>gb|AC087399.7| Homo sapiens chromosome 18, clone RP11-451L19, complete sequence
          Length = 171320

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 89     ccacccagaaccaaaccaaa 108
              ||||||||||||||||||||
Sbjct: 145344 ccacccagaaccaaaccaaa 145325

>emb|AL596218.4| Human DNA sequence from clone RP11-6J21 on chromosome 1 Contains a
              complement component 4 binding protein pseudogene, a novel
              gene and the 3' end of the DAF gene for decay accelerating
              factor for complement (CD55 Cromer blood group system),
              complete sequence
          Length = 130935

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 1      tttacatagggctgctaatctca 23
              |||| ||||||||||||||||||
Sbjct: 119770 tttaaatagggctgctaatctca 119792

>emb|AL158038.10| Human DNA sequence from clone RP11-298H15 on chromosome 13q21.1-21.3,
              complete sequence
          Length = 160015

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      tttacatagggctgctaat 19
              |||||||||||||||||||
Sbjct: 127491 tttacatagggctgctaat 127473

>gb|AC150891.3| Medicago truncatula chromosome 2 BAC clone mth2-76a9, complete sequence
          Length = 142579

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 63     attacatgtattgcatcta 81
              |||||||||||||||||||
Sbjct: 104439 attacatgtattgcatcta 104457

>gb|AY785950.1| Salmo salar zonadhesin-like gene, complete cds and 3' UTR
          Length = 138345

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     tacatagggctgctaatct 21
             |||||||||||||||||||
Sbjct: 19043 tacatagggctgctaatct 19025

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 38.2 bits (19), Expect = 8.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 92      cccagaaccaaaccaaaac 110
               |||||||||||||||||||
Sbjct: 2666566 cccagaaccaaaccaaaac 2666584


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 799,128
Number of Sequences: 3902068
Number of extensions: 799128
Number of successful extensions: 62671
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62633
Number of HSP's gapped (non-prelim): 38
length of query: 168
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 146
effective length of database: 17,147,199,772
effective search space: 2503491166712
effective search space used: 2503491166712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)