3464

---

>ref|NM_001010925.1| Homo sapiens ankyrin repeat domain 19 (ANKRD19), mRNA
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204

---

>emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chromosome 9 Contains the 5'
              end of the gene for coiled-coil protein (BICD2) (KIAA0699),
              a novel gene, a eukaryotic translation elongation factor 1
              delta (guanine nucleotide exchange protein) (EEF1D)
              pseudogene, the gene for a novel KRAB box-containing C2H2
              type zinc finger protein, a novel gene, a pseudogene
              similar to part of sorting nexin associated golgi protein 1
              (SNAG1), a novel pseudogene, a melanoma antigen pseudogene
              and three CpG islands, complete sequence
          Length = 182280

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 409    catgtcagtctcatcgtcccatggcttga 437
              ||||||||||||||||||||| |||||||
Sbjct: 106674 catgtcagtctcatcgtcccaaggcttga 106702

---

>emb|Z97067.1|BVEF1BETA Beta vulgaris mRNA for elongation factor 1-beta
          Length = 1069

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 388 gacagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgag 447
           |||||| ||||| | |||||||||||| || ||||| ||||||||||| |  ||||  | 
Sbjct: 581 gacagcttcctcaagcttcttcatgtctgtttcatcatcccatggcttcacatccaacaa 522

                                                        
Query: 448 gacagaggatttgccactttctttcttctttgcaggcttggcagc 492
           ||| || || |||||   |||||||||||| |||||||| |||||
Sbjct: 521 gaccgatgacttgcccgattctttcttcttagcaggcttagcagc 477

---

>gb|BC028712.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:27029
            IMAGE:4837806), complete cds
          Length = 2351

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            ||||||||||||||||||||| |||||||
Sbjct: 1366 catgtcagtctcatcgtcccaaggcttga 1394

---

>dbj|AK093497.1| Homo sapiens cDNA FLJ36178 fis, clone TESTI2026534
          Length = 1899

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            ||||||||||||||||||||| |||||||
Sbjct: 994  catgtcagtctcatcgtcccaaggcttga 1022

---

>emb|AL116697.1|CNS01DDT Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 348 catgtcggtctcatcgtcccatggcttga 320

---

>emb|AL116510.1|CNS01D8M Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504

---

>emb|AL116208.1|CNS01D08 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 405 catgtcggtctcatcgtcccatggcttga 377

---

>emb|AL115318.1|CNS01CBI Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 584 catgtcggtctcatcgtcccatggcttga 556

---

>emb|AL114622.1|CNS01BS6 Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 82  catgtcggtctcatcgtcccatggcttga 54

---

>emb|AL114417.1|CNS01BMH Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 551 catgtcggtctcatcgtcccatggcttga 523

---

>emb|AL112302.1|CNS019ZQ Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 532 catgtcggtctcatcgtcccatggcttga 504

---

>emb|AL111685.1|CNS019IL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| ||||||||||||||||||||||
Sbjct: 548 catgtcggtctcatcgtcccatggcttga 520

---

>gb|BC038951.1| Homo sapiens ankyrin repeat domain 19, mRNA (cDNA clone MGC:47831
            IMAGE:5733799), complete cds
          Length = 2285

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            ||||||||||||||||||||| |||||||
Sbjct: 1176 catgtcagtctcatcgtcccaaggcttga 1204

---

>ref|XM_752243.1| Ustilago maydis 521 hypothetical protein (UM01189.1) partial mRNA
          Length = 678

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| |||||||| ||||| |||||||||||
Sbjct: 465 cttcatgtcggtctcatcatcccagggcttgatgtc 430

---

>emb|BX046091.1|CNS097Q7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 591 cttcatgtcggtttcatcgtcccatgccttgatgtc 626

---

>emb|BX046090.1|CNS097Q6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 406 cttcatgtcagtctcatcgtcccatggcttgatgtc 441
           ||||||||| || ||||||||||||| |||||||||
Sbjct: 611 cttcatgtcggtttcatcgtcccatgccttgatgtc 576

---

>emb|X74733.1|ATL1BETA A.thaliana mRNA for elongation factor 1 beta
          Length = 900

