ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf165l06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ245086.1| Zea mays clone 12845 mRNA sequence Length = 597 Score = 575 bits (290), Expect = e-161 Identities = 448/498 (89%), Gaps = 7/498 (1%) Strand = Plus / Plus Query: 89 aagctccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctcgt 148 ||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 89 aagctccaatggctggcaagtacatcgtcgccggcctcgtcggctcctgtgtcatctcgt 148 Query: 149 acgcctgtgactacatcgtttctcagaagaagatctttggtggcaccatcccagggaccg 208 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 149 acgcttgtgactacatcgtttctcagaagaagatcttcggtggcaccatcccagggactg 208 Query: 209 tctcggacaaggagtggtggaaggctacagagcagaggttccaggcctggccccgcgttg 268 | || ||||||||||||| |||||| || |||||||||||||||||||||||||| || | Sbjct: 209 tgtccgacaaggagtggttgaaggcgacggagcagaggttccaggcctggccccgggtcg 268 Query: 269 ccggaccaccggtcatcatgaaccccatcagccgccagaacttcatcgtcaaggacctca 328 | || || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 269 ctgggccgccggtcatcatgaaccccatcagccgccagaacttcatcgtcaaggacctca 328 Query: 329 acccctgaggcccaagaccttaaggttcgcggtcgttcggaagctttaccctgatggcga 388 ||||||||||| ||||||||||||| | ||||||| | ||| ||||||||||||||||| Sbjct: 329 acccctgaggctcaagaccttaaggattgcggtcggttcgaacctttaccctgatggcga 388 Query: 389 tttctgttgctgcaacctacctatatatgctggctgtactctgaaggctattttgtctgt 448 | |||||||| || |||||||||| |||||||| |||||| ||||||||| |||||| Sbjct: 389 tgcctgttgct-aaatctacctatatgtgctggctttactctcgaggctatttggtctgt 447 Query: 449 ctaaataattgaaacaacactattgtgtagggcaccatggttttatttcttctgaagaac 508 || ||||||| || |||||||||||||||||||||| ||||| ||||||||||||||||| Sbjct: 448 ctcaataattaaatcaacactattgtgtagggcaccgtggttatatttcttctgaagaac 507 Query: 509 agaagagaaccgaacctgaagcatattttgccttggcctttttgtcatctttcctttgca 568 |||||| |||||||||||||| ||||| |||| |||||||||||||||| |||||| Sbjct: 508 agaaga-----gaacctgaagcata-tttgctttggactttttgtcatctttcgtttgca 561 Query: 569 taaccatttgtttacttt 586 ||| ||| |||||||||| Sbjct: 562 taaacatatgtttacttt 579 Score = 67.9 bits (34), Expect = 4e-08 Identities = 37/38 (97%) Strand = Plus / Plus Query: 5 ttccacaatctttctcccctctcgctctctccaccaag 42 ||||| |||||||||||||||||||||||||||||||| Sbjct: 1 ttccagaatctttctcccctctcgctctctccaccaag 38
>gb|DQ244219.1| Zea mays clone 3523 mRNA sequence Length = 715 Score = 95.6 bits (48), Expect = 2e-16 Identities = 69/76 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| ||| || |||||||| |||||||||||||||||||||| Sbjct: 289 gttccaggcctggcctcgcactgctgggccaccggttgtcatgaaccccatcagccgcca 348 Query: 306 gaacttcatcgtcaag 321 |||||||||||||||| Sbjct: 349 gaacttcatcgtcaag 364
>ref|NM_001072354.1| Oryza sativa (japonica cultivar-group) Os11g0161200 (Os11g0161200) mRNA, complete cds Length = 624 Score = 95.6 bits (48), Expect = 2e-16 Identities = 69/76 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| || || |||||||||||||||||||| |||||||||||||| Sbjct: 537 gttccaggcctggcctcggaccgctggaccaccggtcatcatgaatcccatcagccgcca 596 Query: 306 gaacttcatcgtcaag 321 |||||||||||||||| Sbjct: 597 gaacttcatcgtcaag 612
>gb|AC120534.5| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0084A20, complete sequence Length = 139391 Score = 95.6 bits (48), Expect = 2e-16 Identities = 69/76 (90%) Strand = Plus / Minus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| || || |||||||||||||||||||| |||||||||||||| Sbjct: 110840 gttccaggcctggcctcggaccgctggaccaccggtcatcatgaatcccatcagccgcca 110781 Query: 306 gaacttcatcgtcaag 321 |||||||||||||||| Sbjct: 110780 gaacttcatcgtcaag 110765
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11 Length = 28386948 Score = 95.6 bits (48), Expect = 2e-16 Identities = 69/76 (90%) Strand = Plus / Minus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| || || |||||||||||||||||||| |||||||||||||| Sbjct: 2970027 gttccaggcctggcctcggaccgctggaccaccggtcatcatgaatcccatcagccgcca 2969968 Query: 306 gaacttcatcgtcaag 321 |||||||||||||||| Sbjct: 2969967 gaacttcatcgtcaag 2969952 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6729022 gccgccgccgaatccgccgc 6729003 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6729050 gccgccgccgaatccgccgc 6729031 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6737982 gccgccgccgaatccgccgc 6737963 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 11230277 gccgccgccgaatccgccgc 11230296 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 11731225 gccgccgccgaatccgccgc 11731206 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15002390 gccgccgccgaatccgccgc 15002371 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 22917673 gccgccgccgaatccgccgc 22917654 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 22922187 gccgccgccgaatccgccgc 22922168 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 26637599 gccgccgccgaatccgccgc 26637580
>gb|AY104953.1| Zea mays PCO110060 mRNA sequence Length = 856 Score = 95.6 bits (48), Expect = 2e-16 Identities = 69/76 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| ||| || |||||||| |||||||||||||||||||||| Sbjct: 443 gttccaggcctggcctcgcactgctgggccaccggttgtcatgaaccccatcagccgcca 502 Query: 306 gaacttcatcgtcaag 321 |||||||||||||||| Sbjct: 503 gaacttcatcgtcaag 518
>emb|CT830530.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI245B04, full insert sequence Length = 2070 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 1748 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 1807 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 1808 aaacttcatcgt 1819
>emb|CT830529.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI225E03, full insert sequence Length = 2054 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 1747 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 1806 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 1807 aaacttcatcgt 1818
>emb|CT830528.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI208D24, full insert sequence Length = 2050 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 1749 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 1808 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 1809 aaacttcatcgt 1820
>emb|CT830526.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI027N09, full insert sequence Length = 581 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 244 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 303 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 304 aaacttcatcgt 315
>emb|CT830525.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI026M02, full insert sequence Length = 549 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 248 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 307 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 308 aaacttcatcgt 319
>emb|CT830524.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI022P11, full insert sequence Length = 551 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 244 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 303 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 304 aaacttcatcgt 315
>emb|CT830523.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI022A14, full insert sequence Length = 551 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 244 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 303 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 304 aaacttcatcgt 315
>emb|CT830522.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI021J04, full insert sequence Length = 535 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 234 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 293 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 294 aaacttcatcgt 305
>emb|CT830521.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI020L10, full insert sequence Length = 549 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 242 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 301 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 302 aaacttcatcgt 313
>emb|CT830520.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI014B08, full insert sequence Length = 545 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 244 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 303 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 304 aaacttcatcgt 315
>emb|CT830519.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI008C17, full insert sequence Length = 524 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 244 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 303 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 304 aaacttcatcgt 315
>emb|CT830518.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA333Z15, full insert sequence Length = 497 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 244 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 303 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 304 aaacttcatcgt 315
>ref|NM_001063144.1| Oryza sativa (japonica cultivar-group) Os06g0115100 (Os06g0115100) mRNA, complete cds Length = 526 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 225 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 284 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 285 aaacttcatcgt 296
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6 Length = 30731886 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 853270 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 853329 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 853330 aaacttcatcgt 853341 Score = 77.8 bits (39), Expect = 5e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 253 gcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgccagaacttc 312 |||||||| ||| ||| || |||||||| |||||||||||||||| |||||||||||| Sbjct: 832014 gcctggcctcgcactgctgggccaccggttgtcatgaaccccatcagtcgccagaacttc 831955 Query: 313 atcgtcaagga 323 ||||||||||| Sbjct: 831954 atcgtcaagga 831944 Score = 44.1 bits (22), Expect = 0.63 Identities = 46/54 (85%) Strand = Plus / Minus Query: 93 tccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctc 146 ||||||||||| ||||||||||| || ||| || ||||| |||| || |||||| Sbjct: 832292 tccaatggctggcaagtacatcgccgctggtcttgttggttcctttgccatctc 832239 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8483292 gccgccgccgaatccgccgc 8483311 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8818858 gccgccgccgaatccgccgc 8818877 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 cagccgccgccgaatccgcc 75 |||||||||||||||||||| Sbjct: 10785962 cagccgccgccgaatccgcc 10785981 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 cagccgccgccgaatccgcc 75 |||||||||||||||||||| Sbjct: 10794481 cagccgccgccgaatccgcc 10794500 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10830606 gccgccgccgaatccgccgc 10830587 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10837558 gccgccgccgaatccgccgc 10837539 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18073813 gccgccgccgaatccgccgc 18073794 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18085909 gccgccgccgaatccgccgc 18085890 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18282241 gccgccgccgaatccgccgc 18282222 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18291170 gccgccgccgaatccgccgc 18291151 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18319784 gccgccgccgaatccgccgc 18319803 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18328481 gccgccgccgaatccgccgc 18328462 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18573162 gccgccgccgaatccgccgc 18573181 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 21570251 gccgccgccgaatccgccgc 21570270 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 21577731 gccgccgccgaatccgccgc 21577750 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 22898262 gccgccgccgaatccgccgc 22898281 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 26611782 gccgccgccgaatccgccgc 26611801 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 28706778 gccgccgccgaatccgccgc 28706797
