ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf180j13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK243255.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 50 0.007
2emb|AL732347.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 50 0.007
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
4emb|AL606686.3|OSJN00084 Oryza sativa genomic DNA, chromosome 4,... 50 0.007
5emb|AL606651.3|OSJN00092 Oryza sativa genomic DNA, chromosome 4,... 50 0.007
6gb|AY998670.1| Heroina isonycterina isolate 1157 cytochrome b ge... 46 0.11
7gb|AC024706.6| Homo sapiens BAC clone RP11-119J20 from 4, comple... 46 0.11
8gb|AC190114.4| Canis Familiaris chromosome 2, clone XX-440P16, c... 44 0.42
9gb|AC187001.7| Canis Familiaris chromosome 2, clone XX-425F13, c... 44 0.42
10gb|AC186064.6| Canis Familiaris chromosome 2, clone XX-149D17, c... 44 0.42
11gb|AC123832.4| Mus musculus BAC clone RP24-126O19 from chromosom... 44 0.42
12emb|AL121747.41|HSDJ852M4 Human DNA sequence from clone RP5-852M... 44 0.42
13emb|AL645934.7| Mouse DNA sequence from clone RP23-27P11 on chro... 44 0.42
14gb|AC018685.12| Homo sapiens BAC clone RP11-455M16 from 2, compl... 44 0.42
15gb|AF018596.1|AF018596 Centropomus mexicanus cytochrome b gene, ... 44 0.42
16gb|AF018595.1|AF018595 Centropomus mexicanus cytochrome b gene, ... 44 0.42
17gb|AF018594.1|AF018594 Centropomus parallelus cytochrome b gene,... 44 0.42
18gb|AF018572.1|AF018572 Centropomus pectinatus cytochrome b gene,... 44 0.42
19gb|AF018571.1|AF018571 Centropomus pectinatus cytochrome b gene,... 44 0.42
20gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete s... 42 1.7
21gb|AE014297.2| Drosophila melanogaster chromosome 3R, complete s... 42 1.7
22ref|NM_118809.3| Arabidopsis thaliana unknown protein (AT4G26750... 42 1.7
23gb|AC151782.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 1.7
24gb|AC124976.9| Mus musculus chromosome 3, clone RP24-84E6, compl... 42 1.7
25gb|AF301594.1| Triatoma dimidiata mitochondrial DNA, complete ge... 42 1.7
26gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's ... 42 1.7
27gb|AC006467.13| Drosophila melanogaster clone BACR03L08, complet... 42 1.7
28gb|AC150553.1| Drosophila melanogaster clone BACR09H20, complete... 42 1.7
29gb|AC099863.14| Mus musculus chromosome 3, clone RP23-6F2, compl... 42 1.7
30gb|AC146118.3| Pan troglodytes BAC clone RP43-23A6 from 7, compl... 42 1.7
31gb|AC122239.4| Mus musculus BAC clone RP23-143K14 from chromosom... 42 1.7
32gb|AC122002.2| Mus musculus BAC clone RP24-335H15 from 7, comple... 42 1.7
33gb|AC115750.9| Mus musculus chromosome 10, clone RP23-16F5, comp... 42 1.7
34gb|AC153013.3| Mus musculus BAC clone RP23-273N8 from chromosome... 42 1.7
35gb|AY094009.1| Arabidopsis thaliana AT4g26750/F10M23_90 mRNA, co... 42 1.7
36dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
37emb|CR848038.1| Chlamydophila abortus strain S26/3, complete genome 42 1.7
38gb|AC134432.4| Mus musculus BAC clone RP24-389K11 from chromosom... 42 1.7
39ref|XM_648838.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 42 1.7
40gb|AF380781.1|AF380781 Pseudoeurycea leprosa clone e33.36 cytoch... 42 1.7
41gb|AF380778.1|AF380778 Pseudoeurycea leprosa clone e33.45 cytoch... 42 1.7
42gb|AY048219.1| Arabidopsis thaliana AT4g26750/F10M23_90 mRNA, co... 42 1.7
43emb|CR382400.1| Plasmodium falciparum chromosome 6, complete seq... 42 1.7
44emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, ... 42 1.7
45emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, B... 42 1.7
46dbj|AP003450.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
47gb|AC011253.4|AC011253 Drosophila melanogaster, chromosome 3R, r... 42 1.7
48emb|BX826728.1|CNS0A3ZF Arabidopsis thaliana Full-length cDNA Co... 42 1.7
49emb|BX826584.1|CNS0A453 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
50emb|BX826538.1|CNS0A410 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
51emb|BX826452.1|CNS0A3Z8 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
52emb|BX828244.1|CNS0A3RZ Arabidopsis thaliana Full-length cDNA Co... 42 1.7
53emb|BX828199.1|CNS0A3V4 Arabidopsis thaliana Full-length cDNA Co... 42 1.7
54emb|BX827593.1|CNS0A3PC Arabidopsis thaliana Full-length cDNA Co... 42 1.7
55emb|BX827333.1|CNS0A3PO Arabidopsis thaliana Full-length cDNA Co... 42 1.7
56emb|BX828334.1|CNS0A2EG Arabidopsis thaliana Full-length cDNA Co... 42 1.7
57gb|DQ266374.1| Ixodes ricinus ricinusin mRNA, complete cds 42 1.7
58gb|AC109281.5| Mus musculus chromosome 3, clone RP24-66E21, comp... 42 1.7
59gb|AC153929.3| Mus musculus 10 BAC RP24-364H18 (Roswell Park Can... 42 1.7
60ref|XM_725186.1| Plasmodium yoelii yoelii str. 17XNL cell divisi... 42 1.7
61ref|XM_672255.1| Plasmodium berghei strain ANKA ATPase (PB000861... 42 1.7
62gb|AC142104.4| Mus musculus BAC clone RP24-313C11 from 8, comple... 42 1.7
63emb|AL845263.10| Mouse DNA sequence from clone RP23-337L20 on ch... 42 1.7
64emb|AL669834.10| Mouse DNA sequence from clone RP23-114O4 on chr... 42 1.7
65gb|AC090349.8| Homo sapiens chromosome 18, clone RP11-844N22, co... 40 6.6
66emb|CT027552.11| Zebrafish DNA sequence from clone DKEY-7C22 in ... 40 6.6
67emb|CR735105.10| Zebrafish DNA sequence from clone DKEY-202E11 i... 40 6.6
68ref|XM_001151807.1| PREDICTED: Pan troglodytes hypothetical prot... 40 6.6
69gb|AC190267.1| Gallus gallus chromosome Z clone CH261-44B21, com... 40 6.6
70gb|AC187520.3| Pan troglodytes BAC clone CH251-641K22 from chrom... 40 6.6
71ref|XM_001061937.1| PREDICTED: Rattus norvegicus similar to HCDI... 40 6.6
72ref|XM_341321.3| PREDICTED: Rattus norvegicus similar to HCDI pr... 40 6.6
73ref|XM_001099875.1| PREDICTED: Macaca mulatta AMMECR1 protein (A... 40 6.6
74gb|AC186760.1| Pongo pygmaeus abelii chromosome UNK clone CH276-... 40 6.6
75ref|XM_969374.1| PREDICTED: Tribolium castaneum similar to IQ mo... 40 6.6
76gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome... 40 6.6
77gb|AC164094.5| Mus musculus BAC clone RP23-133F10 from chromosom... 40 6.6
78gb|AC126540.3| Ciona savignyi, clone XX-4791757C3, complete sequ... 40 6.6
79gb|AC130812.2| Ciona savignyi, clone XX-4785757L22, complete seq... 40 6.6
80gb|AF288738.1| Homo sapiens epidermal growth factor receptor (EG... 40 6.6
81gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, com... 40 6.6
82gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 40 6.6
83gb|AC102438.8| Mus musculus chromosome 5, clone RP24-137F10, com... 40 6.6
84gb|AC115922.9| Mus musculus chromosome 7, clone RP24-505K11, com... 40 6.6
