>gb|AF109194.1|AF109194 Hordeum vulgare glutathione-S-transferase mRNA, complete cds
          Length = 1092

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 19   aaatggngtcncaggnggcaactcggtgctgcccccaccgaagaccagggttgacacttg 78
            ||||||  || |||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 1002 aaatggaatcgcaggtggcaactcggtgctgcccccaccgaagaccagggttgacacatg 943

                 
Query: 79   acaca 83
            |||||
Sbjct: 942  acaca 938

>emb|AJ414697.1|TAE414697 Triticum aestivum mRNA for glutathione transferase (gstu1A gene)
          Length = 1085

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 53/55 (96%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                   
Query: 30   caggnggcaactcggtgctgcccccaccgaagaccagggttgacac-ttgacaca 83
            |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1011 caggtggcaactcggtgctgcccccaccgaagaccagggttgacacattgacaca 957

>gb|BT009437.1| Triticum aestivum clone wlmk4.pk0012.c2:fis, full insert mRNA
           sequence
          Length = 1966

 Score = 46.1 bits (23), Expect = 0.023
 Identities = 36/39 (92%), Gaps = 1/39 (2%)
 Strand = Plus / Minus

                                                  
Query: 46  gctgcccccaccgaagaccagggttgacac-ttgacaca 83
           |||||| |||| |||||||||||||||||| ||||||||
Sbjct: 990 gctgccaccactgaagaccagggttgacacattgacaca 952

>gb|AY550532.1| Salmo salar clone Hae459R microsatellite sequence
          Length = 463

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 37 caactcggtgctgcccccacc 57
          |||||||||||||||||||||
Sbjct: 76 caactcggtgctgcccccacc 96

>gb|AC121781.3| Mus musculus BAC clone RP23-363D24 from chromosome X, complete sequence
          Length = 174187

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    acacatgacacacacagaga 98
             ||||||||||||||||||||
Sbjct: 77184 acacatgacacacacagaga 77203

>emb|BX294154.1| Pirellula sp. strain 1 complete genome; segment 22/24
          Length = 299050

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 36     gcaactcggtgctgcccccaccga 59
              |||||||||||||||| |||||||
Sbjct: 157810 gcaactcggtgctgcctccaccga 157833

>gb|AC023686.4| Drosophila melanogaster X BAC RP98-30C1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170626

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    tgacacttgacacatgacac 89
             ||||||||||||||||||||
Sbjct: 52019 tgacacttgacacatgacac 52000

>gb|AC025262.27|AC025262 Homo sapiens 12 BAC RP11-629N8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 167276

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 59     aagaccagggttgacacttg 78
              ||||||||||||||||||||
Sbjct: 163453 aagaccagggttgacacttg 163434

>gb|AC023701.4| Drosophila melanogaster X BAC RP98-29B16 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 198245

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    tgacacttgacacatgacac 89
             ||||||||||||||||||||
Sbjct: 73990 tgacacttgacacatgacac 74009

>gb|AC167565.1| Mus musculus BAC clone RP24-84D8 from chromosome 14, complete sequence
          Length = 199101

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 69     ttgacacttgacacatgaca 88
              ||||||||||||||||||||
Sbjct: 159355 ttgacacttgacacatgaca 159336

>gb|AC105300.24| Mus musculus strain C57BL/6J clone rp23-291e5 map 17, complete sequence
          Length = 168882

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 72     acacttgacacatgacacacacag 95
              |||| |||||||||||||||||||
Sbjct: 141260 acacatgacacatgacacacacag 141283

>gb|AC154412.3| Mus musculus BAC clone RP24-225G4 from 14, complete sequence
          Length = 182048

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    ttgacacttgacacatgaca 88
             ||||||||||||||||||||
Sbjct: 13049 ttgacacttgacacatgaca 13030

>gb|AE003432.5| Drosophila melanogaster chromosome X, section 16 of 74 of the complete
              sequence
          Length = 319328

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     tgacacttgacacatgacac 89
              ||||||||||||||||||||
Sbjct: 287607 tgacacttgacacatgacac 287588

>dbj|AP002342.3| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2258N2, complete
             sequences
          Length = 174548

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    caactcggtgctgcccccac 56
             ||||||||||||||||||||
Sbjct: 75707 caactcggtgctgcccccac 75688

>gb|AC154579.3| Mus musculus BAC clone RP23-376B1 from chromosome 17, complete sequence
          Length = 193686

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 72     acacttgacacatgacacacacag 95
              |||| |||||||||||||||||||
Sbjct: 190977 acacatgacacatgacacacacag 190954

>emb|AL845264.18| Mouse DNA sequence from clone RP23-116F18 on chromosome 2, complete
              sequence
          Length = 207724

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     acacatgacacacacagaga 98
              ||||||||||||||||||||
Sbjct: 183852 acacatgacacacacagaga 183871

>emb|BX005240.7| Mouse DNA sequence from clone RP23-185M16 on chromosome X, complete
             sequence
          Length = 197310

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    acacatgacacacacagaga 98
             ||||||||||||||||||||
Sbjct: 59239 acacatgacacacacagaga 59220

>gb|AY244454.1| Halichondria panicea microsatellite Hapa37 sequence
          Length = 443

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 72  acacttgacacatgacacacaca 94
           |||| ||||||||||||||||||
Sbjct: 178 acacatgacacatgacacacaca 200

>emb|AL603913.14| Mouse DNA sequence from clone RP23-103H9 on chromosome 11 Contains the
             gene for a novel protein (3732413I11Rik), a novel gene
             (4930597A21Rik), the 5' end of the Ebf1 gene for early
             B-cell factor 1, a novel gene and a CpG island, complete
             sequence
          Length = 215524

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 26/27 (96%), Gaps = 1/27 (3%)
 Strand = Plus / Plus

                                        
Query: 72    acacttgacacatgacacacacagaga 98
             ||||||||||||| |||||||||||||
Sbjct: 32638 acacttgacacat-acacacacagaga 32663

>gb|AC010433.9| Homo sapiens chromosome 5 clone CTD-2202L20, complete sequence
          Length = 258929

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 70     tgacacttgacacatgacacaca 92
              |||||| ||||||||||||||||
Sbjct: 217167 tgacacatgacacatgacacaca 217189

>gb|AC023748.4| Drosophila melanogaster X BAC RP98-36F8 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 156096

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 71    gacacttgacacatgacacacac 93
             |||||||||||| ||||||||||
Sbjct: 70790 gacacttgacacttgacacacac 70768

>gb|AC023724.5| Drosophila melanogaster X BAC RP98-14B2 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 181974

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 71    gacacttgacacatgacacacac 93
             |||||||||||| ||||||||||
Sbjct: 38725 gacacttgacacttgacacacac 38703

>gb|AC154727.2| Mus musculus BAC clone RP24-375I15 from 14, complete sequence
          Length = 189907

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 79     acacatgacacacacagag 97
              |||||||||||||||||||
Sbjct: 144336 acacatgacacacacagag 144318

>gb|AE003445.2| Drosophila melanogaster chromosome X, section 29 of 74 of the complete
              sequence
          Length = 334222

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 71     gacacttgacacatgacacacac 93
              |||||||||||| ||||||||||
Sbjct: 115598 gacacttgacacttgacacacac 115620


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 752,516
Number of Sequences: 3902068
Number of extensions: 752516
Number of successful extensions: 91129
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 91064
Number of HSP's gapped (non-prelim): 72
length of query: 121
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 100
effective length of database: 17,151,101,840
effective search space: 1715110184000
effective search space used: 1715110184000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)