>dbj|AP001389.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0541H01 Length = 157519 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 136404 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 136463 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 136464 aaacttcatcgt 136475 Score = 77.8 bits (39), Expect = 5e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 253 gcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgccagaacttc 312 |||||||| ||| ||| || |||||||| |||||||||||||||| |||||||||||| Sbjct: 115148 gcctggcctcgcactgctgggccaccggttgtcatgaaccccatcagtcgccagaacttc 115089 Query: 313 atcgtcaagga 323 ||||||||||| Sbjct: 115088 atcgtcaagga 115078 Score = 44.1 bits (22), Expect = 0.63 Identities = 46/54 (85%) Strand = Plus / Minus Query: 93 tccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctc 146 ||||||||||| ||||||||||| || ||| || ||||| |||| || |||||| Sbjct: 115426 tccaatggctggcaagtacatcgccgctggtcttgttggttcctttgccatctc 115373
>dbj|AP002837.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0019F11 Length = 123673 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 34165 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 34224 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 34225 aaacttcatcgt 34236 Score = 77.8 bits (39), Expect = 5e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 253 gcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgccagaacttc 312 |||||||| ||| ||| || |||||||| |||||||||||||||| |||||||||||| Sbjct: 12909 gcctggcctcgcactgctgggccaccggttgtcatgaaccccatcagtcgccagaacttc 12850 Query: 313 atcgtcaagga 323 ||||||||||| Sbjct: 12849 atcgtcaagga 12839 Score = 44.1 bits (22), Expect = 0.63 Identities = 46/54 (85%) Strand = Plus / Minus Query: 93 tccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctc 146 ||||||||||| ||||||||||| || ||| || ||||| |||| || |||||| Sbjct: 13187 tccaatggctggcaagtacatcgccgctggtcttgttggttcctttgccatctc 13134
>dbj|AK059160.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D05, full insert sequence Length = 526 Score = 87.7 bits (44), Expect = 5e-14 Identities = 65/72 (90%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 225 gttccaggcctggcctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 284 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 285 aaacttcatcgt 296
>emb|CT829711.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA016K23, full insert sequence Length = 507 Score = 85.7 bits (43), Expect = 2e-13 Identities = 124/151 (82%) Strand = Plus / Plus Query: 173 agaagaagatctttggtggcaccatcccagggaccgtctcggacaaggagtggtggaagg 232 |||||||||| ||||| ||||||| ||| ||||| || |||||||| |||||| | | Sbjct: 225 agaagaagatatttggaggcaccacaccacataccgtgtccgacaaggaatggtggcaag 284 Query: 233 ctacagagcagaggttccaggcctggccccgcgttgccggaccaccggtcatcatgaacc 292 | || || ||| ||| || |||||||| ||| ||| || |||||||| ||||||||| Sbjct: 285 caactgacaagaagtttcaagcctggcctcgcactgctgggccaccggttgtcatgaacc 344 Query: 293 ccatcagccgccagaacttcatcgtcaagga 323 ||||||| ||||||||||||||||||||||| Sbjct: 345 ccatcagtcgccagaacttcatcgtcaagga 375 Score = 44.1 bits (22), Expect = 0.63 Identities = 46/54 (85%) Strand = Plus / Plus Query: 93 tccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctc 146 ||||||||||| ||||||||||| || ||| || ||||| |||| || |||||| Sbjct: 145 tccaatggctggcaagtacatcgccgctggtcttgttggttcctttgccatctc 198
>ref|NM_001063139.1| Oryza sativa (japonica cultivar-group) Os06g0114500 (Os06g0114500) mRNA, complete cds Length = 637 Score = 85.7 bits (43), Expect = 2e-13 Identities = 124/151 (82%) Strand = Plus / Plus Query: 173 agaagaagatctttggtggcaccatcccagggaccgtctcggacaaggagtggtggaagg 232 |||||||||| ||||| ||||||| ||| ||||| || |||||||| |||||| | | Sbjct: 196 agaagaagatatttggaggcaccacaccacataccgtgtccgacaaggaatggtggcaag 255 Query: 233 ctacagagcagaggttccaggcctggccccgcgttgccggaccaccggtcatcatgaacc 292 | || || ||| ||| || |||||||| ||| ||| || |||||||| ||||||||| Sbjct: 256 caactgacaagaagtttcaagcctggcctcgcactgctgggccaccggttgtcatgaacc 315 Query: 293 ccatcagccgccagaacttcatcgtcaagga 323 ||||||| ||||||||||||||||||||||| Sbjct: 316 ccatcagtcgccagaacttcatcgtcaagga 346 Score = 44.1 bits (22), Expect = 0.63 Identities = 46/54 (85%) Strand = Plus / Plus Query: 93 tccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctc 146 ||||||||||| ||||||||||| || ||| || ||||| |||| || |||||| Sbjct: 116 tccaatggctggcaagtacatcgccgctggtcttgttggttcctttgccatctc 169
>dbj|AK066771.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013083K07, full insert sequence Length = 640 Score = 85.7 bits (43), Expect = 2e-13 Identities = 124/151 (82%) Strand = Plus / Plus Query: 173 agaagaagatctttggtggcaccatcccagggaccgtctcggacaaggagtggtggaagg 232 |||||||||| ||||| ||||||| ||| ||||| || |||||||| |||||| | | Sbjct: 199 agaagaagatatttggaggcaccacaccacataccgtgtccgacaaggaatggtggcaag 258 Query: 233 ctacagagcagaggttccaggcctggccccgcgttgccggaccaccggtcatcatgaacc 292 | || || ||| ||| || |||||||| ||| ||| || |||||||| ||||||||| Sbjct: 259 caactgacaagaagtttcaagcctggcctcgcactgctgggccaccggttgtcatgaacc 318 Query: 293 ccatcagccgccagaacttcatcgtcaagga 323 ||||||| ||||||||||||||||||||||| Sbjct: 319 ccatcagtcgccagaacttcatcgtcaagga 349 Score = 44.1 bits (22), Expect = 0.63 Identities = 46/54 (85%) Strand = Plus / Plus Query: 93 tccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctc 146 ||||||||||| ||||||||||| || ||| || ||||| |||| || |||||| Sbjct: 119 tccaatggctggcaagtacatcgccgctggtcttgttggttcctttgccatctc 172
>dbj|AK059353.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-D01, full insert sequence Length = 623 Score = 85.7 bits (43), Expect = 2e-13 Identities = 124/151 (82%) Strand = Plus / Plus Query: 173 agaagaagatctttggtggcaccatcccagggaccgtctcggacaaggagtggtggaagg 232 |||||||||| ||||| ||||||| ||| ||||| || |||||||| |||||| | | Sbjct: 185 agaagaagatatttggaggcaccacaccacataccgtgtccgacaaggaatggtggcaag 244 Query: 233 ctacagagcagaggttccaggcctggccccgcgttgccggaccaccggtcatcatgaacc 292 | || || ||| ||| || |||||||| ||| ||| || |||||||| ||||||||| Sbjct: 245 caactgacaagaagtttcaagcctggcctcgcactgctgggccaccggttgtcatgaacc 304 Query: 293 ccatcagccgccagaacttcatcgtcaagga 323 ||||||| ||||||||||||||||||||||| Sbjct: 305 ccatcagtcgccagaacttcatcgtcaagga 335 Score = 44.1 bits (22), Expect = 0.63 Identities = 46/54 (85%) Strand = Plus / Plus Query: 93 tccaatggctgccaagtacatcgtcggtggcctcgttggctcctgtgtcatctc 146 ||||||||||| ||||||||||| || ||| || ||||| |||| || |||||| Sbjct: 105 tccaatggctggcaagtacatcgccgctggtcttgttggttcctttgccatctc 158
>emb|CT830527.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI031F23, full insert sequence Length = 578 Score = 79.8 bits (40), Expect = 1e-11 Identities = 64/72 (88%) Strand = Plus / Plus Query: 246 gttccaggcctggccccgcgttgccggaccaccggtcatcatgaaccccatcagccgcca 305 ||||||||||||| | ||| || |||||||| |||||||||||||||||||||||||| Sbjct: 244 gttccaggcctggtctcgcaccgctggaccaccagtcatcatgaaccccatcagccgcca 303 Query: 306 gaacttcatcgt 317 ||||||||||| Sbjct: 304 aaacttcatcgt 315
>gb|DQ245828.1| Zea mays clone 20679 mRNA sequence Length = 574 Score = 60.0 bits (30), Expect = 1e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| ||||||||||||||||||||| Sbjct: 265 tcatgaaccctatcagtcgccagaacttcatcgtcaag 302
>ref|NM_001053928.1| Oryza sativa (japonica cultivar-group) Os02g0609200 (Os02g0609200) mRNA, complete cds Length = 237 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||||||| |||| ||||||||||||||||||||| Sbjct: 190 atgaaccccgtcaggcgccagaacttcatcgtcaag 225
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2 Length = 35954743 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||||||| |||| ||||||||||||||||||||| Sbjct: 23924109 atgaaccccgtcaggcgccagaacttcatcgtcaag 23924144 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 12306136 gccgccgccgaatccgccgc 12306155 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 16961017 gccgccgccgaatccgccgc 16961036 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19415969 gccgccgccgaatccgccgc 19415950 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19792162 gccgccgccgaatccgccgc 19792181
>dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0030C08 Length = 163423 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||||||| |||| ||||||||||||||||||||| Sbjct: 145775 atgaaccccgtcaggcgccagaacttcatcgtcaag 145810
>dbj|AP004881.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0496E03 Length = 138622 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||||||| |||| ||||||||||||||||||||| Sbjct: 58073 atgaaccccgtcaggcgccagaacttcatcgtcaag 58108
>ref|NM_116312.2| Arabidopsis thaliana ATOZI1 (ATOZI1) mRNA, complete cds Length = 596 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| |||||||| |||||||||||| Sbjct: 311 tcatgaaccctatcagtcgccagaatttcatcgtcaag 348
>gb|AY114604.1| Arabidopsis thaliana stress-induced protein OZI1 precursor (At4g00860) mRNA, complete cds Length = 399 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| |||||||| |||||||||||| Sbjct: 191 tcatgaaccctatcagtcgccagaatttcatcgtcaag 228
>gb|AY093001.1| Arabidopsis thaliana stress-induced protein OZI1 precursor (At4g00860) mRNA, complete cds Length = 574 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| |||||||| |||||||||||| Sbjct: 311 tcatgaaccctatcagtcgccagaatttcatcgtcaag 348
>emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 2 Length = 197975 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Minus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| |||||||| |||||||||||| Sbjct: 166288 tcatgaaccctatcagtcgccagaatttcatcgtcaag 166251
>emb|BX828910.1|CNS0A4HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL50ZC01 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 442 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| |||||||| |||||||||||| Sbjct: 241 tcatgaaccctatcagtcgccagaatttcatcgtcaag 278
>gb|AF013294.1|TM018A10 Arabidopsis thaliana BAC TM018A10 Length = 106184 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| |||||||| |||||||||||| Sbjct: 68277 tcatgaaccctatcagtcgccagaatttcatcgtcaag 68314
>gb|U20347.1|ATU20347 Arabidopsis thaliana putative pathogenesis-related protein (ATOZI1) mRNA, complete cds Length = 506 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||| |||||||| |||||||||||| Sbjct: 221 tcatgaaccctatcagtcgccagaatttcatcgtcaag 258
>dbj|AK224785.1| Solanum lycopersicum cDNA, clone: FC15CG01, HTC in fruit Length = 715 Score = 44.1 bits (22), Expect = 0.63 Identities = 34/38 (89%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||||||||| |||| ||| |||||| Sbjct: 357 tcatgaaccctatcagccgccaaaactacattgtcaag 394
>dbj|AK224738.1| Solanum lycopersicum cDNA, clone: FC11DA09, HTC in fruit Length = 454 Score = 44.1 bits (22), Expect = 0.63 Identities = 34/38 (89%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 ||||||||||||||||||| ||||| | ||| |||||| Sbjct: 238 tcatgaaccccatcagccgacagaattacattgtcaag 275
>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome Length = 5650368 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 59 ccgccgccgaatccgccgcccg 80 |||||||||||||||||||||| Sbjct: 1540746 ccgccgccgaatccgccgcccg 1540725
>gb|AC091732.4| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBb0091O09, complete sequence Length = 123427 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgccc 79 |||||||||||||||||||||| Sbjct: 17122 gccgccgccgaatccgccgccc 17101
>gb|BT014293.1| Lycopersicon esculentum clone 133539F, mRNA sequence Length = 844 Score = 44.1 bits (22), Expect = 0.63 Identities = 34/38 (89%) Strand = Plus / Plus Query: 284 tcatgaaccccatcagccgccagaacttcatcgtcaag 321 |||||||||| ||||||||||| |||| ||| |||||| Sbjct: 407 tcatgaaccctatcagccgccaaaactacattgtcaag 444