85ref|NM_015365.2| Homo sapiens Alport syndrome, mental retardatio... 40 6.6
86ref|NM_001025580.1| Homo sapiens Alport syndrome, mental retarda... 40 6.6
87gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, com... 40 6.6
88gb|BT013505.1| Lycopersicon esculentum clone 132193F, mRNA sequence 40 6.6
89gb|AY196160.1| Solanum tuberosum nematode resistance-like protei... 40 6.6
90gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, com... 40 6.6
91gb|AY588246.1| Homo sapiens epidermal growth factor receptor (er... 40 6.6
92ref|XM_549183.2| PREDICTED: Canis familiaris similar to AMME syn... 40 6.6
93ref|XM_858227.1| PREDICTED: Canis familiaris similar to AMME syn... 40 6.6
94ref|XM_858211.1| PREDICTED: Canis familiaris similar to AMME syn... 40 6.6
95ref|XM_858187.1| PREDICTED: Canis familiaris similar to AMME syn... 40 6.6
96gb|AC083880.5| Homo sapiens BAC clone RP11-634H22 from 7, comple... 40 6.6
97gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome... 40 6.6
98gb|AC124563.4| Mus musculus BAC clone RP23-206B15 from chromosom... 40 6.6
99gb|AC121854.2| Mus musculus BAC clone RP24-97A15 from 7, complet... 40 6.6
100gb|AC004926.2| Homo sapiens PAC clone RP5-910H9 from 7, complete... 40 6.6
101gb|AF098985.2| Caenorhabditis elegans cosmid C08G5, complete seq... 40 6.6
102gb|AC165290.2| Mus musculus BAC clone RP23-343A4 from chromosome... 40 6.6
103gb|BC060813.1| Homo sapiens Alport syndrome, mental retardation,... 40 6.6
104gb|AC110062.4| Homo sapiens chromosome 18, clone CTD-2125N24, co... 40 6.6
105gb|AC117403.4| Homo sapiens 12 BAC RP11-239E14 (Roswell Park Can... 40 6.6
106gb|AC115100.3| Homo sapiens chromosome 18, clone RP11-237L15, co... 40 6.6
107gb|AC015820.10| Homo sapiens chromosome 11, clone RP11-108G3, co... 40 6.6
108gb|AC007566.2| Homo sapiens BAC clone CTB-10G5 from 7q21-7q22, c... 40 6.6
109gb|AC093878.3| Homo sapiens BAC clone RP11-638O6 from 4, complet... 40 6.6
110gb|AC021651.17| Homo sapiens 12 BAC RP11-498B21 (Roswell Park Ca... 40 6.6
111dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
112gb|AC100806.2| Homo sapiens chromosome 18, clone CTB-2341H11, co... 40 6.6
113gb|AC013477.7| Homo sapiens BAC clone RP11-559F19 from 4, comple... 40 6.6
114emb|AL356969.12| Human DNA sequence from clone RP11-411F9 on chr... 40 6.6
115gb|AC091317.3| Homo sapiens chromosome 18, clone CTD-2338I4, com... 40 6.6
116emb|AL031319.5|HS364I1 Human DNA sequence from clone RP3-364I1 o... 40 6.6
117gb|AC160247.2| Pan troglodytes BAC clone CH251-540N18 from chrom... 40 6.6
118gb|AC007768.5| Homo sapiens chromosome 18, clone RP11-540M4, com... 40 6.6
119gb|AC080004.12| Homo sapiens 3q BAC RP11-307O15 (Roswell Park Ca... 40 6.6
120gb|AF380786.1|AF380786 Pseudoeurycea smithi clone e15.4 cytochro... 40 6.6
121gb|AF380780.1|AF380780 Pseudoeurycea leprosa clone e33.44 cytoch... 40 6.6
122gb|AF380779.1|AF380779 Pseudoeurycea leprosa clone e15.3 cytochr... 40 6.6
123gb|AF380777.1|AF380777 Pseudoeurycea leprosa clone e33.16 cytoch... 40 6.6
124gb|AF380776.1|AF380776 Pseudoeurycea leprosa clone e33.1 cytochr... 40 6.6
125gb|AF380769.1|AF380769 Lineatriton lineolus clone e35.12 cytochr... 40 6.6
126gb|AF380768.1|AF380768 Lineatriton lineolus clone eE37.5 cytochr... 40 6.6
127gb|AF380764.1|AF380764 Lineatriton lineolus clone ee35.10 cytoch... 40 6.6
128gb|AF380762.1|AF380762 Lineatriton lineolus clone e35.11 cytochr... 40 6.6
129gb|AF380761.1|AF380761 Lineatriton lineolus clone e34.7 cytochro... 40 6.6
130gb|AF380760.1|AF380760 Lineatriton lineolus clone e34.4 cytochro... 40 6.6
131gb|AF380759.1|AF380759 Lineatriton lineolus clone e33.5 cytochro... 40 6.6
132gb|AF380758.1|AF380758 Lineatriton lineolus clone e33.6 cytochro... 40 6.6
133emb|CR858935.1| Pongo pygmaeus mRNA; cDNA DKFZp469O0323 (from cl... 40 6.6
134emb|AJ007014.1|HSA7014 Homo sapiens mRNA for AMMECR1 protein 40 6.6
135emb|AL645994.7| Mouse DNA sequence from clone RP23-104F14 on chr... 40 6.6
136emb|AL929371.6| Mouse DNA sequence from clone RP23-176O5 on chro... 40 6.6
137emb|BX510646.5| Zebrafish DNA sequence from clone CH211-221B16 i... 40 6.6
138gb|AF451203.1| Pseudoeurycea smithi clone e34.1 cytochrome b (Cy... 40 6.6
139gb|AC108134.3| Homo sapiens chromosome 16 clone RP11-473M20, com... 40 6.6
140gb|AC021631.6|AC021631 Mus musculus, clone RP23-38J11, complete ... 40 6.6
141dbj|AP006068.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
142dbj|AP004865.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
143gb|AC016907.6| Homo sapiens BAC clone RP11-439P4 from 2, complet... 40 6.6
144gb|AC015978.4|AC015978 Homo sapiens BAC clone RP11-529I21 from Y... 40 6.6
145gb|AC007241.3|AC007241 Homo sapiens BAC clone RP11-157F24 from Y... 40 6.6
146gb|AC006977.3|AC006977 Homo sapiens PAC clone RP5-1091E12 from 7... 40 6.6
147dbj|BS000103.1| Pan troglodytes chromosome 22 clone:PTB-031J04, ... 40 6.6
148emb|CR378283.1| Pinus pinaster SSR, clone PPD3H10 40 6.6
149emb|BX571979.8| Zebrafish DNA sequence from clone DKEYP-51C11 in... 40 6.6
150gb|AC120394.10| Mus musculus chromosome 9, clone RP24-325N9, com... 40 6.6
151emb|BX648797.1|HSM808948 Homo sapiens mRNA; cDNA DKFZp686L16148 ... 40 6.6
152emb|AL844482.6| Mouse DNA sequence from clone RP23-81A18 on chro... 40 6.6
153dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.6
154emb|AJ328777.1|HSA328777 Homo sapiens genomic sequence surroundi... 40 6.6
155gb|AC126275.3| Mus musculus BAC clone RP23-111N17 from 14, compl... 40 6.6
156gb|AC110562.17| Mus musculus chromosome 17, clone RP23-268M4, co... 40 6.6
157gb|AC133864.32| Medicago truncatula clone mth2-18d12, complete s... 40 6.6
158emb|AJ012221.1|HSA012221 Homo sapiens ammecr1 gene, exon 1 and j... 40 6.6
159emb|BX004787.8| Zebrafish DNA sequence from clone DKEY-28B17 in ... 40 6.6
160emb|AL845485.16| Mouse DNA sequence from clone RP23-237D23 on ch... 40 6.6
161gb|AC130831.4| Mus musculus BAC clone RP24-80P9 from 14, complet... 40 6.6
162gb|AC140945.1| Gallus gallus BAC clone TAM33-20E22 from chromoso... 40 6.6
163emb|AJ003147.1|HSAJ03147 Homo sapiens complete genomic sequence ... 40 6.6
164emb|AL731692.8| Mouse DNA sequence from clone RP23-245M18 on chr... 40 6.6
165emb|AL672241.6| Mouse DNA sequence from clone RP23-147D3 on chro... 40 6.6
166emb|AL844531.6| Mouse DNA sequence from clone RP23-211J18 on chr... 40 6.6
167emb|AL772242.7| Mouse DNA sequence from clone RP23-15E4 on chrom... 40 6.6
168emb|AL671900.5| Mouse DNA sequence from clone RP23-282O5 on chro... 40 6.6
169gb|AC167975.3| Mus musculus BAC clone RP23-171A14 from chromosom... 40 6.6

