Clone Name	FLbaf172l09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|DQ245844.1| Zea mays clone 20816 mRNA sequence	394	e-106
2	emb|CT830471.1| Oryza sativa (indica cultivar-group) cDNA clone:...	62	4e-06
3	emb|CT828288.1| Oryza sativa (indica cultivar-group) cDNA clone:...	62	4e-06
4	ref|NM_001051730.1| Oryza sativa (japonica cultivar-group) Os01g...	62	4e-06
5	emb|AJ002894.1|OSAJ2894 Oryza sativa mRNA for glycine rich RNA-b...	62	4e-06
6	dbj|AK121668.1| Oryza sativa (japonica cultivar-group) cDNA clon...	62	4e-06
7	dbj|AK059446.1| Oryza sativa (japonica cultivar-group) cDNA clon...	62	4e-06
8	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	58	6e-05
9	dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic D...	58	6e-05
10	dbj|AP003433.3| Oryza sativa (japonica cultivar-group) genomic D...	58	6e-05
11	gb|BT013136.1| Lycopersicon esculentum clone 114438F, mRNA sequence	50	0.013
12	gb|BT012700.1| Lycopersicon esculentum clone 113574R, mRNA sequence	50	0.013
13	ref|XM_001184908.1| PREDICTED: Strongylocentrotus purpuratus hyp...	48	0.053
14	ref|XM_001188704.1| PREDICTED: Strongylocentrotus purpuratus hyp...	48	0.053
15	gb|BT019164.1| Zea mays clone Contig829.F mRNA sequence	46	0.21
16	gb|AY105580.1| Zea mays PCO127552 mRNA sequence	46	0.21
17	ref|NM_001003317.1| Canis familiaris RAB5A, member RAS oncogene ...	46	0.21
18	gb|CP000410.1| Streptococcus pneumoniae D39, complete genome	44	0.83
19	gb|AE008455.1| Streptococcus pneumoniae R6 section 71 of 184 of ...	44	0.83
20	gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome	44	0.83
21	dbj|AB232593.1| Mus musculus mRNA for Rab5A, complete cds	42	3.3
22	gb|AC165960.4| Mus musculus BAC clone RP23-395M20 from chromosom...	42	3.3
23	gb|BC004842.1| Mus musculus RAB5A, member RAS oncogene family, m...	42	3.3
24	gb|AC131785.3| Mus musculus BAC clone RP24-397D13 from chromosom...	42	3.3
25	dbj|AK151066.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	3.3
26	dbj|AK150346.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	3.3
27	dbj|AK150405.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	3.3
28	dbj|AK150296.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	3.3
29	dbj|AK153131.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	3.3
30	dbj|AK159706.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	42	3.3
31	dbj|AK010495.1| Mus musculus ES cells cDNA, RIKEN full-length en...	42	3.3
32	dbj|AK002631.1| Mus musculus adult male kidney cDNA, RIKEN full-...	42	3.3
33	dbj|AK008198.1| Mus musculus adult male small intestine cDNA, RI...	42	3.3
34	dbj|AK076093.1| Mus musculus 10, 11 days embryo whole body cDNA,...	42	3.3
35	ref|NM_025887.2| Mus musculus RAB5A, member RAS oncogene family ...	42	3.3
36	emb|X53933.1|NSRNP28 Tobacco mRNA for 28 kDa chloroplast ribonuc...	42	3.3
37	gb|BC096481.1| Mus musculus RAB5A, member RAS oncogene family, m...	42	3.3
38	dbj|AK177306.1| Mus musculus cDNA, clone:Y0G0102F06, strand:plus...	42	3.3
39	gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome	42	3.3
40	gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete g...	42	3.3
41	ref|NM_022692.1| Rattus norvegicus RAB5A, member RAS oncogene fa...	42	3.3
42	gb|BC034370.1| Mus musculus RAB5A, member RAS oncogene family, m...	42	3.3
43	dbj|D28862.1| Nicotiana sylvestris mRNA for RNA binding protein,...	42	3.3