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 403 cttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||||||||||||||||||| ||||| || |||||
Sbjct: 525 cttcttcatgtcagtctcatcatcccacggtttgat 490

---

>gb|AC090680.11| Homo sapiens 12 BAC RP11-87P13 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 183896

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 79   aaacaaaaccagtagcatttctgt 102
            ||||||||||||||||||||||||
Sbjct: 7442 aaacaaaaccagtagcatttctgt 7465

---

>emb|BX820768.1|CNS0A8OK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH68ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 558

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccat 444
           ||||| ||||| | |||||||||||| || ||||| ||||| |||||||| |||||
Sbjct: 201 acagcttcctctagcttcttcatgtccgtttcatcatcccacggcttgatatccat 146

---

>gb|AC129594.3| Mus musculus BAC clone RP24-319J19 from chromosome Y, complete sequence
          Length = 147674

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 72    gactcaaaaacaaaaccagtagc 94
             |||||||||||||||||||||||
Sbjct: 97310 gactcaaaaacaaaaccagtagc 97332

---

>gb|AC140925.4| Mus musculus BAC clone RP24-140B17 from chromosome Y, complete sequence
          Length = 172606

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 72     gactcaaaaacaaaaccagtagc 94
              |||||||||||||||||||||||
Sbjct: 145559 gactcaaaaacaaaaccagtagc 145537

---

>gb|AC145266.3| Mus musculus BAC clone RP24-174A3 from chromosome Y, complete sequence
          Length = 143481

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 72    gactcaaaaacaaaaccagtagc 94
             |||||||||||||||||||||||
Sbjct: 38840 gactcaaaaacaaaaccagtagc 38862

---

>gb|AY444796.1| Pisum sativum translational elongation factor 1 subunit Bbeta
           (eEF1Bbeta) mRNA, complete cds
          Length = 709

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 403 cttcttcatgtcagtctcatcgtccca 429
           ||||||||||||||| |||||||||||
Sbjct: 493 cttcttcatgtcagtttcatcgtccca 467

---

>gb|BC055643.1| Danio rerio cDNA clone IMAGE:5915478, **** WARNING: chimeric clone
           ****
          Length = 996

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 453
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 695 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 636

                  
Query: 454 ggatttg 460
           |||||||
Sbjct: 635 ggatttg 629

---

>emb|BX029538.1|CNS08UYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 406 cttcatgtcagtctcatcgtcccatggcttg 436
           ||||||||| || ||||||||||||||||||
Sbjct: 604 cttcatgtcggtttcatcgtcccatggcttg 634

---

>ref|XM_703998.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
           (EF-1-delta), transcript variant 2 (LOC565501), mRNA
          Length = 753

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 453
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 576 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 517

                  
Query: 454 ggatttg 460
           |||||||
Sbjct: 516 ggatttg 510

---

>ref|XM_683289.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
            (EF-1-delta), transcript variant 1 (LOC565501), mRNA
          Length = 1479

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 394  ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 453
            |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 1196 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 1137

                   
Query: 454  ggatttg 460
            |||||||
Sbjct: 1136 ggatttg 1130

---

>gb|AY909456.1| Siniperca chuatsi clone C279 translation elongation factor eEF-1
           delta mRNA, partial cds
          Length = 391

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 307 gatctggagcttnntgatgccataacccacagg 339
           ||||||||||||  ||||||| |||||||||||
Sbjct: 191 gatctggagcttcttgatgccgtaacccacagg 159

---

>gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complete sequence
          Length = 198224

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 72     gactcaaaaacaaaaccagtagc 94
              |||||||||||||||||||||||
Sbjct: 102524 gactcaaaaacaaaaccagtagc 102546

---

>gb|BC096865.1| Danio rerio cold inducible RNA binding protein, mRNA (cDNA clone
           MGC:111981 IMAGE:7401032), complete cds
          Length = 919

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacaga 453
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||
Sbjct: 616 ctcctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatgga 557