>dbj|AK243255.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J100048F19, full
            insert sequence
          Length = 1440
 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 383  ttgtttctggtatatcgaagtggtatatgcaga 415
            ||||| |||||||||| ||||||||||||||||
Sbjct: 1395 ttgttcctggtatatcaaagtggtatatgcaga 1427



to top

>emb|AL732347.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0723C07, complete
             sequence
          Length = 112897

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 383   ttgtttctggtatatcgaagtggtatatgcaga 415
             ||||| |||||||||| ||||||||||||||||
Sbjct: 21134 ttgttcctggtatatcaaagtggtatatgcaga 21102



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4
          Length = 35498469

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                                 
Query: 383      ttgtttctggtatatcgaagtggtatatgcaga 415
                ||||| |||||||||| ||||||||||||||||
Sbjct: 35066393 ttgttcctggtatatcaaagtggtatatgcaga 35066361



to top

>emb|AL606686.3|OSJN00084 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0070M12,
            complete sequence
          Length = 144670

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 383  ttgtttctggtatatcgaagtggtatatgcaga 415
            ||||| |||||||||| ||||||||||||||||
Sbjct: 2896 ttgttcctggtatatcaaagtggtatatgcaga 2864



to top

>emb|AL606651.3|OSJN00092 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088H09,
              complete sequence
          Length = 145391

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                               
Query: 383    ttgtttctggtatatcgaagtggtatatgcaga 415
              ||||| |||||||||| ||||||||||||||||
Sbjct: 125440 ttgttcctggtatatcaaagtggtatatgcaga 125408



to top

>gb|AY998670.1| Heroina isonycterina isolate 1157 cytochrome b gene, partial cds;
           mitochondrial
          Length = 1116

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 404 ggtatatgcagatgaagaaaaag 426
           |||||||||||||||||||||||
Sbjct: 265 ggtatatgcagatgaagaaaaag 243



to top

>gb|AC024706.6| Homo sapiens BAC clone RP11-119J20 from 4, complete sequence
          Length = 169557

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 282    tctgtttttatttcttttccttt 304
              |||||||||||||||||||||||
Sbjct: 131604 tctgtttttatttcttttccttt 131626



to top

>gb|AC190114.4| Canis Familiaris chromosome 2, clone XX-440P16, complete sequence
          Length = 182388

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 286   tttttatttcttttcctttgtt 307
             ||||||||||||||||||||||
Sbjct: 68640 tttttatttcttttcctttgtt 68661



to top

>gb|AC187001.7| Canis Familiaris chromosome 2, clone XX-425F13, complete sequence
          Length = 181819

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 286    tttttatttcttttcctttgtt 307
              ||||||||||||||||||||||
Sbjct: 149225 tttttatttcttttcctttgtt 149246



to top

>gb|AC186064.6| Canis Familiaris chromosome 2, clone XX-149D17, complete sequence
          Length = 198843

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 286  tttttatttcttttcctttgtt 307
            ||||||||||||||||||||||
Sbjct: 3720 tttttatttcttttcctttgtt 3741



to top

>gb|AC123832.4| Mus musculus BAC clone RP24-126O19 from chromosome 9, complete sequence
          Length = 181337

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 248    ccagacagacccatccctcctt 269
              ||||||||||||||||||||||
Sbjct: 113460 ccagacagacccatccctcctt 113481



to top

>emb|AL121747.41|HSDJ852M4 Human DNA sequence from clone RP5-852M4 on chromosome 20 Contains the
             C20orf18 gene for the possible ortholog of rodent
             ubiquitin conjugating enzyme 7 interacting protein 3
             (UBCE7IP3), the C20orf140 gene for a novel protein similar
             to Drosophilia CG17883, a novel gene and two CpG islands,
             complete sequence
          Length = 58627

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 218   tgtgaagctgtgctagtgctgt 239
             ||||||||||||||||||||||
Sbjct: 34835 tgtgaagctgtgctagtgctgt 34814



to top

>emb|AL645934.7| Mouse DNA sequence from clone RP23-27P11 on chromosome 11, complete
              sequence
          Length = 225839

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 283    ctgtttttatttcttttcctttgttt 308
              |||||||| |||||||||||||||||
Sbjct: 155838 ctgtttttttttcttttcctttgttt 155863



to top

>gb|AC018685.12| Homo sapiens BAC clone RP11-455M16 from 2, complete sequence
          Length = 173381

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 85    aagggaagagaagagaggagcg 106
             ||||||||||||||||||||||
Sbjct: 16097 aagggaagagaagagaggagcg 16076



to top

>gb|AF018596.1|AF018596 Centropomus mexicanus cytochrome b gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 306

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 404 ggtatatgcagatgaagaaaaa 425
           ||||||||||||||||||||||
Sbjct: 190 ggtatatgcagatgaagaaaaa 169



to top

>gb|AF018595.1|AF018595 Centropomus mexicanus cytochrome b gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 306

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 404 ggtatatgcagatgaagaaaaa 425
           ||||||||||||||||||||||
Sbjct: 190 ggtatatgcagatgaagaaaaa 169



to top

>gb|AF018594.1|AF018594 Centropomus parallelus cytochrome b gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 308

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 404 ggtatatgcagatgaagaaaaa 425
           ||||||||||||||||||||||
Sbjct: 192 ggtatatgcagatgaagaaaaa 171



to top

>gb|AF018572.1|AF018572 Centropomus pectinatus cytochrome b gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 306

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 404 ggtatatgcagatgaagaaaaa 425
           ||||||||||||||||||||||
Sbjct: 190 ggtatatgcagatgaagaaaaa 169



to top

>gb|AF018571.1|AF018571 Centropomus pectinatus cytochrome b gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 306

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 404 ggtatatgcagatgaagaaaaa 425
           ||||||||||||||||||||||
Sbjct: 190 ggtatatgcagatgaagaaaaa 169



to top

>gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete sequence
          Length = 23011544

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 276      ccctcctctgtttttatttcttttc 300
                |||| ||||||||||||||||||||
Sbjct: 21828253 ccctgctctgtttttatttcttttc 21828229



to top

>gb|AE014297.2| Drosophila melanogaster chromosome 3R, complete sequence
          Length = 27905053

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 288     tttatttcttttcctttgttt 308
               |||||||||||||||||||||
Sbjct: 3444529 tttatttcttttcctttgttt 3444509



to top

>ref|NM_118809.3| Arabidopsis thaliana unknown protein (AT4G26750) mRNA, complete cds
          Length = 1535