>gb|AC124213.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAa0019N10, from chromosome 10, complete sequence Length = 148704 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgccc 79 |||||||||||||||||||||| Sbjct: 105826 gccgccgccgaatccgccgccc 105805
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10 Length = 22685906 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgccc 79 |||||||||||||||||||||| Sbjct: 11960144 gccgccgccgaatccgccgccc 11960123 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3140975 gccgccgccgaatccgccgc 3140994 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3242506 gccgccgccgaatccgccgc 3242525 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3290924 gccgccgccgaatccgccgc 3290943 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3302673 gccgccgccgaatccgccgc 3302692 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6105741 gccgccgccgaatccgccgc 6105760 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6114671 gccgccgccgaatccgccgc 6114690 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6778782 gccgccgccgaatccgccgc 6778763 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6787711 gccgccgccgaatccgccgc 6787692 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7384377 gccgccgccgaatccgccgc 7384396 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7739997 gccgccgccgaatccgccgc 7739978 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7748930 gccgccgccgaatccgccgc 7748911 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7797927 gccgccgccgaatccgccgc 7797908 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7806857 gccgccgccgaatccgccgc 7806838 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7972823 gccgccgccgaatccgccgc 7972842 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7981748 gccgccgccgaatccgccgc 7981767 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8192385 gccgccgccgaatccgccgc 8192404 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8268429 gccgccgccgaatccgccgc 8268410 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8277349 gccgccgccgaatccgccgc 8277330 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9539154 gccgccgccgaatccgccgc 9539135 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9545626 gccgccgccgaatccgccgc 9545645 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9553448 gccgccgccgaatccgccgc 9553467 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 11588201 gccgccgccgaatccgccgc 11588220 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19994372 gccgccgccgaatccgccgc 19994391 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 20003226 gccgccgccgaatccgccgc 20003245
>emb|BX572597.1| Rhodopseudomonas palustris CGA009 complete genome; segment 5/16 Length = 349737 Score = 44.1 bits (22), Expect = 0.63 Identities = 22/22 (100%) Strand = Plus / Minus Query: 57 agccgccgccgaatccgccgcc 78 |||||||||||||||||||||| Sbjct: 9473 agccgccgccgaatccgccgcc 9452
>gb|CP000478.1| Syntrophobacter fumaroxidans MPOB, complete genome Length = 4990251 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgcc 78 ||||||||||||||||||||| Sbjct: 102224 gccgccgccgaatccgccgcc 102204
>ref|XM_001215269.1| Aspergillus terreus NIH2624 predicted protein (ATEG_06091) mRNA, complete cds Length = 1605 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 54 accagccgccgccgaatccgccgcc 78 ||||| ||||||||||||||||||| Sbjct: 139 accagacgccgccgaatccgccgcc 115
>gb|CP000441.1| Burkholderia cepacia AMMD chromosome 2, complete sequence Length = 2646969 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 71 ccgccgcccggccggaagaag 91 ||||||||||||||||||||| Sbjct: 1161593 ccgccgcccggccggaagaag 1161573
>gb|CP000431.1| Rhodococcus sp. RHA1, complete genome Length = 7804765 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 303 ccagaacttcatcgtcaaggacctc 327 ||||||||||||||||| ||||||| Sbjct: 7765195 ccagaacttcatcgtcatggacctc 7765171
>gb|AC087325.9| Trypanosoma brucei chromosome 4 clone RPCI93-29M18, complete sequence Length = 123258 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 152 cctgtgactacatcgtttctcagaa 176 |||||||| |||||||||||||||| Sbjct: 113406 cctgtgaccacatcgtttctcagaa 113382
>gb|AC079933.3| Trypanosoma brucei chromosome 4 clone RPCI93-1H19, complete sequence Length = 171392 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 152 cctgtgactacatcgtttctcagaa 176 |||||||| |||||||||||||||| Sbjct: 13642 cctgtgaccacatcgtttctcagaa 13618
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgcc 78 ||||||||||||||||||||| Sbjct: 6869136 gccgccgccgaatccgccgcc 6869116
>dbj|AK158033.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930018H02 product:kangai 1 (suppression of tumorigenicity 6, prostate), full insert sequence Length = 3360 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 495 ttcttctgaagaacagaagag 515 ||||||||||||||||||||| Sbjct: 856 ttcttctgaagaacagaagag 836
>gb|AC016044.11| Homo sapiens chromosome 15 clone RP11-209K10 map 15q21.3, complete sequence Length = 168125 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 494 tttcttctgaagaacagaaga 514 ||||||||||||||||||||| Sbjct: 157607 tttcttctgaagaacagaaga 157627
>ref|XM_757059.1| Ustilago maydis 521 hypothetical protein (UM06005.1) partial mRNA Length = 9528 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 54 accagccgccgccgaatccgccgcc 78 |||||||||||||| |||||||||| Sbjct: 9211 accagccgccgccgtatccgccgcc 9187
>gb|AC079845.31| Mus musculus clone rp23-461a12, complete sequence Length = 206117 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 541 ttggcctttttgtcatctttc 561 ||||||||||||||||||||| Sbjct: 54948 ttggcctttttgtcatctttc 54928
>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome Length = 3309401 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgcccggc 82 ||||||| ||||||||||||||||| Sbjct: 2912704 gccgccggcgaatccgccgcccggc 2912680
>emb|BX927156.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete genome; segment 9/10 Length = 349115 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgcccggc 82 ||||||| ||||||||||||||||| Sbjct: 92425 gccgccggcgaatccgccgcccggc 92401
>emb|AL732483.8| Mouse DNA sequence from clone RP23-70K10 on chromosome 2, complete sequence Length = 201542 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 495 ttcttctgaagaacagaagag 515 ||||||||||||||||||||| Sbjct: 27851 ttcttctgaagaacagaagag 27871
>gb|AC079832.18| Mus musculus strain C57BL/6J chromosome 3 clone rp23-393j8, complete sequence Length = 194354 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 541 ttggcctttttgtcatctttc 561 ||||||||||||||||||||| Sbjct: 54941 ttggcctttttgtcatctttc 54921
>emb|CT797479.12| Pig DNA sequence from clone CH242-196N13 on chromosome 7, complete sequence Length = 212601 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 tggtggcaccatcccaggga 205 |||||||||||||||||||| Sbjct: 107169 tggtggcaccatcccaggga 107150
>emb|CR855239.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSIGBa0139N19-OSIGBa0137L10, complete sequence Length = 124465 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 101717 gccgccgccgaatccgccgc 101698
>emb|CR855040.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSIGBa0093M15, complete sequence Length = 77107 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 36506 gccgccgccgaatccgccgc 36487 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 37215 gccgccgccgaatccgccgc 37234
>ref|XM_001211173.1| Aspergillus terreus NIH2624 hypothetical protein (ATEG_01995) mRNA, complete cds Length = 1476 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 ccgccgccgaatccgccgcc 78 |||||||||||||||||||| Sbjct: 604 ccgccgccgaatccgccgcc 585
>gb|CP000440.1| Burkholderia cepacia AMMD chromosome 1, complete sequence Length = 3556545 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3292128 gccgccgccgaatccgccgc 3292147
>emb|AM236080.1| Rhizobium leguminosarum bv. viciae chromosome complete genome, strain 3841 Length = 5057142 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 gccgcccggccggaagaagc 92 |||||||||||||||||||| Sbjct: 388834 gccgcccggccggaagaagc 388815
>gb|DQ011607.1| Oryza sativa (indica cultivar-group) cultivar Teqing clone TQR14A11, complete sequence Length = 100871 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 512 gccgccgccgaatccgccgc 531
>emb|CT573213.2| Frankia alni str. ACN14A chromosome, complete sequence Length = 7497934 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 214 gacaaggagtggtggaaggc 233 |||||||||||||||||||| Sbjct: 5773866 gacaaggagtggtggaaggc 5773885
>gb|AC189030.1| Taeniopygia guttata chromosome UNK clone TGMCBa-15H12, complete sequence Length = 149563 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 ctttggtggcaccatcccag 202 |||||||||||||||||||| Sbjct: 26134 ctttggtggcaccatcccag 26115
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 ccgccgccgaatccgccgcc 78 |||||||||||||||||||| Sbjct: 730592 ccgccgccgaatccgccgcc 730611
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence Length = 2580084 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 gccgccgaatccgccgcccg 80 |||||||||||||||||||| Sbjct: 2312171 gccgccgaatccgccgcccg 2312190
>emb|AL442108.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0124E07, complete sequence Length = 127181 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 104268 gccgccgccgaatccgccgc 104287
>ref|NM_099999.3| Arabidopsis thaliana unknown protein (AT1G01170) mRNA, complete cds Length = 609 Score = 40.1 bits (20), Expect = 9.8 Identities = 32/36 (88%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||| ||||| ||||| ||||| |||||||||||| Sbjct: 278 atgaatcccattagccgtcagaatttcatcgtcaag 313
>ref|NM_001035849.1| Arabidopsis thaliana unknown protein (AT1G01170) mRNA, complete cds Length = 610 Score = 40.1 bits (20), Expect = 9.8 Identities = 32/36 (88%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||| ||||| ||||| ||||| |||||||||||| Sbjct: 279 atgaatcccattagccgtcagaatttcatcgtcaag 314
>gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, complete sequence Length = 206094 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 tgatggcgatttctgttgct 399 |||||||||||||||||||| Sbjct: 113866 tgatggcgatttctgttgct 113885
>gb|AC137923.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0066C04, complete sequence Length = 133944 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 17279 gccgccgccgaatccgccgc 17298
>gb|AC120535.5| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0092N01, complete sequence Length = 161741 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 49998 gccgccgccgaatccgccgc 49979
>gb|AC119670.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0007H22, complete sequence Length = 160938 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 148877 gccgccgccgaatccgccgc 148896 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 157809 gccgccgccgaatccgccgc 157828 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 157837 gccgccgccgaatccgccgc 157856
>gb|AC112208.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0015P05 map C53961S, complete sequence Length = 175121 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 16635 gccgccgccgaatccgccgc 16654
>gb|AC137748.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0076A09, complete sequence Length = 157010 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 130080 gccgccgccgaatccgccgc 130061 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 139000 gccgccgccgaatccgccgc 138981
>gb|AC137747.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0051L16, complete sequence Length = 175461 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 33899 gccgccgccgaatccgccgc 33880 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 42819 gccgccgccgaatccgccgc 42800 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 126729 gccgccgccgaatccgccgc 126748 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 174862 gccgccgccgaatccgccgc 174843
