| Clone Name | FLbaf171n22 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_001071419.1| Oryza sativa (japonica cultivar-group) Os10g0483100 (Os10g0483100) mRNA, complete cds Length = 1632 Score = 87.7 bits (44), Expect = 1e-13 Identities = 50/52 (96%) Strand = Plus / Plus Query: 574 tgatgatgagatagagcttactgtggaagatcttgtgagcatagctgaagag 625 ||||||||| |||||||||||||||||||||||| ||||||||||||||||| Sbjct: 730 tgatgatgatatagagcttactgtggaagatcttttgagcatagctgaagag 781 Score = 52.0 bits (26), Expect = 0.006 Identities = 35/38 (92%) Strand = Plus / Plus Query: 1048 tgtggcgaaaaagaagagcagcctgaaagatatggtgg 1085 |||| ||||||||||||||||| ||||||||| ||||| Sbjct: 1357 tgtgacgaaaaagaagagcagcttgaaagataaggtgg 1394
>gb|AC051632.18| Oryza sativa chromosome 10 BAC OSJNBa0012L23 genomic sequence, complete sequence Length = 153182 Score = 87.7 bits (44), Expect = 1e-13 Identities = 50/52 (96%) Strand = Plus / Minus Query: 574 tgatgatgagatagagcttactgtggaagatcttgtgagcatagctgaagag 625 ||||||||| |||||||||||||||||||||||| ||||||||||||||||| Sbjct: 86427 tgatgatgatatagagcttactgtggaagatcttttgagcatagctgaagag 86376 Score = 52.0 bits (26), Expect = 0.006 Identities = 35/38 (92%) Strand = Plus / Minus Query: 1048 tgtggcgaaaaagaagagcagcctgaaagatatggtgg 1085 |||| ||||||||||||||||| ||||||||| ||||| Sbjct: 84828 tgtgacgaaaaagaagagcagcttgaaagataaggtgg 84791
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10 Length = 22685906 Score = 87.7 bits (44), Expect = 1e-13 Identities = 50/52 (96%) Strand = Plus / Minus Query: 574 tgatgatgagatagagcttactgtggaagatcttgtgagcatagctgaagag 625 ||||||||| |||||||||||||||||||||||| ||||||||||||||||| Sbjct: 17731307 tgatgatgatatagagcttactgtggaagatcttttgagcatagctgaagag 17731256 Score = 52.0 bits (26), Expect = 0.006 Identities = 35/38 (92%) Strand = Plus / Minus Query: 1048 tgtggcgaaaaagaagagcagcctgaaagatatggtgg 1085 |||| ||||||||||||||||| ||||||||| ||||| Sbjct: 17729708 tgtgacgaaaaagaagagcagcttgaaagataaggtgg 17729671
>dbj|AK071436.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093J24, full insert sequence Length = 1634 Score = 87.7 bits (44), Expect = 1e-13 Identities = 50/52 (96%) Strand = Plus / Plus Query: 574 tgatgatgagatagagcttactgtggaagatcttgtgagcatagctgaagag 625 ||||||||| |||||||||||||||||||||||| ||||||||||||||||| Sbjct: 730 tgatgatgatatagagcttactgtggaagatcttttgagcatagctgaagag 781 Score = 44.1 bits (22), Expect = 1.4 Identities = 34/38 (89%) Strand = Plus / Plus Query: 1048 tgtggcgaaaaagaagagcagcctgaaagatatggtgg 1085 |||| ||||||||||| ||||| ||||||||| ||||| Sbjct: 1357 tgtgacgaaaaagaagggcagcttgaaagataaggtgg 1394
>ref|XM_001170315.1| PREDICTED: Pan troglodytes centromere protein E, transcript variant 4 (CENPE), mRNA Length = 8248 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2396 acttgaagaaattgggaaaacaa 2418
>ref|XM_001170294.1| PREDICTED: Pan troglodytes centromere protein E, transcript variant 3 (CENPE), mRNA Length = 8504 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2472 acttgaagaaattgggaaaacaa 2494
>ref|XM_517376.2| PREDICTED: Pan troglodytes centromere protein E, transcript variant 5 (CENPE), mRNA Length = 8503 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2471 acttgaagaaattgggaaaacaa 2493
>ref|XM_001170275.1| PREDICTED: Pan troglodytes centromere protein E, transcript variant 2 (CENPE), mRNA Length = 8612 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2472 acttgaagaaattgggaaaacaa 2494
>ref|XM_001170168.1| PREDICTED: Pan troglodytes centromere protein E, transcript variant 1 (CENPE), mRNA Length = 8611 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2471 acttgaagaaattgggaaaacaa 2493
>ref|XM_001110550.1| PREDICTED: Macaca mulatta similar to centromere protein E, transcript variant 2 (LOC711186), mRNA Length = 8505 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2472 acttgaagaaattgggaaaacaa 2494
>ref|XM_001110512.1| PREDICTED: Macaca mulatta similar to centromere protein E, transcript variant 1 (LOC711186), mRNA Length = 8613 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2472 acttgaagaaattgggaaaacaa 2494
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4 Length = 35498469 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctcttttg 1269 ||||||||||||||||||||||| Sbjct: 15975021 agtagcttttcttttctcttttg 15974999
>dbj|AB209996.1| Homo sapiens mRNA for CENPE variant protein, partial cds, clone: ef02778 Length = 8167 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2322 acttgaagaaattgggaaaacaa 2344