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1140 ggaggaggaggagcagaggagaagc 1116



to top

>gb|AC151782.1| Ornithorhynchus anatinus chromosome UNK clone OABb-208A1, complete
             sequence
          Length = 145600

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    gggaggaggaggagcagagga 53
             |||||||||||||||||||||
Sbjct: 37684 gggaggaggaggagcagagga 37704



to top

>gb|AC124976.9| Mus musculus chromosome 3, clone RP24-84E6, complete sequence
          Length = 218027

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 281   ctctgtttttatttcttttcctttg 305
             |||||| ||||||||||||||||||
Sbjct: 93468 ctctgtctttatttcttttcctttg 93492



to top

>gb|AF301594.1| Triatoma dimidiata mitochondrial DNA, complete genome
          Length = 17019

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 284   tgtttttatttcttttcctttgttt 308
             ||||||| |||||||||||||||||
Sbjct: 12159 tgtttttttttcttttcctttgttt 12135



to top

>gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 227955

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 161    tttcttctttctttgtggttttgtt 185
              |||||||||||||||| ||||||||
Sbjct: 170043 tttcttctttctttgttgttttgtt 170067



to top

>gb|AC006467.13| Drosophila melanogaster clone BACR03L08, complete sequence
          Length = 170327

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 276   ccctcctctgtttttatttcttttc 300
             |||| ||||||||||||||||||||
Sbjct: 71080 ccctgctctgtttttatttcttttc 71056



to top

>gb|AC150553.1| Drosophila melanogaster clone BACR09H20, complete sequence
          Length = 179099

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 276    ccctcctctgtttttatttcttttc 300
              |||| ||||||||||||||||||||
Sbjct: 118955 ccctgctctgtttttatttcttttc 118931



to top

>gb|AC099863.14| Mus musculus chromosome 3, clone RP23-6F2, complete sequence
          Length = 245784

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 271    tggaaccctcctctgttttta 291
              |||||||||||||||||||||
Sbjct: 227145 tggaaccctcctctgttttta 227165



to top

>gb|AC146118.3| Pan troglodytes BAC clone RP43-23A6 from 7, complete sequence
          Length = 166241

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    aagggaagagaagagaggagc 105
             |||||||||||||||||||||
Sbjct: 90942 aagggaagagaagagaggagc 90962



to top

>gb|AC122239.4| Mus musculus BAC clone RP23-143K14 from chromosome 8, complete sequence
          Length = 197109

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 165    ttctttctttgtggttttgtt 185
              |||||||||||||||||||||
Sbjct: 115899 ttctttctttgtggttttgtt 115879



to top

>gb|AC122002.2| Mus musculus BAC clone RP24-335H15 from 7, complete sequence
          Length = 114070

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 164 cttctttctttgtggttttgt 184
           |||||||||||||||||||||
Sbjct: 847 cttctttctttgtggttttgt 827



to top

>gb|AC115750.9| Mus musculus chromosome 10, clone RP23-16F5, complete sequence
          Length = 228071

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 284    tgtttttatttcttttcctttgttt 308
              |||||||||||| ||||||||||||
Sbjct: 140108 tgtttttatttcctttcctttgttt 140084



to top

>gb|AC153013.3| Mus musculus BAC clone RP23-273N8 from chromosome 8, complete sequence
          Length = 196609

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 165   ttctttctttgtggttttgtt 185
             |||||||||||||||||||||
Sbjct: 18526 ttctttctttgtggttttgtt 18506



to top

>gb|AY094009.1| Arabidopsis thaliana AT4g26750/F10M23_90 mRNA, complete cds
          Length = 1266

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1025 ggaggaggaggagcagaggagaagc 1001



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 33       gggaggaggaggagcagagga 53
                |||||||||||||||||||||
Sbjct: 28515765 gggaggaggaggagcagagga 28515745



to top

>emb|CR848038.1| Chlamydophila abortus strain S26/3, complete genome
          Length = 1144377

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 279     tcctctgtttttatttctttt 299
               |||||||||||||||||||||
Sbjct: 1135040 tcctctgtttttatttctttt 1135060



to top

>gb|AC134432.4| Mus musculus BAC clone RP24-389K11 from chromosome 8, complete sequence
          Length = 150334

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 284   tgtttttatttcttttcctttgttt 308
             |||||||||||| ||||||||||||
Sbjct: 53188 tgtttttatttcctttcctttgttt 53164



to top

>ref|XM_648838.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (68.t00026)
           partial mRNA
          Length = 795

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 tgtttttatttcttttccttt 304
           |||||||||||||||||||||
Sbjct: 354 tgtttttatttcttttccttt 334



to top

>gb|AF380781.1|AF380781 Pseudoeurycea leprosa clone e33.36 cytochrome b (cytB) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 567

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 405 gtatatgcagatgaagaaaaa 425
           |||||||||||||||||||||
Sbjct: 228 gtatatgcagatgaagaaaaa 208



to top

>gb|AF380778.1|AF380778 Pseudoeurycea leprosa clone e33.45 cytochrome b (cytB) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 567

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 405 gtatatgcagatgaagaaaaa 425
           |||||||||||||||||||||
Sbjct: 228 gtatatgcagatgaagaaaaa 208



to top

>gb|AY048219.1| Arabidopsis thaliana AT4g26750/F10M23_90 mRNA, complete cds
          Length = 1474

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1080 ggaggaggaggagcagaggagaagc 1056



to top

>emb|CR382400.1| Plasmodium falciparum chromosome 6, complete sequence; segment 3/5
          Length = 348034

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 284    tgtttttatttcttttcctttgttt 308
              |||||||||||||||| ||||||||
Sbjct: 198364 tgtttttatttctttttctttgttt 198340



to top

>emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 65
          Length = 198320

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 34     ggaggaggaggagcagaggacaagc 58
              |||||||||||||||||||| ||||
Sbjct: 173264 ggaggaggaggagcagaggagaagc 173288



to top

>emb|AL035440.2|ATF10M23 Arabidopsis thaliana DNA chromosome 4, BAC clone F10M23 (ESSA project)
          Length = 128574

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 34    ggaggaggaggagcagaggacaagc 58
             |||||||||||||||||||| ||||
Sbjct: 24101 ggaggaggaggagcagaggagaagc 24125



to top

>dbj|AP003450.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0034C09
          Length = 170226

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 33    gggaggaggaggagcagagga 53
             |||||||||||||||||||||
Sbjct: 42204 gggaggaggaggagcagagga 42184



to top

>gb|AC011253.4|AC011253 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
              BACR37K05, complete sequence
          Length = 197597

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 288    tttatttcttttcctttgttt 308
              |||||||||||||||||||||
Sbjct: 124805 tttatttcttttcctttgttt 124785



to top

>emb|BX826728.1|CNS0A3ZF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB58ZD12 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1332

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1058 ggaggaggaggagcagaggagaagc 1034



to top

>emb|BX826584.1|CNS0A453 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB43ZG12 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1408

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1059 ggaggaggaggagcagaggagaagc 1035



to top

>emb|BX826538.1|CNS0A410 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB36ZG06 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1328

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1036 ggaggaggaggagcagaggagaagc 1012



to top

>emb|BX826452.1|CNS0A3Z8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB27ZH05 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1366

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1050 ggaggaggaggagcagaggagaagc 1026



to top

>emb|BX828244.1|CNS0A3RZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH67ZB03 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1495

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1140 ggaggaggaggagcagaggagaagc 1116



to top

>emb|BX828199.1|CNS0A3V4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH62ZF04 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1343

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1050 ggaggaggaggagcagaggagaagc 1026



to top

>emb|BX827593.1|CNS0A3PC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS80ZA02 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1409