>gb|AC119290.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0037H06, complete sequence Length = 144457 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 38625 gccgccgccgaatccgccgc 38606
>gb|AC131966.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0028C16, complete sequence Length = 151030 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3850 gccgccgccgaatccgccgc 3869 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 105381 gccgccgccgaatccgccgc 105400
>gb|AC137613.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0034K10, complete sequence Length = 138925 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 54855 gccgccgccgaatccgccgc 54874 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 63785 gccgccgccgaatccgccgc 63804
>gb|AC146338.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0093C16, complete sequence Length = 206612 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 173959 gccgccgccgaatccgccgc 173978 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 195812 gccgccgccgaatccgccgc 195831
>gb|AC137609.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0010H19, complete sequence Length = 162902 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 20343 gccgccgccgaatccgccgc 20324
>gb|AC145272.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0002L02, complete sequence Length = 165685 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 66098 gccgccgccgaatccgccgc 66117 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 87951 gccgccgccgaatccgccgc 87970
>gb|AY762971.1| Pangasianodon gigas mitochondrion, complete genome Length = 16533 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 213 ggacaaggagtggtggaagg 232 |||||||||||||||||||| Sbjct: 13672 ggacaaggagtggtggaagg 13653
>gb|AC111016.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1651_D06, complete sequence Length = 145323 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19853 gccgccgccgaatccgccgc 19834
>gb|AC135431.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0683B12, complete sequence Length = 187523 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 174604 gccgccgccgaatccgccgc 174585
>gb|AC136228.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0672D07, complete sequence Length = 136465 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 29086 gccgccgccgaatccgccgc 29105 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 36982 gccgccgccgaatccgccgc 37001 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 120754 gccgccgccgaatccgccgc 120773
>gb|AC137612.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0022B03, complete sequence Length = 151814 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 95368 gccgccgccgaatccgccgc 95387
>gb|AC151106.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNOa0281D22, complete sequence Length = 35282 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 23058 gccgccgccgaatccgccgc 23077
>gb|AC105743.8| Oryza sativa chromosome 3 BAC OSJNBa0035N15 genomic sequence, complete sequence Length = 171120 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 117103 gccgccgccgaatccgccgc 117122 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 126006 gccgccgccgaatccgccgc 126025
>gb|AC135598.4| Oryza sativa chromosome 3 BAC OSJNBb0021K20 genomic sequence, complete sequence Length = 137220 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 25578 gccgccgccgaatccgccgc 25597
>gb|AC137003.3| Oryza sativa (japonica cultivar-group) Chromosome 5 BAC clone OSJNBb0069G11, complete sequence Length = 174844 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 111847 gccgccgccgaatccgccgc 111866 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 120773 gccgccgccgaatccgccgc 120792
>gb|AC136998.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0082P17, complete sequence Length = 157539 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 47876 gccgccgccgaatccgccgc 47857
>gb|AC137615.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0053F13, from chromosome 5, complete sequence Length = 149538 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9946 gccgccgccgaatccgccgc 9965 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 83646 gccgccgccgaatccgccgc 83627 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 95792 gccgccgccgaatccgccgc 95773 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 102888 gccgccgccgaatccgccgc 102869
>gb|AC137610.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OSJNBa0018H09, complete sequence Length = 155329 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 149326 gccgccgccgaatccgccgc 149307
>gb|AC137624.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0680F01, complete sequence Length = 156691 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 114606 gccgccgccgaatccgccgc 114587
>gb|AC136220.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0075J06, complete sequence Length = 127053 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 92242 gccgccgccgaatccgccgc 92261 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 101145 gccgccgccgaatccgccgc 101164
>gb|AC099741.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-92M3, complete sequence Length = 249636 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 495 ttcttctgaagaacagaaga 514 |||||||||||||||||||| Sbjct: 224690 ttcttctgaagaacagaaga 224671
>gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OSJNBa0082F22, complete sequence Length = 176038 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 42997 gccgccgccgaatccgccgc 42978 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 50477 gccgccgccgaatccgccgc 50458
>gb|AC134932.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0092G21, complete sequence Length = 151267 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 64903 gccgccgccgaatccgccgc 64922
>gb|AC137607.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0006O14, complete sequence Length = 142764 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 59696 gccgccgccgaatccgccgc 59677 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 120875 gccgccgccgaatccgccgc 120856
>gb|AC135864.5| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0071K13, complete sequence Length = 176150 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 112177 gccgccgccgaatccgccgc 112158
>gb|AC134923.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBb0030I07, complete sequence Length = 122733 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 99857 gccgccgccgaatccgccgc 99838
>gb|AC120886.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0068E24, complete sequence Length = 141492 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 70180 gccgccgccgaatccgccgc 70161 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 74694 gccgccgccgaatccgccgc 74675
>gb|AC137073.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0005A11, from chromosome 3, complete sequence Length = 168219 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 25629 gccgccgccgaatccgccgc 25610 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 34541 gccgccgccgaatccgccgc 34522 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 41344 gccgccgccgaatccgccgc 41363 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 46938 gccgccgccgaatccgccgc 46957 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 79987 gccgccgccgaatccgccgc 80006 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 94102 gccgccgccgaatccgccgc 94083
>gb|AC124494.4| Mus musculus BAC clone RP23-464P12 from chromosome 13, complete sequence Length = 204177 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 ggaaggctacagagcagagg 246 |||||||||||||||||||| Sbjct: 135082 ggaaggctacagagcagagg 135101
>gb|AC112157.4| Mus musculus BAC clone RP24-103F14 from chromosome 13, complete sequence Length = 155757 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 ggaaggctacagagcagagg 246 |||||||||||||||||||| Sbjct: 119633 ggaaggctacagagcagagg 119614
>gb|AC146893.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone B1107B01, complete sequence Length = 160104 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 142013 gccgccgccgaatccgccgc 141994 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 150942 gccgccgccgaatccgccgc 150923
>gb|AC146310.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone B1082A06, complete sequence Length = 135774 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 42136 gccgccgccgaatccgccgc 42155
>gb|AC157380.6| Mus musculus chromosome 3, clone RP23-404C21, complete sequence Length = 196528 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 573 catttgtttacttttgattc 592 |||||||||||||||||||| Sbjct: 155148 catttgtttacttttgattc 155129
>gb|AC117212.5| Mus musculus BAC clone RP23-302A24 from chromosome 6, complete sequence Length = 212735 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 495 ttcttctgaagaacagaaga 514 |||||||||||||||||||| Sbjct: 109357 ttcttctgaagaacagaaga 109376
>gb|AC126224.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0078O24, complete sequence Length = 135980 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 44814 gccgccgccgaatccgccgc 44795 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 52739 gccgccgccgaatccgccgc 52720 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 86254 gccgccgccgaatccgccgc 86235
>gb|AC130731.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0692E03, complete sequence Length = 74462 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 20319 gccgccgccgaatccgccgc 20300
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 Length = 2661830 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 aagaagctccaatggctgcc 105 |||||||||||||||||||| Sbjct: 750112 aagaagctccaatggctgcc 750131
>gb|AC091680.7| Oryza sativa chromosome 10 BAC OSJNBa0034L04 genomic sequence, complete sequence Length = 148611 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 104964 gccgccgccgaatccgccgc 104945 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 113818 gccgccgccgaatccgccgc 113799
>gb|AC104322.4| Oryza sativa chromosome 10 BAC OSJNBb0005F01 genomic sequence, complete sequence Length = 151428 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 40746 gccgccgccgaatccgccgc 40765 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 49676 gccgccgccgaatccgccgc 49695
>gb|BT024529.1| Arabidopsis thaliana At1g01170 mRNA, complete cds Length = 252 Score = 40.1 bits (20), Expect = 9.8 Identities = 32/36 (88%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||| ||||| ||||| ||||| |||||||||||| Sbjct: 202 atgaatcccattagccgtcagaatttcatcgtcaag 237
>gb|AC131968.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0053D03, complete sequence Length = 150496 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 71951 gccgccgccgaatccgccgc 71932 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 80871 gccgccgccgaatccgccgc 80852
>gb|AC119148.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0035F15, complete sequence Length = 138335 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 27227 gccgccgccgaatccgccgc 27208 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 33699 gccgccgccgaatccgccgc 33718 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 41521 gccgccgccgaatccgccgc 41540
>gb|AC119149.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBb0079E01, complete sequence Length = 132870 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 110955 gccgccgccgaatccgccgc 110936 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 119880 gccgccgccgaatccgccgc 119861