                  
Query: 454 ggatttg 460
           |||||||
Sbjct: 556 ggatttg 550

---

>ref|XM_532345.2| PREDICTED: Canis familiaris similar to eukaryotic translation
            elongation factor 1 delta, transcript variant 1
            (LOC475115), mRNA
          Length = 1959

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 416  gtctcatcgtcccatggcttgatgtccatgagga 449
            |||||||||||||| ||||||| ||||| |||||
Sbjct: 1685 gtctcatcgtcccaaggcttgacgtccaggagga 1652

---

>ref|XM_851661.1| PREDICTED: Canis familiaris similar to eukaryotic translation
            elongation factor 1 delta, transcript variant 8
            (LOC475115), mRNA
          Length = 1890

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 416  gtctcatcgtcccatggcttgatgtccatgagga 449
            |||||||||||||| ||||||| ||||| |||||
Sbjct: 1616 gtctcatcgtcccaaggcttgacgtccaggagga 1583

---

>ref|XM_851616.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 7
           (LOC475115), mRNA
          Length = 930

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 416 gtctcatcgtcccatggcttgatgtccatgagga 449
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 656 gtctcatcgtcccaaggcttgacgtccaggagga 623

---

>ref|XM_851583.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 6
           (LOC475115), mRNA
          Length = 891

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 416 gtctcatcgtcccatggcttgatgtccatgagga 449
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 617 gtctcatcgtcccaaggcttgacgtccaggagga 584

---

>ref|XM_851537.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 5
           (LOC475115), mRNA
          Length = 912

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 416 gtctcatcgtcccatggcttgatgtccatgagga 449
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 641 gtctcatcgtcccaaggcttgacgtccaggagga 608

---

>ref|XM_851498.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 4
           (LOC475115), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 416 gtctcatcgtcccatggcttgatgtccatgagga 449
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 605 gtctcatcgtcccaaggcttgacgtccaggagga 572

---

>ref|XM_851462.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           elongation factor 1 delta, transcript variant 3
           (LOC475115), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 416 gtctcatcgtcccatggcttgatgtccatgagga 449
           |||||||||||||| ||||||| ||||| |||||
Sbjct: 605 gtctcatcgtcccaaggcttgacgtccaggagga 572

---

>emb|AL353136.21| Human DNA sequence from clone RP11-133K18 on chromosome X Contains a
              pyruvate kinase muscle (PKM2) pseudogene and the gene for
              ectodysplasin A2 isoform receptor (XEDAR), complete
              sequence
          Length = 192505

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 78     aaaacaaaaccagtagcatttctgta 103
              |||| |||||||||||||||||||||
Sbjct: 186554 aaaaaaaaaccagtagcatttctgta 186529

---

>gb|AY321330.1| Rattus norvegicus Ac2-067 mRNA, complete cds
          Length = 808

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           |||||| | |||| ||||||| |||||||||||||| |||||
Sbjct: 664 ctcctcgagcttcgtcatgtctgtctcatcgtcccaaggctt 623

---

>emb|AJ291984.1|PFL291984 Platichthys flesus partial mRNA for translation elongation factor
           1-delta (ef1D gene)
          Length = 430

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtcca 443
           |||||||| ||||  |||||| |||||||||||||| || |||| |||||
Sbjct: 342 ctcctccagcttcgccatgtccgtctcatcgtcccaaggtttgacgtcca 293

---

>emb|AL645962.22| Mouse DNA sequence from clone RP23-217L7 on chromosome 11 Contains the
             Olfr54 gene for olfactory receptor 54, the gene for a
             novel protein (olfactory receptor MOR126-2 (MOR126-2)) and
             the Zfp354a gene for zinc finger protein 354A, complete
             sequence
          Length = 82484

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 151   aagaatccagcagcaacaggtg 172
             ||||||||||||||||||||||
Sbjct: 37065 aagaatccagcagcaacaggtg 37044

---

>emb|CR387695.1| Gallus gallus finished cDNA, clone ChEST70j23
          Length = 936

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 685 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 644

---

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 416    gtctcatcgtcccatggcttgatgtccatg 445
              ||||| |||||||||||||||| |||||||
Sbjct: 442596 gtctcgtcgtcccatggcttgacgtccatg 442625