>gb|AC079919.5| Homo sapiens BAC clone RP11-291N5 from 4, complete sequence Length = 168311 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Minus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 59249 acttgaagaaattgggaaaacaa 59227
>ref|NM_001813.2| Homo sapiens centromere protein E, 312kDa (CENPE), mRNA Length = 8630 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2472 acttgaagaaattgggaaaacaa 2494
>emb|Z15005.1|HSCENPE H.sapiens CENP-E mRNA Length = 8257 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaacaa 470 ||||||||||||||||||||||| Sbjct: 2472 acttgaagaaattgggaaaacaa 2494
>emb|AL606625.3|OSJN00039 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032I19, complete sequence Length = 145383 Score = 46.1 bits (23), Expect = 0.35 Identities = 23/23 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctcttttg 1269 ||||||||||||||||||||||| Sbjct: 59234 agtagcttttcttttctcttttg 59212
>gb|EF029175.1| Pollicipes pollicipes isolate PPOL846_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 477 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgaggg 247
>gb|EF029174.1| Pollicipes pollicipes isolate PPOL845_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 477 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgaggg 247
>gb|EF029161.1| Pollicipes pollicipes isolate PPOL832_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 476 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgaggg 247
>gb|EF029153.1| Pollicipes pollicipes isolate PPOL823_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 475 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 225 cttttcttttctcttttgaggg 246
>gb|EF029152.1| Pollicipes pollicipes isolate PPOL822_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 477 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgaggg 247
>gb|EF029147.1| Pollicipes pollicipes isolate PPOL817_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 476 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgaggg 247
>gb|EF029144.1| Pollicipes pollicipes isolate PPOL814_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 477 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgaggg 247
>gb|EF029136.1| Pollicipes pollicipes isolate PPOL831_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 476 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgaggg 247
>gb|EF029129.1| Pollicipes pollicipes isolate PPOL800_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 475 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 225 cttttcttttctcttttgaggg 246
>ref|XM_526632.2| PREDICTED: Pan troglodytes matrix, extracellular phosphoglycoprotein with ASARM motif (bone) (MEPE), mRNA Length = 1981 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1187 cttttcttttctcttttgaggg 1166
>ref|NM_020203.2| Homo sapiens matrix, extracellular phosphoglycoprotein with ASARM motif (bone) (MEPE), mRNA Length = 1979 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1192 cttttcttttctcttttgaggg 1171
>ref|XM_001098930.1| PREDICTED: Macaca mulatta matrix, extracellular phosphoglycoprotein with ASARM motif (bone), transcript variant 1 (MEPE), mRNA Length = 2250 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1459 cttttcttttctcttttgaggg 1438
>ref|XM_001099032.1| PREDICTED: Macaca mulatta matrix, extracellular phosphoglycoprotein with ASARM motif (bone), transcript variant 2 (MEPE), mRNA Length = 1984 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1193 cttttcttttctcttttgaggg 1172
>ref|XM_001099140.1| PREDICTED: Macaca mulatta matrix, extracellular phosphoglycoprotein with ASARM motif (bone), transcript variant 3 (MEPE), mRNA Length = 2146 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1355 cttttcttttctcttttgaggg 1334
>gb|AY360386.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0017M13, complete sequence Length = 161902 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 9958 agtagcttttcttttctctttt 9937 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 46645 agtagcttttcttttctctttt 46624
>gb|AC122903.4| Mus musculus BAC clone RP23-44N5 from chromosome 1, complete sequence Length = 169832 Score = 44.1 bits (22), Expect = 1.4 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 aaacccatcagaaggaagagaaaaat 105 |||||||||| ||||||||||||||| Sbjct: 155424 aaacccatcaaaaggaagagaaaaat 155449
>gb|AC124519.2| Mus musculus BAC clone RP23-393I12 from 1, complete sequence Length = 195739 Score = 44.1 bits (22), Expect = 1.4 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 aaacccatcagaaggaagagaaaaat 105 |||||||||| ||||||||||||||| Sbjct: 17826 aaacccatcaaaaggaagagaaaaat 17851