>emb|CR788319.8| Zebrafish DNA sequence from clone DKEY-245H10 in linkage group 12, complete sequence Length = 188205 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 603 catcatcatcatcggaatgtgtgc 626 |||||||||||||| ||||||||| Sbjct: 170893 catcatcatcatcgcaatgtgtgc 170916
>tpg|BK000373.1| TPA_exp: Oryza sativa transposon Rim2-M91, complete sequence Length = 31793 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 27921 gccgccgccgaatccgccgc 27940
>gb|AC119071.1| Oryza sativa ssp. japonica cv. Nipponbare OSJNBa0044D15 BAC genomic sequence, complete sequence Length = 144544 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 59870 gccgccgccgaatccgccgc 59851 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 59898 gccgccgccgaatccgccgc 59879 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 68830 gccgccgccgaatccgccgc 68811
>dbj|AK085999.1| Mus musculus 16 days neonate heart cDNA, RIKEN full-length enriched library, clone:D830040I01 product:unclassifiable, full insert sequence Length = 1800 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 ggtggcaccatcccagggac 206 |||||||||||||||||||| Sbjct: 1441 ggtggcaccatcccagggac 1460
>gb|AC097446.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0034B05, complete sequence Length = 175061 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 14351 gccgccgccgaatccgccgc 14370 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 62769 gccgccgccgaatccgccgc 62788 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 74518 gccgccgccgaatccgccgc 74537
>gb|AC091735.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0082N11, from chromosome 10, complete sequence Length = 183345 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18241 gccgccgccgaatccgccgc 18260
>gb|AC021892.16| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0053D03, from chromosome 10, complete sequence Length = 199113 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 64094 gccgccgccgaatccgccgc 64075
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12 Length = 27566993 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4351507 gccgccgccgaatccgccgc 4351488 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 5940654 gccgccgccgaatccgccgc 5940673 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8208594 gccgccgccgaatccgccgc 8208613 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8220876 gccgccgccgaatccgccgc 8220895 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8981389 gccgccgccgaatccgccgc 8981408 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9040650 gccgccgccgaatccgccgc 9040631 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13297915 gccgccgccgaatccgccgc 13297896 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13306794 gccgccgccgaatccgccgc 13306775 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 14418154 gccgccgccgaatccgccgc 14418173 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15975163 gccgccgccgaatccgccgc 15975182 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15984081 gccgccgccgaatccgccgc 15984100 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15988749 gccgccgccgaatccgccgc 15988768 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 16265782 gccgccgccgaatccgccgc 16265801 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 16274605 gccgccgccgaatccgccgc 16274624 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18171703 gccgccgccgaatccgccgc 18171722 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18180601 gccgccgccgaatccgccgc 18180620 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 23398530 gccgccgccgaatccgccgc 23398511
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8 Length = 28434780 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6478269 gccgccgccgaatccgccgc 6478250 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6506566 gccgccgccgaatccgccgc 6506585 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6681181 gccgccgccgaatccgccgc 6681162 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6704103 gccgccgccgaatccgccgc 6704084 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6938161 gccgccgccgaatccgccgc 6938180 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6968171 gccgccgccgaatccgccgc 6968152 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6969585 gccgccgccgaatccgccgc 6969604 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6978301 gccgccgccgaatccgccgc 6978282 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6984291 gccgccgccgaatccgccgc 6984310 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6999285 gccgccgccgaatccgccgc 6999266 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7003948 gccgccgccgaatccgccgc 7003929 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7225591 gccgccgccgaatccgccgc 7225572 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8723905 gccgccgccgaatccgccgc 8723924 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8732829 gccgccgccgaatccgccgc 8732848 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8740276 gccgccgccgaatccgccgc 8740257 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 16992159 gccgccgccgaatccgccgc 16992178 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 16996127 gccgccgccgaatccgccgc 16996146 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 17015874 gccgccgccgaatccgccgc 17015893 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 17272264 gccgccgccgaatccgccgc 17272245 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 17278539 gccgccgccgaatccgccgc 17278520 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 17284816 gccgccgccgaatccgccgc 17284797 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 25175292 gccgccgccgaatccgccgc 25175311 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 25185312 gccgccgccgaatccgccgc 25185293
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9 Length = 22696651 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 23453 gccgccgccgaatccgccgc 23472 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 175841 gccgccgccgaatccgccgc 175822 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 184753 gccgccgccgaatccgccgc 184734 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 1576364 gccgccgccgaatccgccgc 1576345 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4598978 gccgccgccgaatccgccgc 4598997 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4866621 gccgccgccgaatccgccgc 4866640 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 5235681 gccgccgccgaatccgccgc 5235662 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 5244342 gccgccgccgaatccgccgc 5244323 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 5665519 gccgccgccgaatccgccgc 5665500 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 5674439 gccgccgccgaatccgccgc 5674420 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7534959 gccgccgccgaatccgccgc 7534940 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7546785 gccgccgccgaatccgccgc 7546766 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8036610 gccgccgccgaatccgccgc 8036591 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10588219 gccgccgccgaatccgccgc 10588200 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10595048 gccgccgccgaatccgccgc 10595029 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10603859 gccgccgccgaatccgccgc 10603840 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13049255 gccgccgccgaatccgccgc 13049274 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13057741 gccgccgccgaatccgccgc 13057760 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 14251394 gccgccgccgaatccgccgc 14251375
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7 Length = 29644043 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9165217 gccgccgccgaatccgccgc 9165236 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9843771 gccgccgccgaatccgccgc 9843752 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9850619 gccgccgccgaatccgccgc 9850600 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9932528 gccgccgccgaatccgccgc 9932547 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9975708 gccgccgccgaatccgccgc 9975689 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9984584 gccgccgccgaatccgccgc 9984565 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10560367 gccgccgccgaatccgccgc 10560348 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10569288 gccgccgccgaatccgccgc 10569269 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10698286 gccgccgccgaatccgccgc 10698305 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 12050018 gccgccgccgaatccgccgc 12050037 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 12056546 gccgccgccgaatccgccgc 12056565 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13983754 gccgccgccgaatccgccgc 13983735 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15042802 gccgccgccgaatccgccgc 15042821 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 21137613 gccgccgccgaatccgccgc 21137632 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 21144968 gccgccgccgaatccgccgc 21144987 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 22979393 gccgccgccgaatccgccgc 22979374 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 22988322 gccgccgccgaatccgccgc 22988303 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 27160834 gccgccgccgaatccgccgc 27160853 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 27200756 gccgccgccgaatccgccgc 27200737 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 28547993 gccgccgccgaatccgccgc 28548012 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 28556018 gccgccgccgaatccgccgc 28556037
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5 Length = 29737217 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4274479 gccgccgccgaatccgccgc 4274498 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4282375 gccgccgccgaatccgccgc 4282394 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4366147 gccgccgccgaatccgccgc 4366166 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 5080019 gccgccgccgaatccgccgc 5080000 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 8706183 gccgccgccgaatccgccgc 8706164 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9456512 gccgccgccgaatccgccgc 9456531 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9465415 gccgccgccgaatccgccgc 9465434 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9943332 gccgccgccgaatccgccgc 9943351 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9965185 gccgccgccgaatccgccgc 9965204 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10109852 gccgccgccgaatccgccgc 10109871 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10183552 gccgccgccgaatccgccgc 10183533 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10195698 gccgccgccgaatccgccgc 10195679 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10202794 gccgccgccgaatccgccgc 10202775 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10276131 gccgccgccgaatccgccgc 10276112 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10337310 gccgccgccgaatccgccgc 10337291 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10495031 gccgccgccgaatccgccgc 10495050 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10503957 gccgccgccgaatccgccgc 10503976 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10583233 gccgccgccgaatccgccgc 10583252 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10592163 gccgccgccgaatccgccgc 10592182 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 11247072 gccgccgccgaatccgccgc 11247053 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13080220 gccgccgccgaatccgccgc 13080201 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13087700 gccgccgccgaatccgccgc 13087681 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15101330 gccgccgccgaatccgccgc 15101311 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15110250 gccgccgccgaatccgccgc 15110231 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15194160 gccgccgccgaatccgccgc 15194179 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15242293 gccgccgccgaatccgccgc 15242274 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15248875 gccgccgccgaatccgccgc 15248856 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15279742 gccgccgccgaatccgccgc 15279761 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15285180 gccgccgccgaatccgccgc 15285199 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19143005 gccgccgccgaatccgccgc 19143024 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 22176588 gccgccgccgaatccgccgc 22176569