---

>emb|BX933683.2| Gallus gallus finished cDNA, clone ChEST942d7
          Length = 820

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 652 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 611

---

>emb|AL116212.1|CNS01D0C Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||| |||||||||||||||||
Sbjct: 405 catgtcggtctnatcgtcccatggcttga 377

---

>emb|BX813340.1|CNS0AC3L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 699

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||||| | ||||||||||| ||||||||| ||||| || |||||
Sbjct: 336 acagcttcctcaagcttcttcatgtaagtctcatcatcccacggtttgat 287

---

>emb|BX818274.1|CNS0AB2B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL6ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||||| | ||||||||||| ||||||||| ||||| || |||||
Sbjct: 517 acagcttcctcaagcttcttcatgtgagtctcatcatcccacggtttgat 468

---

>emb|BX841878.1|CNS09Y45 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 895

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 389 acagcctcctccaacttcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||| ||||| | ||||||||||||||| ||||| ||||| || |||||
Sbjct: 533 acagcttcctcaagcttcttcatgtcagtttcatcatcccacggtttgat 484

---

>emb|BX841873.1|CNS09Y2H Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH57ZC11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 405 tcttcatgtcagtctcatcgtcccatggcttgat 438
           ||||||||||||||||||| ||||| || |||||
Sbjct: 596 tcttcatgtcagtctcatcatcccacggtttgat 563

---

>emb|BX935015.1| Gallus gallus finished cDNA, clone ChEST301p14
          Length = 978

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           |||||||| ||||  ||||||||||||||| ||||| |||||
Sbjct: 731 ctcctccatcttcgccatgtcagtctcatcatcccacggctt 690

---

>ref|XM_342043.2| PREDICTED: Rattus norvegicus similar to eukaryotic translation
           elongation factor 1 beta 2 (LOC361750), mRNA
          Length = 672

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 394 ctcctccaacttcttcatgtcagtctcatcgtcccatggctt 435
           |||||| | |||| ||||||| |||||||||||||| |||||
Sbjct: 474 ctcctcgagcttcgtcatgtctgtctcatcgtcccaaggctt 433

---

>ref|NM_210904.1| Eremothecium gossypii AFR003Cp (AFR003C), mRNA
          Length = 621

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 416 gtctcatcgtcccatggcttgatgtccatg 445
           ||||| |||||||||||||||| |||||||
Sbjct: 401 gtctcgtcgtcccatggcttgacgtccatg 372

---

>gb|AC170424.1| Rhesus Macaque  BAC CH250-53N5 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 175619

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 109571 aaaaccagtagcatttctgta 109551

---

>ref|XM_524853.1| PREDICTED: Pan troglodytes similar to Elongation factor 1-delta
            (EF-1-delta) (Antigen NY-CO-4) (LOC469470), mRNA
          Length = 3660

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            |||||| |||||||||||||| |||||||
Sbjct: 1332 catgtccgtctcatcgtcccaaggcttga 1304

---

>ref|XM_414267.1| PREDICTED: Gallus gallus similar to ring finger protein 123
            (LOC415923), mRNA
          Length = 7740

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 400  caacttcttcatgtcagtctcatcgtccc 428
            |||||||||||| ||||||||| ||||||
Sbjct: 5546 caacttcttcatctcagtctcagcgtccc 5574

---

>gb|DQ440296.1| Aedes aegypti clone AET-374 elongation factor 1 beta/delta chain
           mRNA, complete cds
          Length = 798

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 407 ttcatgtcagtctcatcgtcccatggcttgatgtcca 443
           |||||||| || || || |||||||||||||||||||
Sbjct: 587 ttcatgtcggtttcgtcatcccatggcttgatgtcca 551

---

>gb|AY543685.1| Balanus glandula translation elongation factor mRNA, partial cds
          Length = 315

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                  
Query: 188 tagatcttgttgaaggcnncgatgtcacacgactggacg 226
           |||||||||||||||||  | ||||||  ||||||||||
Sbjct: 314 tagatcttgttgaaggcggcaatgtcaaccgactggacg 276