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1050 ggaggaggaggagcagaggagaagc 1026



to top

>emb|BX827333.1|CNS0A3PO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS40ZB09 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1435

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1055 ggaggaggaggagcagaggagaagc 1031



to top

>emb|BX828334.1|CNS0A2EG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH78ZA09 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1407

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 34   ggaggaggaggagcagaggacaagc 58
            |||||||||||||||||||| ||||
Sbjct: 1060 ggaggaggaggagcagaggagaagc 1036



to top

>gb|DQ266374.1| Ixodes ricinus ricinusin mRNA, complete cds
          Length = 529

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 414 gatgaagaaaaagatgaattc 434
           |||||||||||||||||||||
Sbjct: 333 gatgaagaaaaagatgaattc 353



to top

>gb|AC109281.5| Mus musculus chromosome 3, clone RP24-66E21, complete sequence
          Length = 222162

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 271    tggaaccctcctctgttttta 291
              |||||||||||||||||||||
Sbjct: 159261 tggaaccctcctctgttttta 159241



to top

>gb|AC153929.3| Mus musculus 10 BAC RP24-364H18 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 173752

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                           
Query: 276    ccctcctctgtttttatttcttttccttt 304
              ||||||||||||||| |||||||||||||
Sbjct: 114263 ccctcctctgttttt-tttcttttccttt 114290



to top

>ref|XM_725186.1| Plasmodium yoelii yoelii str. 17XNL cell division cycle protein 48
           (PY02401) partial mRNA
          Length = 2142

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 408 tatgcagatgaagaaaaagat 428
           |||||||||||||||||||||
Sbjct: 493 tatgcagatgaagaaaaagat 513



to top

>ref|XM_672255.1| Plasmodium berghei strain ANKA ATPase (PB000861.00.0), partial mRNA
          Length = 2073

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 408 tatgcagatgaagaaaaagat 428
           |||||||||||||||||||||
Sbjct: 448 tatgcagatgaagaaaaagat 468



to top

>gb|AC142104.4| Mus musculus BAC clone RP24-313C11 from 8, complete sequence
          Length = 157626

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 284   tgtttttatttcttttcctttgttt 308
             |||||||||||| ||||||||||||
Sbjct: 11822 tgtttttatttcctttcctttgttt 11846



to top

>emb|AL845263.10| Mouse DNA sequence from clone RP23-337L20 on chromosome 2, complete
              sequence
          Length = 209967

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 254    agacccatccctccttctggaaccc 278
              ||||||||| |||||||||||||||
Sbjct: 181336 agacccatctctccttctggaaccc 181312



to top

>emb|AL669834.10| Mouse DNA sequence from clone RP23-114O4 on chromosome 4, complete
             sequence
          Length = 147248

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 28    gcagtgggaggaggaggagcagagg 52
             |||| ||||||||||||||||||||
Sbjct: 35221 gcagagggaggaggaggagcagagg 35197



to top

>gb|AC090349.8| Homo sapiens chromosome 18, clone RP11-844N22, complete sequence
          Length = 132192

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 284  tgtttttatttcttttcctt 303
            ||||||||||||||||||||
Sbjct: 9657 tgtttttatttcttttcctt 9676



to top

>emb|CT027552.11| Zebrafish DNA sequence from clone DKEY-7C22 in linkage group 23, complete
              sequence
          Length = 215184

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 282    tctgtttttatttcttttcc 301
              ||||||||||||||||||||
Sbjct: 195309 tctgtttttatttcttttcc 195290



to top

>emb|CR735105.10| Zebrafish DNA sequence from clone DKEY-202E11 in linkage group 23,
             complete sequence
          Length = 82796

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   tgtttttatttcttttcctt 303
             ||||||||||||||||||||
Sbjct: 45108 tgtttttatttcttttcctt 45089



to top

>ref|XM_001151807.1| PREDICTED: Pan troglodytes hypothetical protein LOC740967
           (LOC740967), mRNA
          Length = 597

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 202 ctgggggtggttgggctgtgaagc 225
           |||||||||| |||||||||||||
Sbjct: 502 ctgggggtgggtgggctgtgaagc 479



to top

>gb|AC190267.1| Gallus gallus chromosome Z clone CH261-44B21, complete sequence
          Length = 162998

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 81     agacaagggaagagaagaga 100
              ||||||||||||||||||||
Sbjct: 116155 agacaagggaagagaagaga 116136



to top

>gb|AC187520.3| Pan troglodytes BAC clone CH251-641K22 from chromosome 7, complete
             sequence
          Length = 189666

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 286   tttttatttcttttcctttg 305
             ||||||||||||||||||||
Sbjct: 40133 tttttatttcttttcctttg 40152



to top

>ref|XM_001061937.1| PREDICTED: Rattus norvegicus similar to HCDI protein (predicted)
            (RGD1309307_predicted), mRNA
          Length = 1981

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 82   gacaagggaagagaagagag 101
            ||||||||||||||||||||
Sbjct: 1793 gacaagggaagagaagagag 1774



to top

>ref|XM_341321.3| PREDICTED: Rattus norvegicus similar to HCDI protein (predicted)
            (RGD1309307_predicted), mRNA
          Length = 1981

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 82   gacaagggaagagaagagag 101
            ||||||||||||||||||||
Sbjct: 1793 gacaagggaagagaagagag 1774



to top

>ref|XM_001099875.1| PREDICTED: Macaca mulatta AMMECR1 protein (AMMECR1), mRNA
          Length = 5408

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 108 tgcagtgggaggaggaggag 89



to top

>gb|AC186760.1| Pongo pygmaeus abelii chromosome UNK clone CH276-22H12, complete
             sequence
          Length = 225183

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ggaggaggaggagcagagga 53
             ||||||||||||||||||||
Sbjct: 71113 ggaggaggaggagcagagga 71094



to top

>ref|XM_969374.1| PREDICTED: Tribolium castaneum similar to IQ motif containing D
            (LOC663319), mRNA
          Length = 1407

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ggaggaggaggagcagagga 53
            ||||||||||||||||||||
Sbjct: 1059 ggaggaggaggagcagagga 1078



to top

>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     agtgggaggaggaggagcag 49
              ||||||||||||||||||||
Sbjct: 179384 agtgggaggaggaggagcag 179365



to top

>gb|AC164094.5| Mus musculus BAC clone RP23-133F10 from chromosome 6, complete sequence
          Length = 216271

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ggaggaggaggagcagagga 53
              ||||||||||||||||||||
Sbjct: 214899 ggaggaggaggagcagagga 214918



to top

>gb|AC126540.3| Ciona savignyi, clone XX-4791757C3, complete sequence
          Length = 39109

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ggaggaggaggagcagagga 53
             ||||||||||||||||||||
Sbjct: 26153 ggaggaggaggagcagagga 26172



to top

>gb|AC130812.2| Ciona savignyi, clone XX-4785757L22, complete sequence
          Length = 40437

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ggaggaggaggagcagagga 53
             ||||||||||||||||||||
Sbjct: 25031 ggaggaggaggagcagagga 25012



to top

>gb|AF288738.1| Homo sapiens epidermal growth factor receptor (EGFR) gene, complete
             cds, alternatively spliced; and 5S ribosomal RNA gene,
             complete sequence
          Length = 197496

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    tgcagtgggaggaggaggag 46
             ||||||||||||||||||||
Sbjct: 39709 tgcagtgggaggaggaggag 39690



to top

>gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, complete sequence
          Length = 215514

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 85     aagggaagagaagagaggag 104
              ||||||||||||||||||||
Sbjct: 146912 aagggaagagaagagaggag 146893



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     tgcagtgggaggaggaggag 46
              ||||||||||||||||||||
Sbjct: 648800 tgcagtgggaggaggaggag 648819



to top

>gb|AC102438.8| Mus musculus chromosome 5, clone RP24-137F10, complete sequence
          Length = 205785