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4 Length = 35498469 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 1446186 gccgccgccgaatccgccgc 1446205 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3913008 gccgccgccgaatccgccgc 3912989 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3948276 gccgccgccgaatccgccgc 3948295 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3954804 gccgccgccgaatccgccgc 3954823 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4167971 gccgccgccgaatccgccgc 4167990 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6727930 gccgccgccgaatccgccgc 6727949 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6735414 gccgccgccgaatccgccgc 6735433 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7669787 gccgccgccgaatccgccgc 7669768 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7678439 gccgccgccgaatccgccgc 7678420 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7689807 gccgccgccgaatccgccgc 7689788 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7708921 gccgccgccgaatccgccgc 7708940 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7729903 gccgccgccgaatccgccgc 7729884 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7738831 gccgccgccgaatccgccgc 7738812 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7740433 gccgccgccgaatccgccgc 7740414 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7796032 gccgccgccgaatccgccgc 7796051 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7803558 gccgccgccgaatccgccgc 7803577 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 16332228 gccgccgccgaatccgccgc 16332209
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3 Length = 36192742 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13344718 gccgccgccgaatccgccgc 13344699 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13352643 gccgccgccgaatccgccgc 13352624 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13386158 gccgccgccgaatccgccgc 13386139 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13461613 gccgccgccgaatccgccgc 13461594 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13470525 gccgccgccgaatccgccgc 13470506 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13477328 gccgccgccgaatccgccgc 13477347 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13482922 gccgccgccgaatccgccgc 13482941 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13515971 gccgccgccgaatccgccgc 13515990 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13530086 gccgccgccgaatccgccgc 13530067 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 17296742 gccgccgccgaatccgccgc 17296761 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18645920 gccgccgccgaatccgccgc 18645901 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18654823 gccgccgccgaatccgccgc 18654804 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 25245331 gccgccgccgaatccgccgc 25245312 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 25574694 gccgccgccgaatccgccgc 25574675
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 813608 gccgccgccgaatccgccgc 813589 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 57 agccgccgccgaatccgccgcccg 80 ||||||| |||||||||||||||| Sbjct: 8855651 agccgccaccgaatccgccgcccg 8855674 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 12009662 gccgccgccgaatccgccgc 12009681 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 14646070 gccgccgccgaatccgccgc 14646051 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 14655003 gccgccgccgaatccgccgc 14654984 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19578412 gccgccgccgaatccgccgc 19578393 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19584630 gccgccgccgaatccgccgc 19584611 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19732114 gccgccgccgaatccgccgc 19732095 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19746925 gccgccgccgaatccgccgc 19746906 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19934873 gccgccgccgaatccgccgc 19934854 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 19943807 gccgccgccgaatccgccgc 19943788 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 20671701 gccgccgccgaatccgccgc 20671682 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 20680640 gccgccgccgaatccgccgc 20680621 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 21366286 gccgccgccgaatccgccgc 21366305 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 42481822 gccgccgccgaatccgccgc 42481841
>gb|AC098565.3| Oryza sativa chromosome 10 clone OSJNBa0028C16, complete sequence Length = 166757 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 110607 gccgccgccgaatccgccgc 110626
>emb|BX511137.14| Zebrafish DNA sequence from clone DKEY-192A11 in linkage group 7, complete sequence Length = 214145 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 8 cacaatctttctcccctctcgctctctc 35 ||||||||| |||| ||||||||||||| Sbjct: 29347 cacaatcttcctcctctctcgctctctc 29320
>emb|AL590244.5| Human DNA sequence from clone RP11-28H17 on chromosome 6 Contains the 3' end of a novel gene, part of a novel gene, a novel gene, cytochrome P450 pseudogene and the 3' end of the RHAG gene for Rhesus blood group-associated glycoprotein (RH50A), complete sequence Length = 133579 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 521 aacctgaagcatattttgccttgg 544 ||||| |||||||||||||||||| Sbjct: 54558 aacctaaagcatattttgccttgg 54535
>emb|AL450384.34| Human DNA sequence from clone RP11-383B4 on chromosome 10 Contains the 3' end of the CACNB2 gene for calcium channel voltage-dependent beta 2 subunit, the 5' end of a novel gene, a novel gene and the 3' end of a novel gene (LOC221078) (FLJ23743), complete sequence Length = 124571 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 493 atttcttctgaagaacagaa 512 |||||||||||||||||||| Sbjct: 27889 atttcttctgaagaacagaa 27870
>emb|AL365499.19| Human DNA sequence from clone RP11-227E22 on chromosome 6, complete sequence Length = 84972 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 489 ttttatttcttctgaagaacagaa 512 |||||||| ||||||||||||||| Sbjct: 57671 ttttatttgttctgaagaacagaa 57648
>dbj|AB208917.1| Homo sapiens mRNA for calcium channel, voltage-dependent, beta 2 subunit isoform 1 variant protein Length = 4468 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 493 atttcttctgaagaacagaa 512 |||||||||||||||||||| Sbjct: 3860 atttcttctgaagaacagaa 3841
>emb|AL159154.16| Human DNA sequence from clone RP11-428G23 on chromosome 13 Contains part of a novel gene (KIAA0916), complete sequence Length = 124964 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 tggaaggctacagagcagag 245 |||||||||||||||||||| Sbjct: 117401 tggaaggctacagagcagag 117420
>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0013K10 Length = 129118 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 75741 gccgccgccgaatccgccgc 75760
>dbj|AP004362.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0014E04 Length = 146710 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 46864 gccgccgccgaatccgccgc 46845 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 53082 gccgccgccgaatccgccgc 53063
>dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0062A24 Length = 148362 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 37782 gccgccgccgaatccgccgc 37763 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 46716 gccgccgccgaatccgccgc 46697
>dbj|AP003933.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0066C06 Length = 162304 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 14659 gccgccgccgaatccgccgc 14640 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 23598 gccgccgccgaatccgccgc 23579
>dbj|AP004365.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0458E05 Length = 193577 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 2705 gccgccgccgaatccgccgc 2724
>dbj|AP004360.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1166B08 Length = 147667 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 80736 gccgccgccgaatccgccgc 80717 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 95547 gccgccgccgaatccgccgc 95528
>dbj|AP004258.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0024F24 Length = 172642 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 133677 gccgccgccgaatccgccgc 133658 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 142616 gccgccgccgaatccgccgc 142597
>dbj|AP003267.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0496H05 Length = 147817 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 88224 gccgccgccgaatccgccgc 88243
>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483G10 Length = 190721 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 141160 gccgccgccgaatccgccgc 141179
>gb|AC022352.5|AC022352 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0034E23, from chromosome 10, complete sequence Length = 139398 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 45876 gccgccgccgaatccgccgc 45857 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 54809 gccgccgccgaatccgccgc 54790 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 103806 gccgccgccgaatccgccgc 103787 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 112736 gccgccgccgaatccgccgc 112717
>emb|BX842606.1|OSJN00297 Oryza sativa genomic DNA, chromosome 4, BAC clone: B1292H11, complete sequence Length = 152632 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 105210 gccgccgccgaatccgccgc 105229
>emb|AL731594.5|OSJN00234 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032N05, complete sequence Length = 159486 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 153976 gccgccgccgaatccgccgc 153995
>emb|AL731643.4|OSJN00284 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0085C10, complete sequence Length = 202924 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 55066 gccgccgccgaatccgccgc 55047 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 63718 gccgccgccgaatccgccgc 63699 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 75086 gccgccgccgaatccgccgc 75067 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 96421 gccgccgccgaatccgccgc 96440 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 117403 gccgccgccgaatccgccgc 117384 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 126331 gccgccgccgaatccgccgc 126312 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 127847 gccgccgccgaatccgccgc 127828 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 184368 gccgccgccgaatccgccgc 184387 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 191894 gccgccgccgaatccgccgc 191913
>emb|AL662980.3|OSJN00185 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0080E14, complete sequence Length = 148064 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 139989 gccgccgccgaatccgccgc 139970