>dbj|AK075076.1| Homo sapiens cDNA FLJ90595 fis, clone PLACE1001183 Length = 2031 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1238 cttttcttttctcttttgaggg 1217
>gb|AC068308.12| Homo sapiens 3 BAC RP11-275H4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 154495 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 248 aggaaagtttgtggaagagctg 269 |||||||||||||||||||||| Sbjct: 117330 aggaaagtttgtggaagagctg 117309
>gb|AC093768.3| Homo sapiens BAC clone RP11-113G13 from 4, complete sequence Length = 187624 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 76720 cttttcttttctcttttgaggg 76699
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8 Length = 28434780 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 13193480 agtagcttttcttttctctttt 13193459 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 13285483 agtagcttttcttttctctttt 13285462 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 13322170 agtagcttttcttttctctttt 13322149
>dbj|AB060891.1| Macaca fascicularis brain cDNA clone:QtrA-13588, similar to human matrix, extracellular phosphoglycoprotein with ASARM motif (bone) (MEPE), mRNA,. NM_020203 Length = 2259 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1461 cttttcttttctcttttgaggg 1440
>dbj|AB056814.1| Macaca fascicularis brain cDNA clone:QflA-15292, similar to human matrix, extracellular phosphoglycoprotein with ASARM motif (bone) (MEPE), mRNA., NM_020203 Length = 2085 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1303 cttttcttttctcttttgaggg 1282
>dbj|AB050259.1| Macaca fascicularis brain cDNA, clone:QnpA-21045, similar to human matrix, extracellular phosphoglycoprotein with ASARM motif (bone) (MEPE), mRNA, NM_020203.1 Length = 2140 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1355 cttttcttttctcttttgaggg 1334
>gb|AC091022.4| Homo sapiens chromosome 8, clone RP11-65A5, complete sequence Length = 155949 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 45694 agtagcttttcttttctctttt 45715
>gb|AF325916.1|AF325916 Homo sapiens matrix extracellular phosphoglycoprotein precursor (MEPE) mRNA, complete cds Length = 1617 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1192 cttttcttttctcttttgaggg 1171
>emb|AL683883.26| Mouse DNA sequence from clone RP23-361B8 on chromosome X, complete sequence Length = 190863 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1241 ataataagtagcttttcttttc 1262 |||||||||||||||||||||| Sbjct: 8227 ataataagtagcttttcttttc 8206
>dbj|AP005832.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1136D08 Length = 176635 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 36952 agtagcttttcttttctctttt 36931 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 73639 agtagcttttcttttctctttt 73618
>dbj|AP006482.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone: B1101E07 Length = 158084 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1247 agtagcttttcttttctctttt 1268 |||||||||||||||||||||| Sbjct: 69831 agtagcttttcttttctctttt 69810
>emb|AJ276396.1|HSA276396 Homo sapiens mRNA for matrix extracellular phosphoglycoprotein (MEPE gene) Length = 1989 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1202 cttttcttttctcttttgaggg 1181
>dbj|AB046056.1| Macaca fascicularis mRNA for matrix extracellular phosphoglycoprotein(MEPE gene), complete cds Length = 2095 Score = 44.1 bits (22), Expect = 1.4 Identities = 22/22 (100%) Strand = Plus / Minus Query: 1252 cttttcttttctcttttgaggg 1273 |||||||||||||||||||||| Sbjct: 1314 cttttcttttctcttttgaggg 1293
>ref|XM_419025.2| PREDICTED: Gallus gallus hypothetical LOC420941 (LOC420941), mRNA Length = 1085 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 291 ggatgctggaggatgtgggat 311 ||||||||||||||||||||| Sbjct: 282 ggatgctggaggatgtgggat 262
>gb|EF029157.1| Pollicipes pollicipes isolate PPOL827_CV tRNA-Gln gene, partial sequence; tRNA-Ser gene, complete sequence; and 12S ribosomal RNA gene, partial sequence; mitochondrial Length = 476 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgagg 1272 ||||||||||||||||||||| Sbjct: 226 cttttcttttctcttttgagg 246
>gb|AC139852.18| Medicago truncatula clone mth2-8n13, complete sequence Length = 155295 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 445 tgaacttgaagaaattgggaa 465 ||||||||||||||||||||| Sbjct: 34408 tgaacttgaagaaattgggaa 34388
>ref|XM_001058241.1| PREDICTED: Rattus norvegicus hypothetical protein LOC681743 (LOC681743), mRNA Length = 864 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1031 caagtgcagggggtgcctgtg 1051 ||||||||||||||||||||| Sbjct: 538 caagtgcagggggtgcctgtg 518