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    ggaggaggaggagcagagga 53
             ||||||||||||||||||||
Sbjct: 62392 ggaggaggaggagcagagga 62411



to top

>gb|AC115922.9| Mus musculus chromosome 7, clone RP24-505K11, complete sequence
          Length = 134271

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    aagggaagagaagagaggag 104
             ||||||||||||||||||||
Sbjct: 10977 aagggaagagaagagaggag 10958



to top

>ref|NM_015365.2| Homo sapiens Alport syndrome, mental retardation, midface
           hypoplasia and elliptocytosis chromosomal region, gene 1
           (AMMECR1), transcript variant 1, mRNA
          Length = 5431

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 181 tgcagtgggaggaggaggag 162



to top

>ref|NM_001025580.1| Homo sapiens Alport syndrome, mental retardation, midface
           hypoplasia and elliptocytosis chromosomal region, gene 1
           (AMMECR1), transcript variant 2, mRNA
          Length = 5320

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 181 tgcagtgggaggaggaggag 162



to top

>gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, complete sequence
          Length = 149463

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    aagggaagagaagagaggag 104
             ||||||||||||||||||||
Sbjct: 22106 aagggaagagaagagaggag 22087



to top

>gb|BT013505.1| Lycopersicon esculentum clone 132193F, mRNA sequence
          Length = 1959

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 406  tatatgcagatgaagaaaaa 425
            ||||||||||||||||||||
Sbjct: 1616 tatatgcagatgaagaaaaa 1635



to top

>gb|AY196160.1| Solanum tuberosum nematode resistance-like protein (Gro1-10) gene,
            Gro1-10-P41 allele, partial cds
          Length = 8306

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 269  tctggaaccctcctctgtttttatttct 296
            ||||||||| |||||| |||||||||||
Sbjct: 3087 tctggaaccttcctctatttttatttct 3114



to top

>gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, complete sequence
          Length = 194261

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ggaggaggaggagcagagga 53
             ||||||||||||||||||||
Sbjct: 12244 ggaggaggaggagcagagga 12225



to top

>gb|AY588246.1| Homo sapiens epidermal growth factor receptor (erythroblastic leukemia
             viral (v-erb-b) oncogene homolog, avian) (EGFR) gene,
             complete cds
          Length = 192168

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    tgcagtgggaggaggaggag 46
             ||||||||||||||||||||
Sbjct: 32426 tgcagtgggaggaggaggag 32407



to top

>ref|XM_549183.2| PREDICTED: Canis familiaris similar to AMME syndrome candidate gene
           1 protein, transcript variant 1 (LOC492063), mRNA
          Length = 1341

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 261 tgcagtgggaggaggaggag 242



to top

>ref|XM_858227.1| PREDICTED: Canis familiaris similar to AMME syndrome candidate gene
           1 protein, transcript variant 4 (LOC492063), mRNA
          Length = 912

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 124 tgcagtgggaggaggaggag 105



to top

>ref|XM_858211.1| PREDICTED: Canis familiaris similar to AMME syndrome candidate gene
           1 protein, transcript variant 3 (LOC492063), mRNA
          Length = 583

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 124 tgcagtgggaggaggaggag 105



to top

>ref|XM_858187.1| PREDICTED: Canis familiaris similar to AMME syndrome candidate gene
           1 protein, transcript variant 2 (LOC492063), mRNA
          Length = 639

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 124 tgcagtgggaggaggaggag 105



to top

>gb|AC083880.5| Homo sapiens BAC clone RP11-634H22 from 7, complete sequence
          Length = 38486

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 286   tttttatttcttttcctttg 305
             ||||||||||||||||||||
Sbjct: 35191 tttttatttcttttcctttg 35210



to top

>gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome 17, complete sequence
          Length = 187751

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    agggaagagaagagaggagc 105
             ||||||||||||||||||||
Sbjct: 11834 agggaagagaagagaggagc 11815



to top

>gb|AC124563.4| Mus musculus BAC clone RP23-206B15 from chromosome 6, complete sequence
          Length = 210092

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ggaggaggaggagcagagga 53
              ||||||||||||||||||||
Sbjct: 142350 ggaggaggaggagcagagga 142331



to top

>gb|AC121854.2| Mus musculus BAC clone RP24-97A15 from 7, complete sequence
          Length = 185164

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    aagggaagagaagagaggag 104
             ||||||||||||||||||||
Sbjct: 35048 aagggaagagaagagaggag 35067



to top

>gb|AC004926.2| Homo sapiens PAC clone RP5-910H9 from 7, complete sequence
          Length = 153556

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    aagggaagagaagagaggag 104
             ||||||||||||||||||||
Sbjct: 19861 aagggaagagaagagaggag 19842



to top

>gb|AF098985.2| Caenorhabditis elegans cosmid C08G5, complete sequence
          Length = 40550

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 281   ctctgtttttatttcttttc 300
             ||||||||||||||||||||
Sbjct: 18565 ctctgtttttatttcttttc 18546



to top

>gb|AC165290.2| Mus musculus BAC clone RP23-343A4 from chromosome 13, complete sequence
          Length = 206249

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    gggaggaggaggagcagagg 52
             ||||||||||||||||||||
Sbjct: 68108 gggaggaggaggagcagagg 68127



to top

>gb|BC060813.1| Homo sapiens Alport syndrome, mental retardation, midface
           hypoplasia and elliptocytosis chromosomal region, gene
           1, mRNA (cDNA clone MGC:71655 IMAGE:30344824), complete
           cds
          Length = 3053

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 114 tgcagtgggaggaggaggag 95



to top

>gb|AC110062.4| Homo sapiens chromosome 18, clone CTD-2125N24, complete sequence
          Length = 139550

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 402   gtggtatatgcagatgaagaaaaa 425
             ||||||||||||||||| ||||||
Sbjct: 45594 gtggtatatgcagatgatgaaaaa 45571



to top

>gb|AC117403.4| Homo sapiens 12 BAC RP11-239E14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 121632

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    agacaagggaagagaagaga 100
             ||||||||||||||||||||
Sbjct: 69466 agacaagggaagagaagaga 69485



to top

>gb|AC115100.3| Homo sapiens chromosome 18, clone RP11-237L15, complete sequence
          Length = 169152

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   ttttgctgggggtggttggg 216
             ||||||||||||||||||||
Sbjct: 99612 ttttgctgggggtggttggg 99593



to top

>gb|AC015820.10| Homo sapiens chromosome 11, clone RP11-108G3, complete sequence
          Length = 165149

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 155   ggaggatttcttctttcttt 174
             ||||||||||||||||||||
Sbjct: 21171 ggaggatttcttctttcttt 21152



to top

>gb|AC007566.2| Homo sapiens BAC clone CTB-10G5 from 7q21-7q22, complete sequence
          Length = 149194

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    aagggaagagaagagaggag 104
             ||||||||||||||||||||
Sbjct: 10871 aagggaagagaagagaggag 10852



to top

>gb|AC093878.3| Homo sapiens BAC clone RP11-638O6 from 4, complete sequence
          Length = 176018

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 85     aagggaagagaagagaggag 104
              ||||||||||||||||||||
Sbjct: 117952 aagggaagagaagagaggag 117971



to top

>gb|AC021651.17| Homo sapiens 12 BAC RP11-498B21 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 67150

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 287   ttttatttcttttcctttgt 306
             ||||||||||||||||||||
Sbjct: 58541 ttttatttcttttcctttgt 58560



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 284      tgtttttatttcttttcctttgtt 307
                ||||||| ||||||||||||||||
Sbjct: 21563725 tgtttttttttcttttcctttgtt 21563748



to top

>gb|AC100806.2| Homo sapiens chromosome 18, clone CTB-2341H11, complete sequence
          Length = 81641