>emb|AL731581.2|OSJN00228 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0022F16, complete sequence Length = 154397 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 22323 gccgccgccgaatccgccgc 22304 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 57591 gccgccgccgaatccgccgc 57610 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 64119 gccgccgccgaatccgccgc 64138
>emb|AL606667.5|OSJN00082 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0061C06, complete sequence Length = 160129 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 148886 gccgccgccgaatccgccgc 148905 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 156370 gccgccgccgaatccgccgc 156389
>emb|AL662948.4|OSJN00150 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0060B20, complete sequence Length = 147254 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 1729 gccgccgccgaatccgccgc 1748 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 9255 gccgccgccgaatccgccgc 9274
>emb|AL606449.4|OSJN00004 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0014F04, complete sequence Length = 173903 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 4031 gccgccgccgaatccgccgc 4050 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 11516 gccgccgccgaatccgccgc 11535
>dbj|AP001366.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0469E09 Length = 146081 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 57 agccgccgccgaatccgccgcccg 80 ||||||| |||||||||||||||| Sbjct: 91679 agccgccaccgaatccgccgcccg 91702
>emb|AL669835.9| Mouse DNA sequence from clone RP23-151P20 on chromosome 11, complete sequence Length = 81513 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 187 ggtggcaccatcccagggac 206 |||||||||||||||||||| Sbjct: 76368 ggtggcaccatcccagggac 76349
>gb|AC012500.7| Homo sapiens BAC clone RP11-434M17 from 2, complete sequence Length = 117763 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 548 ttttgtcatctttcctttgc 567 |||||||||||||||||||| Sbjct: 37591 ttttgtcatctttcctttgc 37572
>gb|AY027898.1|AY027893S6 Homo sapiens voltage-dependent calcium channel beta 2 subunit (CACNB2) gene, exons 6 through 13 and complete cds Length = 29000 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 493 atttcttctgaagaacagaa 512 |||||||||||||||||||| Sbjct: 27887 atttcttctgaagaacagaa 27868
>gb|AC160949.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBb0006E22, complete sequence Length = 128256 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 66687 gccgccgccgaatccgccgc 66668 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 73709 gccgccgccgaatccgccgc 73690
>gb|AC009499.4| Homo sapiens BAC clone RP11-510D10 from 2, complete sequence Length = 176570 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 568 ataaccatttgtttacttttgatt 591 ||||||||||||||| |||||||| Sbjct: 47720 ataaccatttgtttatttttgatt 47697
>dbj|AP005810.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0696F12 Length = 165227 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 58974 gccgccgccgaatccgccgc 58993 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 66329 gccgccgccgaatccgccgc 66348
>dbj|AP005189.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0474B11 Length = 141702 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 3031 gccgccgccgaatccgccgc 3012 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 11952 gccgccgccgaatccgccgc 11933 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 140950 gccgccgccgaatccgccgc 140969
>dbj|AP004790.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0476H10 Length = 151703 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 33496 gccgccgccgaatccgccgc 33477
>dbj|AP004690.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0437G01 Length = 147101 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 1654 gccgccgccgaatccgccgc 1673 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 10578 gccgccgccgaatccgccgc 10597 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 18025 gccgccgccgaatccgccgc 18006
>dbj|AP006058.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0066B16 Length = 190143 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 71339 gccgccgccgaatccgccgc 71320 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 80251 gccgccgccgaatccgccgc 80232
>dbj|AP005881.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0057I13 Length = 156330 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 40531 gccgccgccgaatccgccgc 40512 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 47360 gccgccgccgaatccgccgc 47341 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 56171 gccgccgccgaatccgccgc 56152
>dbj|AP003617.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0502H06 Length = 165630 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 73084 gccgccgccgaatccgccgc 73103
>dbj|AP005930.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0502B12 Length = 197160 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 40424 gccgccgccgaatccgccgc 40405 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 67991 gccgccgccgaatccgccgc 68010 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 75589 gccgccgccgaatccgccgc 75608 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 91724 gccgccgccgaatccgccgc 91705
>dbj|AP006524.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0077M23 Length = 167264 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 69463 gccgccgccgaatccgccgc 69444 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 81559 gccgccgccgaatccgccgc 81540
>dbj|AP006063.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0022O06 Length = 180769 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 41201 gccgccgccgaatccgccgc 41220 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 161622 gccgccgccgaatccgccgc 161603 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 170551 gccgccgccgaatccgccgc 170532
>dbj|AP005929.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0071G09 Length = 169148 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 140119 gccgccgccgaatccgccgc 140100 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 152215 gccgccgccgaatccgccgc 152196
>dbj|AP005773.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0085C03 Length = 188905 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 156045 gccgccgccgaatccgccgc 156064
>dbj|AP005932.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0597A07 Length = 149682 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 6401 gccgccgccgaatccgccgc 6382 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15330 gccgccgccgaatccgccgc 15311 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 43944 gccgccgccgaatccgccgc 43963 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 52641 gccgccgccgaatccgccgc 52622
>dbj|AP005468.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0020P04 Length = 153894 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 25265 gccgccgccgaatccgccgc 25284
>dbj|AP003444.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1164G11 Length = 142699 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 127447 gccgccgccgaatccgccgc 127428 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 136380 gccgccgccgaatccgccgc 136361
>dbj|AP005458.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0567G03 Length = 196834 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 127435 gccgccgccgaatccgccgc 127454 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 134915 gccgccgccgaatccgccgc 134934
>dbj|AP005445.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0028E05 Length = 157631 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 14553 gccgccgccgaatccgccgc 14572
>dbj|AP005382.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ1001_B06 Length = 134810 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 89179 gccgccgccgaatccgccgc 89198
>dbj|AP004740.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0092H22 Length = 165194 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 97993 gccgccgccgaatccgccgc 98012
>dbj|AP003522.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0036B02 Length = 168253 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 cagccgccgccgaatccgcc 75 |||||||||||||||||||| Sbjct: 139025 cagccgccgccgaatccgcc 139044 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 cagccgccgccgaatccgcc 75 |||||||||||||||||||| Sbjct: 147544 cagccgccgccgaatccgcc 147563
>dbj|AP003257.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0460H02 Length = 155012 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15170 gccgccgccgaatccgccgc 15151 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 24103 gccgccgccgaatccgccgc 24084
>dbj|AP005413.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0055N24 Length = 142702 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 cagccgccgccgaatccgcc 75 |||||||||||||||||||| Sbjct: 12328 cagccgccgccgaatccgcc 12347 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 cagccgccgccgaatccgcc 75 |||||||||||||||||||| Sbjct: 20847 cagccgccgccgaatccgcc 20866 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 56972 gccgccgccgaatccgccgc 56953 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 63924 gccgccgccgaatccgccgc 63905
>dbj|AP003771.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0622F03 Length = 170064 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 107344 gccgccgccgaatccgccgc 107363
>dbj|AP002867.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0463F06 Length = 144322 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 36282 gccgccgccgaatccgccgc 36263
>dbj|AP003075.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0468H06 Length = 155031 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 7672 gccgccgccgaatccgccgc 7691
>dbj|AP006155.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1012G04 Length = 144644 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 70621 gccgccgccgaatccgccgc 70602 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 79282 gccgccgccgaatccgccgc 79263
>dbj|AP006059.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0023E08 Length = 127560 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 23453 gccgccgccgaatccgccgc 23472
>dbj|AP005893.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0030K05 Length = 157835 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 100197 gccgccgccgaatccgccgc 100178 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 109117 gccgccgccgaatccgccgc 109098
>dbj|AP005739.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0012A04 Length = 150317 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 32394 gccgccgccgaatccgccgc 32375 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 41055 gccgccgccgaatccgccgc 41036
>dbj|AP003921.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0028G04 Length = 159761 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 55326 gccgccgccgaatccgccgc 55345
>dbj|AP003338.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1212_B09 Length = 130728 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 90808 gccgccgccgaatccgccgc 90789
>dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0460H04 Length = 166490 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 145435 gccgccgccgaatccgccgc 145454
>dbj|AP006176.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0681H07 Length = 144722 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 51847 gccgccgccgaatccgccgc 51866
>dbj|AP005903.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1012G11 Length = 167168 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 49153 gccgccgccgaatccgccgc 49172
>dbj|AP004803.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0677B10 Length = 134423 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 28212 gccgccgccgaatccgccgc 28231