---

>gb|DQ245844.1| Zea mays clone 20816 mRNA sequence
          Length = 773
 Score =  394 bits (199), Expect = e-106
 Identities = 331/375 (88%)
 Strand = Plus / Plus

                                                                       
Query: 66  catggcggccctcatcaagctcggaagccttcttaggcagagtgctttcgcgagcagcgc 125
           |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||
Sbjct: 59  catggcggccctcatcaagctcggaagccttcttaggcagagtgctgtggcgagcagtgc 118

                                                                       
Query: 126 atcgacaggctcggctcctgccctgttcaacgctgcccgtttcatgtgcgccggccagtc 185
            ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
Sbjct: 119 ctcgaccggctcggctcctgccctgttcaacgctgcccgcttcatgtgcgccggccagcc 178

                                                                       
Query: 186 tggtcctagctccaagcttttcgtcggtggtctcgcctggggtactgatgatcactcgct 245
           || |  | |||||||||||||||| || ||||| ||||||| |||||||||||| |||||
Sbjct: 179 tgctgatggctccaagcttttcgttggcggtcttgcctgggctactgatgatcattcgct 238

                                                                       
Query: 246 caaggaggcgtttcaaagcttcggagaggtcaccgaagcacgtgtcatcactgacagaga 305
            |||||||||||||||||||| || ||||||   ||||||||||| ||||||||||| ||
Sbjct: 239 gaaggaggcgtttcaaagctttggtgaggtcgttgaagcacgtgttatcactgacaggga 298

                                                                       
Query: 306 gactggaaggtctagagggtttggttttgtgagctttgcgagtgaagaggatgcaggaaa 365
           |||||||||||||||||||||||||||||||||||| || ||||  |||||||||   | 
Sbjct: 299 gactggaaggtctagagggtttggttttgtgagcttcgccagtggcgaggatgcaaagag 358

                                                                       
Query: 366 tgccgccaaaggcatggacggtcaggagcttgggggaaggaacgtccgtgtgaactttgc 425
           ||| ||  ||  |||||||||  |||||||||  || |||||||||||||||||||||||
Sbjct: 359 tgctgcagaaaacatggacggcaaggagcttgctgggaggaacgtccgtgtgaactttgc 418

                          
Query: 426 caatgagagaccttc 440
           ||| ||| |||||||
Sbjct: 419 caacgagcgaccttc 433



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 33/33 (100%)
 Strand = Plus / Plus

                                            
Query: 610 ttttaggacagtgtcttgattatgtggaaccta 642
           |||||||||||||||||||||||||||||||||
Sbjct: 624 ttttaggacagtgtcttgattatgtggaaccta 656



 Score = 42.1 bits (21), Expect = 3.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 762 tgctgcttcgagactcggatgattctctaggaa 794
           |||||||||||| ||||||||| |||| |||||
Sbjct: 726 tgctgcttcgaggctcggatgagtctcaaggaa 758

---

>emb|CT830471.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA101M05, full
           insert sequence
          Length = 1067

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 262 agcttcggagaggtcaccgaagcacgtgtcatcactgacagagagactggaaggtctaga 321
           |||||||| || || || ||||| || || |||| |||||||||  |||||||||| |||
Sbjct: 247 agcttcggggatgtgactgaagctcgggtgatcaatgacagagaatctggaaggtcaaga 306

                                  
Query: 322 gggtttggttttgtgagctttgc 344
           |||||||| ||||| ||||||||
Sbjct: 307 gggtttggctttgttagctttgc 329



 Score = 42.1 bits (21), Expect = 3.3
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 378 catggacggtcaggagcttgggggaaggaacgtccgtgtgaactttgccaatgagagacc 437
           |||||||||| |||| |||| |||| |||   |||| |||||||| || |||||||||||
Sbjct: 363 catggacggtaaggaacttgagggacggagtatccgcgtgaacttcgcgaatgagagacc 422