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   gtttttatttcttttccttt 304
             ||||||||||||||||||||
Sbjct: 10057 gtttttatttcttttccttt 10076



to top

>gb|AC013477.7| Homo sapiens BAC clone RP11-559F19 from 4, complete sequence
          Length = 182092

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 281   ctctgtttttatttcttttccttt 304
             |||||||||| |||||||||||||
Sbjct: 52552 ctctgtttttttttcttttccttt 52575



to top

>emb|AL356969.12| Human DNA sequence from clone RP11-411F9 on chromosome 6, complete
              sequence
          Length = 169184

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     agtgggaggaggaggagcag 49
              ||||||||||||||||||||
Sbjct: 129367 agtgggaggaggaggagcag 129348



to top

>gb|AC091317.3| Homo sapiens chromosome 18, clone CTD-2338I4, complete sequence
          Length = 105168

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 197    ttttgctgggggtggttggg 216
              ||||||||||||||||||||
Sbjct: 102292 ttttgctgggggtggttggg 102311



to top

>emb|AL031319.5|HS364I1 Human DNA sequence from clone RP3-364I1 on chromosome Xq23 Contains a
             novel gene, part of the AMMECR1 gene for Alport syndrome
             (mental retardation, midface hypoplasia and elliptocytosis
             chromosomal region, gene 1) (FLJ341111), the gene for a
             novel protein similar to guanine nucleotide binding
             protein (G protein) gamma 5 (GNG5) and a CpG island,
             complete sequence
          Length = 98770

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    tgcagtgggaggaggaggag 46
             ||||||||||||||||||||
Sbjct: 37240 tgcagtgggaggaggaggag 37259



to top

>gb|AC160247.2| Pan troglodytes BAC clone CH251-540N18 from chromosome 7, complete
             sequence
          Length = 168031

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    aagggaagagaagagaggag 104
             ||||||||||||||||||||
Sbjct: 44174 aagggaagagaagagaggag 44193



to top

>gb|AC007768.5| Homo sapiens chromosome 18, clone RP11-540M4, complete sequence
          Length = 175579

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 285 gtttttatttcttttccttt 304
           ||||||||||||||||||||
Sbjct: 153 gtttttatttcttttccttt 134



to top

>gb|AC080004.12| Homo sapiens 3q BAC RP11-307O15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 206162

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 155    ggaggatttcttctttcttt 174
              ||||||||||||||||||||
Sbjct: 175634 ggaggatttcttctttcttt 175653



to top

>gb|AF380786.1|AF380786 Pseudoeurycea smithi clone e15.4 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 567

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380780.1|AF380780 Pseudoeurycea leprosa clone e33.44 cytochrome b (cytB) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 547

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 218 tatatgcagatgaagaaaaa 199



to top

>gb|AF380779.1|AF380779 Pseudoeurycea leprosa clone e15.3 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 569

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380777.1|AF380777 Pseudoeurycea leprosa clone e33.16 cytochrome b (cytB) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 569

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380776.1|AF380776 Pseudoeurycea leprosa clone e33.1 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 569

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380769.1|AF380769 Lineatriton lineolus clone e35.12 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 540

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380768.1|AF380768 Lineatriton lineolus clone eE37.5 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 507

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 206 tatatgcagatgaagaaaaa 187



to top

>gb|AF380764.1|AF380764 Lineatriton lineolus clone ee35.10 cytochrome b (cytB) gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 539

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380762.1|AF380762 Lineatriton lineolus clone e35.11 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 505

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 192 tatatgcagatgaagaaaaa 173



to top

>gb|AF380761.1|AF380761 Lineatriton lineolus clone e34.7 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 569

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380760.1|AF380760 Lineatriton lineolus clone e34.4 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 569

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380759.1|AF380759 Lineatriton lineolus clone e33.5 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 569

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>gb|AF380758.1|AF380758 Lineatriton lineolus clone e33.6 cytochrome b (cytB) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 569

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 227 tatatgcagatgaagaaaaa 208



to top

>emb|CR858935.1| Pongo pygmaeus mRNA; cDNA DKFZp469O0323 (from clone DKFZp469O0323)
          Length = 3158

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 111 tgcagtgggaggaggaggag 92



to top

>emb|AJ007014.1|HSA7014 Homo sapiens mRNA for AMMECR1 protein
          Length = 1300

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 268 tgcagtgggaggaggaggag 249



to top

>emb|AL645994.7| Mouse DNA sequence from clone RP23-104F14 on chromosome 11 Contains the
             Upp gene for uridine phosphorylase, a polymerase (RNA) II
             (DNA directed) (Polr2c) pseudogene and the 5' end of the
             Abca13 gene for ATP-binding cassette sub-family A (ABC1)
             member 13, complete sequence
          Length = 136162

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    ggaggaggaggagcagagga 53
             ||||||||||||||||||||
Sbjct: 91979 ggaggaggaggagcagagga 91960



to top

>emb|AL929371.6| Mouse DNA sequence from clone RP23-176O5 on chromosome 11 Contains a
            ribosomal protein S2 (Rps2) pseudogene, a novel gene, an
            apurinic/apyrimidinic endonuclease 2 (Apex2) pseudogene,
            the Rtn4 gene for reticulon 4, the 3' end of the gene for
            a novel protein (C230094A16Rik) (MGC38936) and a CpG
            island, complete sequence
          Length = 212042

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   ggaggaggaggagcagagga 53
            ||||||||||||||||||||
Sbjct: 3768 ggaggaggaggagcagagga 3787



to top

>emb|BX510646.5| Zebrafish DNA sequence from clone CH211-221B16 in linkage group 9,
             complete sequence
          Length = 200321

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 413   agatgaagaaaaagatgaat 432
             ||||||||||||||||||||
Sbjct: 87921 agatgaagaaaaagatgaat 87940



to top

>gb|AF451203.1| Pseudoeurycea smithi clone e34.1 cytochrome b (Cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 570

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 tatatgcagatgaagaaaaa 425
           ||||||||||||||||||||
Sbjct: 228 tatatgcagatgaagaaaaa 209



to top

>gb|AC108134.3| Homo sapiens chromosome 16 clone RP11-473M20, complete sequence
          Length = 180354

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 30    agtgggaggaggaggagcag 49
             ||||||||||||||||||||
Sbjct: 64209 agtgggaggaggaggagcag 64228



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 30    agtgggaggaggaggagcag 49
             ||||||||||||||||||||
Sbjct: 83842 agtgggaggaggaggagcag 83861



to top

>gb|AC021631.6|AC021631 Mus musculus, clone RP23-38J11, complete sequence
          Length = 160618

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 85     aagggaagagaagagaggag 104
              ||||||||||||||||||||
Sbjct: 155873 aagggaagagaagagaggag 155892



to top

>dbj|AP006068.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0020D05
          Length = 158760

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 284   tgtttttatttcttttcctttgtt 307
             ||||||| ||||||||||||||||
Sbjct: 52675 tgtttttttttcttttcctttgtt 52698



to top

>dbj|AP004865.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0020C11
          Length = 163328

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 284    tgtttttatttcttttcctttgtt 307
              ||||||| ||||||||||||||||
Sbjct: 158652 tgtttttttttcttttcctttgtt 158675



to top

>gb|AC016907.6| Homo sapiens BAC clone RP11-439P4 from 2, complete sequence
          Length = 202827

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 78     atcagacaagggaagagaag 97
              ||||||||||||||||||||
Sbjct: 185213 atcagacaagggaagagaag 185194



to top

>gb|AC015978.4|AC015978 Homo sapiens BAC clone RP11-529I21 from Y, complete sequence
          Length = 178780