---

>gb|BC021729.1| Homo sapiens similar to hypothetical protein FLJ20897, mRNA (cDNA
           clone IMAGE:5267252)
          Length = 1330

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 411 tgtcagtctcatcgtcccatggcttgatgtcca 443
           |||| |||||||||||||| ||||||| |||||
Sbjct: 995 tgtccgtctcatcgtcccaaggcttgaagtcca 963

---

>gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence
          Length = 208866

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 29    aattcaactatttaaaggtaa 49
             |||||||||||||||||||||
Sbjct: 14426 aattcaactatttaaaggtaa 14446

---

>gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-259H10, complete
             sequence
          Length = 189134

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 394   ctcctccaacttcttcatgtcagtc 418
             |||||||||| ||||||||||||||
Sbjct: 14005 ctcctccaacctcttcatgtcagtc 14029

---

>emb|AL731568.7| Human DNA sequence from clone RP11-367B6 on chromosome 10 Contains the 5'
              end of the gene for CDA017 protein, a novel gene and a CpG
              island, complete sequence
          Length = 137034

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 131260 aaaaccagtagcatttctgta 131280

---

>emb|AL590229.3| Human DNA sequence from clone RP11-192B18 on chromosome Xq21.1-21.33,
             complete sequence
          Length = 171847

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    aaaaccagtagcatttctgta 103
             |||||||||||||||||||||
Sbjct: 35745 aaaaccagtagcatttctgta 35765

---

>emb|AL512627.6| Human DNA sequence from clone RP11-21A16 on chromosome 10 Contains a
            CpG island, complete sequence
          Length = 27079

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 83   aaaaccagtagcatttctgta 103
            |||||||||||||||||||||
Sbjct: 5252 aaaaccagtagcatttctgta 5272

---

>emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on chromosome 1 Contains a
              novel gene and the 3' end of a variant of novel gene
              (MGC22773), complete sequence
          Length = 169434

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 125909 aaaaccagtagcatttctgta 125889

---

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 455     gatttgccactttctttcttctttg 479
               |||||||||||||| ||||||||||
Sbjct: 2784956 gatttgccactttccttcttctttg 2784980

---

>emb|CR354438.9| Zebrafish DNA sequence from clone CH211-243G16 in linkage group 8,
              complete sequence
          Length = 136324

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1      atgttttgccattacaaactg 21
              |||||||||||||||||||||
Sbjct: 107685 atgttttgccattacaaactg 107665

---

>emb|AL833768.1|HSM805081 Homo sapiens mRNA; cDNA DKFZp666K117 (from clone DKFZp666K117)
          Length = 3298

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 411  tgtcagtctcatcgtcccatggcttgatgtcca 443
            |||| |||||||||||||| ||||||| |||||
Sbjct: 3009 tgtccgtctcatcgtcccaaggcttgaagtcca 2977

---

>gb|AC022098.9| Homo sapiens chromosome 19 clone CTB-55O6, complete sequence
          Length = 237931

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 409    catgtcagtctcatcgtcccatggcttga 437
              |||||| |||||||||||||| |||||||
Sbjct: 108404 catgtccgtctcatcgtcccaaggcttga 108376

---

>gb|AC099507.3| Homo sapiens chromosome 5 clone RP11-24H18, complete sequence
          Length = 187386

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 83    aaaaccagtagcatttctgta 103
             |||||||||||||||||||||
Sbjct: 48527 aaaaccagtagcatttctgta 48507

---

>gb|AC087490.6| Homo sapiens chromosome 15, clone RP11-810H22, complete sequence
          Length = 183342

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 135118 aaaaccagtagcatttctgta 135138

---

>gb|AC103750.2| Homo sapiens chromosome 15, clone RP11-494F2, complete sequence
          Length = 179486

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 132613 aaaaccagtagcatttctgta 132593

---

>gb|AC010362.6| Homo sapiens chromosome 5 clone CTD-2037I18, complete sequence
          Length = 133769

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 133188 aaaaccagtagcatttctgta 133168