            
Query: 438 t 438
           |
Sbjct: 423 t 423

---

>emb|CT828288.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA105E12, full
           insert sequence
          Length = 1069

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 262 agcttcggagaggtcaccgaagcacgtgtcatcactgacagagagactggaaggtctaga 321
           |||||||| || || || ||||| || || |||| |||||||||  |||||||||| |||
Sbjct: 248 agcttcggggatgtgactgaagctcgggtgatcaatgacagagaatctggaaggtcaaga 307

                                  
Query: 322 gggtttggttttgtgagctttgc 344
           |||||||| ||||| ||||||||
Sbjct: 308 gggtttggctttgttagctttgc 330

---

>ref|NM_001051730.1| Oryza sativa (japonica cultivar-group) Os01g0916600 (Os01g0916600)
           mRNA, complete cds
          Length = 872

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 262 agcttcggagaggtcaccgaagcacgtgtcatcactgacagagagactggaaggtctaga 321
           |||||||| || || || ||||| || || |||| |||||||||  |||||||||| |||
Sbjct: 248 agcttcggggatgtgactgaagctcgggtgatcaatgacagagaatctggaaggtcaaga 307

                                  
Query: 322 gggtttggttttgtgagctttgc 344
           |||||||| ||||| ||||||||
Sbjct: 308 gggtttggctttgttagctttgc 330



 Score = 42.1 bits (21), Expect = 3.3
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 378 catggacggtcaggagcttgggggaaggaacgtccgtgtgaactttgccaatgagagacc 437
           |||||||||| |||| |||| |||| |||   |||| |||||||| || |||||||||||
Sbjct: 364 catggacggtaaggaacttgagggacggagtatccgcgtgaacttcgcgaatgagagacc 423

            
Query: 438 t 438
           |
Sbjct: 424 t 424

---

>emb|AJ002894.1|OSAJ2894 Oryza sativa mRNA for glycine rich RNA-binding protein 2 (OsGRP2)
          Length = 705

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 262 agcttcggagaggtcaccgaagcacgtgtcatcactgacagagagactggaaggtctaga 321
           |||||||| || || || ||||| || || |||| |||||||||  |||||||||| |||
Sbjct: 223 agcttcggggatgtgactgaagctcgggtgatcaatgacagagaatctggaaggtcaaga 282

                                  
Query: 322 gggtttggttttgtgagctttgc 344
           |||||||| ||||| ||||||||
Sbjct: 283 gggtttggctttgttagctttgc 305



 Score = 42.1 bits (21), Expect = 3.3
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 378 catggacggtcaggagcttgggggaaggaacgtccgtgtgaactttgccaatgagagacc 437
           |||||||||| |||| |||| |||| |||   |||| |||||||| || |||||||||||
Sbjct: 339 catggacggtaaggaacttgagggacggagtatccgcgtgaacttcgcgaatgagagacc 398

            
Query: 438 t 438
           |
Sbjct: 399 t 399

---

>dbj|AK121668.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033067G16, full
           insert sequence
          Length = 809

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 262 agcttcggagaggtcaccgaagcacgtgtcatcactgacagagagactggaaggtctaga 321
           |||||||| || || || ||||| || || |||| |||||||||  |||||||||| |||
Sbjct: 269 agcttcggggatgtgactgaagctcgggtgatcaatgacagagaatctggaaggtcaaga 328

                                  
Query: 322 gggtttggttttgtgagctttgc 344
           |||||||| ||||| ||||||||
Sbjct: 329 gggtttggctttgttagctttgc 351



 Score = 42.1 bits (21), Expect = 3.3
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 378 catggacggtcaggagcttgggggaaggaacgtccgtgtgaactttgccaatgagagacc 437
           |||||||||| |||| |||| |||| |||   |||| |||||||| || |||||||||||
Sbjct: 385 catggacggtaaggaacttgagggacggagtatccgcgtgaacttcgcgaatgagagacc 444