>dbj|AP006235.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0017N10 Length = 168535 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 149253 gccgccgccgaatccgccgc 149234
>dbj|AP005916.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0066M12 Length = 162198 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 43374 gccgccgccgaatccgccgc 43355 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 55200 gccgccgccgaatccgccgc 55181
>dbj|AP005876.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0092O08 Length = 145596 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 51715 gccgccgccgaatccgccgc 51696
>dbj|AP005837.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0024K20 Length = 165041 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 138763 gccgccgccgaatccgccgc 138744 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 150589 gccgccgccgaatccgccgc 150570
>dbj|AP005722.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1261_A08 Length = 162113 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 67939 gccgccgccgaatccgccgc 67920
>dbj|AP004132.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1089_A02 Length = 117908 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 103122 gccgccgccgaatccgccgc 103141
>dbj|AP005753.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0084L05 Length = 126264 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 115522 gccgccgccgaatccgccgc 115503
>dbj|AP005322.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0677G01 Length = 137031 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 12273 gccgccgccgaatccgccgc 12292
>dbj|AP006268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0037D09 Length = 140470 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 113745 gccgccgccgaatccgccgc 113764 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 121770 gccgccgccgaatccgccgc 121789
>dbj|AP005911.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0040C06 Length = 158875 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 102875 gccgccgccgaatccgccgc 102856
>dbj|AP005201.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0685B06 Length = 140293 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 62060 gccgccgccgaatccgccgc 62079 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 105240 gccgccgccgaatccgccgc 105221 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 114116 gccgccgccgaatccgccgc 114097
>dbj|AP005444.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0011H01 Length = 165634 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 48706 gccgccgccgaatccgccgc 48725
>dbj|AP005307.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0046D03 Length = 150554 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 48090 gccgccgccgaatccgccgc 48109
>dbj|AP005260.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0557D09 Length = 135315 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 27732 gccgccgccgaatccgccgc 27751
>dbj|AP006626.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1042B08 Length = 142032 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 58866 gccgccgccgaatccgccgc 58885 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 65394 gccgccgccgaatccgccgc 65413
>dbj|AP006459.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0084D17 Length = 143931 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 26053 gccgccgccgaatccgccgc 26072 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 65975 gccgccgccgaatccgccgc 65956
>dbj|AP005908.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1121_A05 Length = 172668 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 54607 gccgccgccgaatccgccgc 54588 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 63536 gccgccgccgaatccgccgc 63517
>dbj|AP005104.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0042E08 Length = 166257 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 111696 gccgccgccgaatccgccgc 111677 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 120617 gccgccgccgaatccgccgc 120598
>dbj|AP005102.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0033J14 Length = 158233 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 89811 gccgccgccgaatccgccgc 89792 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 96659 gccgccgccgaatccgccgc 96640
>dbj|AP003817.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1167_G06 Length = 112386 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13951 gccgccgccgaatccgccgc 13970 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 21976 gccgccgccgaatccgccgc 21995
>dbj|AP004343.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0618H09 Length = 142306 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 105534 gccgccgccgaatccgccgc 105553 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 113559 gccgccgccgaatccgccgc 113578
>dbj|AP004156.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_G07 Length = 149119 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 100713 gccgccgccgaatccgccgc 100732
>dbj|AP005556.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1118_F11 Length = 113866 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 76133 gccgccgccgaatccgccgc 76152 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 84619 gccgccgccgaatccgccgc 84638
>dbj|AP004879.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0475F05 Length = 147522 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 101460 gccgccgccgaatccgccgc 101441
>gb|AC135600.3| Oryza sativa chromosome 3 BAC OSJNBb0047K21 genomic sequence, complete sequence Length = 117046 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 51467 gccgccgccgaatccgccgc 51486
>dbj|AP005746.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0018I03 Length = 145818 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 104608 gccgccgccgaatccgccgc 104589
>dbj|AP004845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1233_A01 Length = 98378 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 68161 gccgccgccgaatccgccgc 68180
>dbj|AP006615.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1165C09 Length = 202985 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 56209 gccgccgccgaatccgccgc 56228 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 86219 gccgccgccgaatccgccgc 86200 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 87633 gccgccgccgaatccgccgc 87652 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 96349 gccgccgccgaatccgccgc 96330 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 102339 gccgccgccgaatccgccgc 102358 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 117333 gccgccgccgaatccgccgc 117314 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 121996 gccgccgccgaatccgccgc 121977
>dbj|AP005754.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0089L03 Length = 172106 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 33583 gccgccgccgaatccgccgc 33564 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 56505 gccgccgccgaatccgccgc 56486
>dbj|AP005494.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0086M15 Length = 153491 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 59744 gccgccgccgaatccgccgc 59725 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 88041 gccgccgccgaatccgccgc 88060
>dbj|AP005488.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0003D23 Length = 151604 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 114528 gccgccgccgaatccgccgc 114509 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 137450 gccgccgccgaatccgccgc 137431
>dbj|AK118199.1| Arabidopsis thaliana At1g01170 mRNA for unknown protein, complete cds, clone: RAFL19-52-C06 Length = 422 Score = 40.1 bits (20), Expect = 9.8 Identities = 32/36 (88%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||| ||||| ||||| ||||| |||||||||||| Sbjct: 275 atgaatcccattagccgtcagaatttcatcgtcaag 310
>dbj|AP005816.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1168A08 Length = 138135 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 40415 gccgccgccgaatccgccgc 40434 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 50435 gccgccgccgaatccgccgc 50416
>dbj|AP005254.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0064I19 Length = 111644 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 79467 gccgccgccgaatccgccgc 79486 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 89487 gccgccgccgaatccgccgc 89468
>dbj|AP005478.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0070J06 Length = 142303 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 66884 gccgccgccgaatccgccgc 66903 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 75808 gccgccgccgaatccgccgc 75827 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 83255 gccgccgccgaatccgccgc 83236
>dbj|AP005933.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0674B07 Length = 192191 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 13657 gccgccgccgaatccgccgc 13638 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 15071 gccgccgccgaatccgccgc 15090 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 23787 gccgccgccgaatccgccgc 23768 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 29777 gccgccgccgaatccgccgc 29796 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 44771 gccgccgccgaatccgccgc 44752 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 49434 gccgccgccgaatccgccgc 49415
>dbj|AP005870.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1049E04 Length = 159216 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 94850 gccgccgccgaatccgccgc 94831
>dbj|AP005298.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1770_H03 Length = 189893 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 132889 gccgccgccgaatccgccgc 132870 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 139164 gccgccgccgaatccgccgc 139145 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 145441 gccgccgccgaatccgccgc 145422
>dbj|AP004663.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0410E02 Length = 144294 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 27676 gccgccgccgaatccgccgc 27695 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 31644 gccgccgccgaatccgccgc 31663 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 gccgccgccgaatccgccgc 77 |||||||||||||||||||| Sbjct: 51391 gccgccgccgaatccgccgc 51410
>emb|AL844155.6| Mouse DNA sequence from clone RP23-163L4 on chromosome 2, complete sequence Length = 193188 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 gctctctccaccaagcaaga 47 |||||||||||||||||||| Sbjct: 144296 gctctctccaccaagcaaga 144277
>gb|AC023628.3|AC023628 Arabidopsis thaliana chromosome I BAC F6F3 genomic sequence, complete sequence Length = 104001 Score = 40.1 bits (20), Expect = 9.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||| ||||| ||||| ||||| |||||||||||| Sbjct: 15063 atgaatcccattagccgtcagaatttcatcgtcaag 15028
>emb|BX818169.1|CNS0ACMJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL64ZF12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 483 Score = 40.1 bits (20), Expect = 9.8 Identities = 32/36 (88%) Strand = Plus / Plus Query: 286 atgaaccccatcagccgccagaacttcatcgtcaag 321 ||||| ||||| ||||| ||||| |||||||||||| Sbjct: 259 atgaatcccattagccgtcagaatttcatcgtcaag 294 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 125,564,088 Number of extensions: 7223104 Number of successful extensions: 165043 Number of sequences better than 10.0: 272 Number of HSP's gapped: 165037 Number of HSP's successfully gapped: 622 Length of query: 665 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 643 Effective length of database: 18,508,616,841 Effective search space: 11901040628763 Effective search space used: 11901040628763 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