---

>gb|AC098976.2| Homo sapiens BAC clone RP11-751L19 from 4, complete sequence
          Length = 165221

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 135190 aaaaccagtagcatttctgta 135210

---

>ref|XM_944722.1| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 8
           (LOC126037), mRNA
          Length = 944

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 621 catgtccgtctcatcgtcccaaggcttga 593

---

>ref|XM_944719.1| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 7
           (LOC126037), mRNA
          Length = 931

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 608 catgtccgtctcatcgtcccaaggcttga 580

---

>ref|XM_944718.1| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 6
           (LOC126037), mRNA
          Length = 513

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 215 catgtccgtctcatcgtcccaaggcttga 187

---

>ref|XM_940654.1| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 5
           (LOC126037), mRNA
          Length = 1021

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 698 catgtccgtctcatcgtcccaaggcttga 670

---

>ref|XM_934766.1| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 4
           (LOC126037), mRNA
          Length = 944

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 621 catgtccgtctcatcgtcccaaggcttga 593

---

>ref|XM_934764.1| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 3
           (LOC126037), mRNA
          Length = 931

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 608 catgtccgtctcatcgtcccaaggcttga 580

---

>ref|XM_934762.1| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 2
           (LOC126037), mRNA
          Length = 513

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 215 catgtccgtctcatcgtcccaaggcttga 187

---

>ref|XM_058967.12| PREDICTED: Homo sapiens similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4), transcript variant 1
           (LOC126037), mRNA
          Length = 1021

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 409 catgtcagtctcatcgtcccatggcttga 437
           |||||| |||||||||||||| |||||||
Sbjct: 698 catgtccgtctcatcgtcccaaggcttga 670

---

>ref|XM_695588.1| PREDICTED: Danio rerio similar to Elongation factor 1-delta
           (EF-1-delta) (Antigen NY-CO-4) (LOC571942), partial mRNA
          Length = 621

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 396 cctccaacttcttcatgtcagtctcatcgtcccatggcttgatgtccatgaggacagagg 455
           |||||| ||||  |||||| |||||||||||||| || |||| |||||  ||||  ||||
Sbjct: 336 cctccagcttcgacatgtccgtctcatcgtcccaaggtttgacgtccagcaggatggagg 277

                
Query: 456 atttg 460
           |||||
Sbjct: 276 atttg 272

---

>gb|AC009075.7| Homo sapiens chromosome 16 clone RP11-328J14, complete sequence
          Length = 189983

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 394   ctcctccaacttcttcatgtcagtc 418
             |||||||||| ||||||||||||||
Sbjct: 40493 ctcctccaacctcttcatgtcagtc 40469

---

>dbj|AB169168.1| Macaca fascicularis testis cDNA, clone: QtsA-17735, similar to human
            eukaryotic translation elongation factor 1 delta(guanine
            nucleotide exchange protein) (EEF1D), transcriptvariant
            1, mRNA, RefSeq: NM_032378.2
          Length = 2181

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            |||||| |||||||||||||| |||||||
Sbjct: 1880 catgtccgtctcatcgtcccaaggcttga 1852

---

>dbj|AB179332.1| Macaca fascicularis testis cDNA clone: QtsA-17735, similar to human
            eukaryotic translation elongation factor 1 delta(guanine
            nucleotide exchange protein) (EEF1D), transcriptvariant
            1, mRNA, RefSeq: NM_032378.2
          Length = 2181

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 409  catgtcagtctcatcgtcccatggcttga 437
            |||||| |||||||||||||| |||||||
Sbjct: 1880 catgtccgtctcatcgtcccaaggcttga 1852

---

>gb|AC010429.6|AC010429 Homo sapiens chromosome 5 clone CTD-2199L14, complete sequence
          Length = 133769

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     aaaaccagtagcatttctgta 103
              |||||||||||||||||||||
Sbjct: 133188 aaaaccagtagcatttctgta 133168

---

>gb|AC008220.5|AC008220 Drosophila melanogaster, chromosome 3R, region 100B-100C, BAC clone
             BACR11C03, complete sequence
          Length = 186549