            
Query: 438 t 438
           |
Sbjct: 445 t 445

---

>dbj|AK059446.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-A07, full
           insert sequence
          Length = 874

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 262 agcttcggagaggtcaccgaagcacgtgtcatcactgacagagagactggaaggtctaga 321
           |||||||| || || || ||||| || || |||| |||||||||  |||||||||| |||
Sbjct: 249 agcttcggggatgtgactgaagctcgggtgatcaatgacagagaatctggaaggtcaaga 308

                                  
Query: 322 gggtttggttttgtgagctttgc 344
           |||||||| ||||| ||||||||
Sbjct: 309 gggtttggctttgttagctttgc 331



 Score = 42.1 bits (21), Expect = 3.3
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 378 catggacggtcaggagcttgggggaaggaacgtccgtgtgaactttgccaatgagagacc 437
           |||||||||| |||| |||| |||| |||   |||| |||||||| || |||||||||||
Sbjct: 365 catggacggtaaggaacttgagggacggagtatccgcgtgaacttcgcgaatgagagacc 424

            
Query: 438 t 438
           |
Sbjct: 425 t 425

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                     
Query: 292      atcactgacagagagactggaaggtctagagggtttggttttgtgagctttgc 344
                |||| |||||||||  |||||||||| ||||||||||| ||||| ||||||||
Sbjct: 39948867 atcaatgacagagaatctggaaggtcaagagggtttggctttgttagctttgc 39948919

---

>dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0413C03
          Length = 162161

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 292   atcactgacagagagactggaaggtctagagggtttggttttgtgagctttgc 344
             |||| |||||||||  |||||||||| ||||||||||| ||||| ||||||||
Sbjct: 40318 atcaatgacagagaatctggaaggtcaagagggtttggctttgttagctttgc 40370

---

>dbj|AP003433.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0004D12
          Length = 138136

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 292    atcactgacagagagactggaaggtctagagggtttggttttgtgagctttgc 344
              |||| |||||||||  |||||||||| ||||||||||| ||||| ||||||||
Sbjct: 129575 atcaatgacagagaatctggaaggtcaagagggtttggctttgttagctttgc 129627

---

>gb|BT013136.1| Lycopersicon esculentum clone 114438F, mRNA sequence
          Length = 1317

 Score = 50.1 bits (25), Expect = 0.013
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 297 tgacagagagactggaaggtctagagggtttggttttgtga 337
           |||||||||| ||||||||||  |||| |||||||||||||
Sbjct: 835 tgacagagagtctggaaggtcacgaggctttggttttgtga 875

---

>gb|BT012700.1| Lycopersicon esculentum clone 113574R, mRNA sequence
          Length = 1329

 Score = 50.1 bits (25), Expect = 0.013
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 297 tgacagagagactggaaggtctagagggtttggttttgtga 337
           |||||||||| ||||||||||  |||| |||||||||||||
Sbjct: 820 tgacagagagtctggaaggtcacgaggctttggttttgtga 860

---

>ref|XM_001184908.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC754241 (LOC754241), mRNA
          Length = 629

 Score = 48.1 bits (24), Expect = 0.053
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 316 tctagagggtttggttttgtgagctttg 343
           |||| |||||||||||||||||||||||
Sbjct: 203 tctaaagggtttggttttgtgagctttg 230

---

>ref|XM_001188704.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC760561 (LOC760561), mRNA
          Length = 629

 Score = 48.1 bits (24), Expect = 0.053
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 316 tctagagggtttggttttgtgagctttg 343
           |||| |||||||||||||||||||||||
Sbjct: 203 tctaaagggtttggttttgtgagctttg 230

---

>gb|BT019164.1| Zea mays clone Contig829.F mRNA sequence
          Length = 1109

 Score = 46.1 bits (23), Expect = 0.21
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 297 tgacagagagactggaaggtctagagggtttggttttgt 335
           |||||| |||| ||||||||| || ||||||||||||||
Sbjct: 437 tgacagggagagtggaaggtcaagggggtttggttttgt 399

