| Clone Name | rbah59n08 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|L36959.1|BLYCA Hordeum vulgare carbonic anhydrase mRNA, compl... | 448 | e-123 | 2 | emb|AL079341.19|HSDJ319M7 Human DNA sequence from clone RP1-319M... | 40 | 3.6 |
|---|
>gb|L36959.1|BLYCA Hordeum vulgare carbonic anhydrase mRNA, complete cds Length = 1529 Score = 448 bits (226), Expect = e-123 Identities = 262/276 (94%), Gaps = 1/276 (0%) Strand = Plus / Minus Query: 1 aacttatatatnaagtctttcgatcacaaggacgatcaaattatgcatcacatagcagta 60 ||||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1469 aacttatatatgatgtctttcgatcacaag-acgatcaaattatgcatcacatagcagta 1411 Query: 61 caattcctcgtcagaaaatggtgaagnnnnnnnggttctattgcttatggcaaattcaca 120 |||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 1410 caattcctcgtcagaaaatggtgaagaaaaaaaggttctattgcttatggcaaattcaca 1351 Query: 121 tcgggccatccggcatccagtactggacaataacgggtacgcactcccatggcattgcat 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1350 tcgggccatccggcatccagtactggacaataacgggtacgcactcccatggcattgcat 1291 Query: 181 tcacatcgatcggacgatatcttgatatatgtncgngggtatatgtcggagttaaccggt 240 |||||||||||||||||||||||||||||||| || |||||||||||||||||||||| Sbjct: 1290 tcacatcgatcggacgatatcttgatatatgtacgtttgtatatgtcggagttaaccggt 1231 Query: 241 ggggaagatttactgctcccatgtttcgaacttgcc 276 |||||||||||||||||||||||||||||||||||| Sbjct: 1230 ggggaagatttactgctcccatgtttcgaacttgcc 1195
>emb|AL079341.19|HSDJ319M7 Human DNA sequence from clone RP1-319M7 on chromosome 6p21.1-21.3 Contains the 5' end of the gene for a novel protein (contains KIAA1880 and FLJ32945), a TRK-fused gene (TFG) pseudogene and a CpG island, complete sequence Length = 128216 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 ttctattgcttatggcaaat 115 |||||||||||||||||||| Sbjct: 55862 ttctattgcttatggcaaat 55881 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,441,975 Number of Sequences: 3902068 Number of extensions: 1441975 Number of successful extensions: 19405 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 19399 Number of HSP's gapped (non-prelim): 4 length of query: 276 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 254 effective length of database: 17,147,199,772 effective search space: 4355388742088 effective search space used: 4355388742088 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)