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 287    ttttatttcttttcctttgt 306
              ||||||||||||||||||||
Sbjct: 113351 ttttatttcttttcctttgt 113332



to top

>gb|AC007241.3|AC007241 Homo sapiens BAC clone RP11-157F24 from Y, complete sequence
          Length = 161868

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 287    ttttatttcttttcctttgt 306
              ||||||||||||||||||||
Sbjct: 121666 ttttatttcttttcctttgt 121685



to top

>gb|AC006977.3|AC006977 Homo sapiens PAC clone RP5-1091E12 from 7p11.2-p21, complete sequence
          Length = 177998

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    tgcagtgggaggaggaggag 46
             ||||||||||||||||||||
Sbjct: 39709 tgcagtgggaggaggaggag 39690



to top

>dbj|BS000103.1| Pan troglodytes chromosome 22 clone:PTB-031J04, map 22, complete
             sequences
          Length = 164274

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    agtgggaggaggaggagcag 49
             ||||||||||||||||||||
Sbjct: 22683 agtgggaggaggaggagcag 22664



to top

>emb|CR378283.1| Pinus pinaster SSR, clone PPD3H10
          Length = 121

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 28 gcagtgggaggaggaggagcagag 51
          |||||||||||||||| |||||||
Sbjct: 50 gcagtgggaggaggagaagcagag 73



to top

>emb|BX571979.8| Zebrafish DNA sequence from clone DKEYP-51C11 in linkage group 13,
              complete sequence
          Length = 165275

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 412    cagatgaagaaaaagatgaa 431
              ||||||||||||||||||||
Sbjct: 114659 cagatgaagaaaaagatgaa 114678



to top

>gb|AC120394.10| Mus musculus chromosome 9, clone RP24-325N9, complete sequence
          Length = 206641

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     ggaggaggaggagcagagga 53
              ||||||||||||||||||||
Sbjct: 156044 ggaggaggaggagcagagga 156025



to top

>emb|BX648797.1|HSM808948 Homo sapiens mRNA; cDNA DKFZp686L16148 (from clone DKFZp686L16148)
          Length = 3065

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 143 tgcagtgggaggaggaggag 124



to top

>emb|AL844482.6| Mouse DNA sequence from clone RP23-81A18 on chromosome X, complete
             sequence
          Length = 141997

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    tgggaggaggaggagcagag 51
             ||||||||||||||||||||
Sbjct: 72916 tgggaggaggaggagcagag 72897



to top

>dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-46K15, complete
             sequence
          Length = 177463

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 276   ccctcctctgtttttatttctttt 299
             ||||||||||||||| ||||||||
Sbjct: 54806 ccctcctctgtttttttttctttt 54783



to top

>emb|AJ328777.1|HSA328777 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-MK23R
          Length = 752

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 268 ttctggaaccctcctctgttttta 291
           ||||||||||||| ||||||||||
Sbjct: 497 ttctggaaccctcatctgttttta 474



to top

>gb|AC126275.3| Mus musculus BAC clone RP23-111N17 from 14, complete sequence
          Length = 211542

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     gggaggaggaggagcagagg 52
              ||||||||||||||||||||
Sbjct: 184487 gggaggaggaggagcagagg 184468



to top

>gb|AC110562.17| Mus musculus chromosome 17, clone RP23-268M4, complete sequence
          Length = 165190

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 86    agggaagagaagagaggagc 105
             ||||||||||||||||||||
Sbjct: 32914 agggaagagaagagaggagc 32933



to top

>gb|AC133864.32| Medicago truncatula clone mth2-18d12, complete sequence
          Length = 125734

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   gtttttatttcttttccttt 304
             ||||||||||||||||||||
Sbjct: 27854 gtttttatttcttttccttt 27873



to top

>emb|AJ012221.1|HSA012221 Homo sapiens ammecr1 gene, exon 1 and joined CDS (alternative
           transcripts)
          Length = 651

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tgcagtgggaggaggaggag 46
           ||||||||||||||||||||
Sbjct: 268 tgcagtgggaggaggaggag 249



to top

>emb|BX004787.8| Zebrafish DNA sequence from clone DKEY-28B17 in linkage group 23,
             complete sequence
          Length = 198036

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 282   tctgtttttatttcttttcc 301
             ||||||||||||||||||||
Sbjct: 45020 tctgtttttatttcttttcc 45001



to top

>emb|AL845485.16| Mouse DNA sequence from clone RP23-237D23 on chromosome 2, complete
              sequence
          Length = 230213

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 286    tttttatttcttttcctttg 305
              ||||||||||||||||||||
Sbjct: 115008 tttttatttcttttcctttg 114989



to top

>gb|AC130831.4| Mus musculus BAC clone RP24-80P9 from 14, complete sequence
          Length = 233804

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     gggaggaggaggagcagagg 52
              ||||||||||||||||||||
Sbjct: 230363 gggaggaggaggagcagagg 230382



to top

>gb|AC140945.1| Gallus gallus BAC clone TAM33-20E22 from chromosome ul, complete
            sequence
          Length = 143278

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 27   tgcagtgggaggaggaggag 46
            ||||||||||||||||||||
Sbjct: 5583 tgcagtgggaggaggaggag 5602



to top

>emb|AJ003147.1|HSAJ03147 Homo sapiens complete genomic sequence between D16S3070 and D16S3275,
             containing Familial Mediterranean Fever gene disease
          Length = 239566

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 30    agtgggaggaggaggagcag 49
             ||||||||||||||||||||
Sbjct: 11896 agtgggaggaggaggagcag 11915



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 30    agtgggaggaggaggagcag 49
             ||||||||||||||||||||
Sbjct: 31529 agtgggaggaggaggagcag 31548



to top

>emb|AL731692.8| Mouse DNA sequence from clone RP23-245M18 on chromosome X, complete
            sequence
          Length = 169309

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 32   tgggaggaggaggagcagag 51
            ||||||||||||||||||||
Sbjct: 5064 tgggaggaggaggagcagag 5045



to top

>emb|AL672241.6| Mouse DNA sequence from clone RP23-147D3 on chromosome 2, complete
             sequence
          Length = 197925

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   tgtttttatttcttttcctt 303
             ||||||||||||||||||||
Sbjct: 92129 tgtttttatttcttttcctt 92148



to top

>emb|AL844531.6| Mouse DNA sequence from clone RP23-211J18 on chromosome 2, complete
             sequence
          Length = 181194

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    aagggaagagaagagaggag 104
             ||||||||||||||||||||
Sbjct: 97326 aagggaagagaagagaggag 97307



to top

>emb|AL772242.7| Mouse DNA sequence from clone RP23-15E4 on chromosome 2, complete
              sequence
          Length = 196548

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     ggaggaggaggagcagagga 53
              ||||||||||||||||||||
Sbjct: 132305 ggaggaggaggagcagagga 132324



to top

>emb|AL671900.5| Mouse DNA sequence from clone RP23-282O5 on chromosome X, complete
             sequence
          Length = 185389

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    agacaagggaagagaagaga 100
             ||||||||||||||||||||
Sbjct: 78256 agacaagggaagagaagaga 78237



to top

>gb|AC167975.3| Mus musculus BAC clone RP23-171A14 from chromosome 13, complete sequence
          Length = 220418

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     gggaggaggaggagcagagg 52
              ||||||||||||||||||||
Sbjct: 154239 gggaggaggaggagcagagg 154258


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 94,505,561
Number of extensions: 7184886
Number of successful extensions: 1060052
Number of sequences better than 10.0: 169
Number of HSP's gapped: 1060051
Number of HSP's successfully gapped: 171
Length of query: 455
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 433
Effective length of database: 18,508,616,841
Effective search space: 8014231092153
Effective search space used: 8014231092153
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
to top