---

>gb|AY105580.1| Zea mays PCO127552 mRNA sequence
          Length = 1133

 Score = 46.1 bits (23), Expect = 0.21
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 297 tgacagagagactggaaggtctagagggtttggttttgt 335
           |||||| |||| ||||||||| || ||||||||||||||
Sbjct: 694 tgacagggagagtggaaggtcaagggggtttggttttgt 732

---

>ref|NM_001003317.1| Canis familiaris RAB5A, member RAS oncogene family (RAB5A), mRNA
 gb|M35520.1|DOGRAB5A C.familiaris GTP-binding protein (rab5) mRNA, complete cds
          Length = 796

 Score = 46.1 bits (23), Expect = 0.21
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 731 tgtcttgatgatacaacagtaaa 753
           |||||||||||||||||||||||
Sbjct: 307 tgtcttgatgatacaacagtaaa 329

---

>gb|CP000410.1| Streptococcus pneumoniae D39, complete genome
          Length = 2046115

 Score = 44.1 bits (22), Expect = 0.83
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 647    atgtctgtcttatcatctgtga 668
              ||||||||||||||||||||||
Sbjct: 800512 atgtctgtcttatcatctgtga 800491

---

>gb|AE008455.1| Streptococcus pneumoniae R6 section 71 of 184 of the complete genome
          Length = 10284

 Score = 44.1 bits (22), Expect = 0.83
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 647  atgtctgtcttatcatctgtga 668
            ||||||||||||||||||||||
Sbjct: 4100 atgtctgtcttatcatctgtga 4079

---

>gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome
          Length = 2160842

 Score = 44.1 bits (22), Expect = 0.83
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 647    atgtctgtcttatcatctgtga 668
              ||||||||||||||||||||||
Sbjct: 844075 atgtctgtcttatcatctgtga 844054

---

>dbj|AB232593.1| Mus musculus mRNA for Rab5A, complete cds
          Length = 648

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 187 tgtcttgatgacacaacagtaaaat 211

---

>gb|AC165960.4| Mus musculus BAC clone RP23-395M20 from chromosome 17, complete sequence
          Length = 192675

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 731    tgtcttgatgatacaacagtaaaat 755
              ||||||||||| |||||||||||||
Sbjct: 180554 tgtcttgatgacacaacagtaaaat 180578

---

>gb|BC004842.1| Mus musculus RAB5A, member RAS oncogene family, mRNA (cDNA clone
           MGC:6509 IMAGE:2649317), complete cds
          Length = 2246

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 515 tgtcttgatgacacaacagtaaaat 539

---

>gb|AC131785.3| Mus musculus BAC clone RP24-397D13 from chromosome 17, complete
             sequence
          Length = 147557

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 731   tgtcttgatgatacaacagtaaaat 755
             ||||||||||| |||||||||||||
Sbjct: 43197 tgtcttgatgacacaacagtaaaat 43221

---

>dbj|AK151066.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830022H01 product:RAB5A, member
           RAS oncogene family, full insert sequence
          Length = 2118

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 408 tgtcttgatgacacaacagtaaaat 432

---

>dbj|AK150346.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830003N13 product:RAB5A, member
           RAS oncogene family, full insert sequence
          Length = 2117

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 408 tgtcttgatgacacaacagtaaaat 432

---

>dbj|AK150405.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830006M11 product:RAB5A, member
           RAS oncogene family, full insert sequence
          Length = 2162

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 452 tgtcttgatgacacaacagtaaaat 476

---

>dbj|AK150296.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830001N22 product:RAB5A, member
           RAS oncogene family, full insert sequence
          Length = 2118

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 408 tgtcttgatgacacaacagtaaaat 432

---

>dbj|AK153131.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830124A17 product:RAB5A, member
           RAS oncogene family, full insert sequence
          Length = 2118

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 408 tgtcttgatgacacaacagtaaaat 432

---

>dbj|AK159706.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420028L03 product:RAB5A, member RAS
           oncogene family, full insert sequence
          Length = 2110