>gb|AC183763.2| Pan troglodytes BAC clone CH251-685C13 from chromosome 3, complete sequence Length = 186561 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 gcaaacccatcagaaggaaga 98 ||||||||||||||||||||| Sbjct: 37907 gcaaacccatcagaaggaaga 37927
>gb|AC183529.4| Pan troglodytes BAC clone CH251-669H19 from chromosome 3, complete sequence Length = 216860 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gcaaacccatcagaaggaaga 98 ||||||||||||||||||||| Sbjct: 201445 gcaaacccatcagaaggaaga 201425
>gb|AC183269.3| Pan troglodytes BAC clone CH251-685E7 from chromosome 3, complete sequence Length = 220398 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gcaaacccatcagaaggaaga 98 ||||||||||||||||||||| Sbjct: 107917 gcaaacccatcagaaggaaga 107897
>emb|CT573072.1| Kuenenia stuttgartiensis genome fragment KUST_D (4 of 5) Length = 896449 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1252 cttttcttttctcttttgagg 1272 ||||||||||||||||||||| Sbjct: 641749 cttttcttttctcttttgagg 641769
>gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome 13, complete sequence Length = 203039 Score = 42.1 bits (21), Expect = 5.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 89 agaaggaagagaaaaattgtggata 113 |||||||||| |||||||||||||| Sbjct: 152331 agaaggaagaaaaaaattgtggata 152307
>gb|AE013199.1| Thermoanaerobacter tengcongensis MB4, section 226 of 244 of the complete genome Length = 13138 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 331 aataactgatgatgagataga 351 ||||||||||||||||||||| Sbjct: 4501 aataactgatgatgagataga 4481
>ref|XM_847538.1| PREDICTED: Canis familiaris similar to centromere protein E (LOC610125), mRNA Length = 3718 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 448 acttgaagaaattgggaaaac 468 ||||||||||||||||||||| Sbjct: 2368 acttgaagaaattgggaaaac 2388
>ref|XM_545851.2| PREDICTED: Canis familiaris similar to leucine-rich repeat kinase 1 (LOC488733), mRNA Length = 1890 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 397 agaaaagaccagaaggaagca 417 ||||||||||||||||||||| Sbjct: 445 agaaaagaccagaaggaagca 465
>gb|AC160113.2| Mus musculus BAC clone RP24-84O12 from chromosome 9, complete sequence Length = 223852 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1253 ttttcttttctcttttgaggg 1273 ||||||||||||||||||||| Sbjct: 11683 ttttcttttctcttttgaggg 11663
>gb|AC156023.2| Mus musculus BAC clone RP23-210I15 from chromosome 16, complete sequence Length = 196765 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1245 taagtagcttttcttttctct 1265 ||||||||||||||||||||| Sbjct: 186365 taagtagcttttcttttctct 186345
>gb|AC160135.2| Mus musculus BAC clone RP23-160P11 from chromosome 9, complete sequence Length = 205946 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1253 ttttcttttctcttttgaggg 1273 ||||||||||||||||||||| Sbjct: 40433 ttttcttttctcttttgaggg 40453
>gb|AC146160.3| Pan troglodytes BAC clone RP43-1E22 from chromosome 7, complete sequence Length = 182457 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gcaaacccatcagaaggaaga 98 ||||||||||||||||||||| Sbjct: 105277 gcaaacccatcagaaggaaga 105257
>gb|AC154794.2| Mus musculus BAC clone RP24-485J1 from 16, complete sequence Length = 179257 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1245 taagtagcttttcttttctct 1265 ||||||||||||||||||||| Sbjct: 22025 taagtagcttttcttttctct 22005
>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome Length = 1767403 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 621 aagagattataaatgctgata 641 ||||||||||||||||||||| Sbjct: 1599507 aagagattataaatgctgata 1599487
>gb|AC171274.2| Gallus gallus BAC clone CH261-121C13 from chromosome ul, complete sequence Length = 218983 Score = 42.1 bits (21), Expect = 5.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 241 gaatgagaggaaagtttgtgg 261 ||||||||||||||||||||| Sbjct: 68811 gaatgagaggaaagtttgtgg 68791
>emb|AL732459.5| Mouse DNA sequence from clone RP23-115J4 on chromosome X, complete sequence Length = 201897 Score = 42.1 bits (21), Expect = 5.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 251 aaagtttgtggaagagctgctacaaagaa 279 |||||||| ||||||||||||||||||| Sbjct: 97664 aaagtttgaagaagagctgctacaaagaa 97692 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 284,509,923 Number of extensions: 15342017 Number of successful extensions: 331218 Number of sequences better than 10.0: 68 Number of HSP's gapped: 331218 Number of HSP's successfully gapped: 76 Length of query: 1421 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 1398 Effective length of database: 18,503,978,556 Effective search space: 25868562021288 Effective search space used: 25868562021288 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)