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 29    aattcaactatttaaaggtaa 49
             |||||||||||||||||||||
Sbjct: 12367 aattcaactatttaaaggtaa 12387

---

>gb|AC007975.7|AC007975 Drosophila melanogaster, chromosome 3R, region 100A-100B, BAC clone
              BACR06P08, complete sequence
          Length = 180630

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 29     aattcaactatttaaaggtaa 49
              |||||||||||||||||||||
Sbjct: 134414 aattcaactatttaaaggtaa 134434

---

>ref|NM_145293.2| Homo sapiens similar to hypothetical protein FLJ20897 (LOC196549),
            mRNA
          Length = 3298

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 411  tgtcagtctcatcgtcccatggcttgatgtcca 443
            |||| |||||||||||||| ||||||| |||||
Sbjct: 3009 tgtccgtctcatcgtcccaaggcttgaagtcca 2977

---

>dbj|BS000210.2| Pan troglodytes chromosome 22 clone:RP43-018H16, map 22, complete
             sequences
          Length = 148120

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 83    aaaaccagtagcatttctgta 103
             |||||||||||||||||||||
Sbjct: 53593 aaaaccagtagcatttctgta 53573

---

>emb|AL590078.2|HS381K22 Homo sapiens chromosome 9 BAC RP11-381K22, complete sequence
          Length = 203175

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    aaaaccagtagcatttctgta 103
             |||||||||||||||||||||
Sbjct: 79891 aaaaccagtagcatttctgta 79911

---

>emb|CR848705.13| Zebrafish DNA sequence from clone DKEY-8O15 in linkage group 11,
             complete sequence
          Length = 261584

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 29    aattcaactatttaaaggtaa 49
             |||||||||||||||||||||
Sbjct: 67398 aattcaactatttaaaggtaa 67418

---

>gb|AE003776.2| Drosophila melanogaster chromosome 3R, section 114 of 118 of the complete
              sequence
          Length = 225764

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 29     aattcaactatttaaaggtaa 49
              |||||||||||||||||||||
Sbjct: 129040 aattcaactatttaaaggtaa 129060

---

>dbj|AP001011.6| Homo sapiens genomic DNA, chromosome 18 clone:RP11-703M24, complete
             sequence
          Length = 204777

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    aaaaccagtagcatttctgta 103
             |||||||||||||||||||||
Sbjct: 92811 aaaaccagtagcatttctgta 92831

---

>gb|AC002525.1|AC002525 Human PAC clone 257C22A from 13q12-q13, complete sequence
          Length = 140942

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 411   tgtcagtctcatcgtcccatggcttgatgtcca 443
             |||| |||||||||||||| ||||||| |||||
Sbjct: 81319 tgtccgtctcatcgtcccaaggcttgaagtcca 81287

---

>ref|NM_121249.2| Arabidopsis thaliana translation elongation factor AT5G12110 mRNA,
           complete cds
          Length = 892

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 401 aacttcttcatgtcagtctcatcgtcccatgg 432
           |||||||||||||| || ||||| ||||||||
Sbjct: 475 aacttcttcatgtcggtttcatcatcccatgg 444

---

>gb|AC102320.6| Mus musculus chromosome 1, clone RP24-459A11, complete sequence
          Length = 121264

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    actcaaaaacaaaaccagta 92
             ||||||||||||||||||||
Sbjct: 88009 actcaaaaacaaaaccagta 87990

---

>gb|AC152821.5| Mus musculus BAC clone RP24-366H21 from chromosome y, complete sequence
          Length = 179613

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    gactcaaaaacaaaaccagt 91
             ||||||||||||||||||||
Sbjct: 70656 gactcaaaaacaaaaccagt 70637


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,234,079
Number of Sequences: 3902068
Number of extensions: 7234079
Number of successful extensions: 146376
Number of sequences better than 10.0: 440
Number of HSP's better than 10.0 without gapping: 442
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 145400
Number of HSP's gapped (non-prelim): 974
length of query: 530
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 507
effective length of database: 17,143,297,704
effective search space: 8691651935928
effective search space used: 8691651935928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---