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 408 tgtcttgatgacacaacagtaaaat 432

---

>dbj|AK010495.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410015H04 product:RAB5A, member RAS oncogene
           family, full insert sequence
          Length = 2210

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 499 tgtcttgatgacacaacagtaaaat 523

---

>dbj|AK002631.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610014J03 product:SMALL GTP-BINDING
           PROTEIN RAB5 homolog [Rattus norvegicus], full insert
           sequence
          Length = 2112

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 409 tgtcttgatgacacaacagtaaaat 433

---

>dbj|AK008198.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010012B19 product:RAB5A, member
           RAS oncogene family, full insert sequence
          Length = 1232

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 395 tgtcttgatgacacaacagtaaaat 419

---

>dbj|AK076093.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2810011C17 product:RAB5A, member
           RAS oncogene family, full insert sequence
          Length = 2075

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 635 tgtcttgatgacacaacagtaaaat 659

---

>ref|NM_025887.2| Mus musculus RAB5A, member RAS oncogene family (Rab5a), mRNA
 dbj|AK081999.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130093C03 product:RAB5A, member RAS
           oncogene family, full insert sequence
          Length = 2367

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 655 tgtcttgatgacacaacagtaaaat 679

---

>emb|X53933.1|NSRNP28 Tobacco mRNA for 28 kDa chloroplast ribonucleoprotein
          Length = 1079

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 297 tgacagagagactggaaggtctagagggtttggttttgtga 337
           |||||||||| ||||| ||||  |||| |||||||||||||
Sbjct: 696 tgacagagagtctggacggtcacgaggctttggttttgtga 736

---

>gb|BC096481.1| Mus musculus RAB5A, member RAS oncogene family, mRNA (cDNA clone
           MGC:106126 IMAGE:5322132), complete cds
          Length = 2316

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 588 tgtcttgatgacacaacagtaaaat 612

---

>dbj|AK177306.1| Mus musculus cDNA, clone:Y0G0102F06, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000017975, based on BLAT search
          Length = 478

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 420 tgtcttgatgacacaacagtaaaat 444

---

>gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome
          Length = 2616530

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 735    ttgatgatacaacagtaaaat 755
              |||||||||||||||||||||
Sbjct: 572735 ttgatgatacaacagtaaaat 572755

---

>gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete genome
          Length = 2499279

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 735    ttgatgatacaacagtaaaat 755
              |||||||||||||||||||||
Sbjct: 680502 ttgatgatacaacagtaaaat 680522

---

>ref|NM_022692.1| Rattus norvegicus RAB5A, member RAS oncogene family (Rab5a), mRNA
 gb|AF072935.1|AF072935 Rattus norvegicus small GTP-binding protein rab5 (RAB5) mRNA,
           complete cds
          Length = 649

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 188 tgtcttgatgacacaacagtaaaat 212

---

>gb|BC034370.1| Mus musculus RAB5A, member RAS oncogene family, mRNA (cDNA clone
           MGC:18688 IMAGE:3709729), complete cds
          Length = 1866

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 731 tgtcttgatgatacaacagtaaaat 755
           ||||||||||| |||||||||||||
Sbjct: 397 tgtcttgatgacacaacagtaaaat 421

---

>dbj|D28862.1| Nicotiana sylvestris mRNA for RNA binding protein, complete cds
          Length = 575

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 199 aagcttttcgtcggtggtctcgcctggggtactgatgatca 239
           ||||||||||| ||||||||  | ||||| |||||||||||
Sbjct: 141 aagcttttcgttggtggtctttcatggggaactgatgatca 181


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 103,654,469
Number of extensions: 5025689
Number of successful extensions: 92444
Number of sequences better than 10.0: 43
Number of HSP's gapped: 92444
Number of HSP's successfully gapped: 51
Length of query: 871
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 849
Effective length of database: 18,508,616,841
Effective search space: 15713815698009
Effective search space used: 15713815698009
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)

---