Clone Information

BLAST Search Result

Clone Name	FLbaf156e09
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|AL136119.16\| Human DNA sequence from clone RP11-113F5 on chr...	48	0.097
2	emb\|BX510640.4\| Zebrafish DNA sequence from clone RP71-57J15 in ...	48	0.097
3	emb\|BX649520.20\| Zebrafish DNA sequence from clone DKEY-174E3 in...	48	0.097
4	emb\|BX936423.12\| Zebrafish DNA sequence from clone DKEY-174M14 i...	48	0.097
5	emb\|AL606977.28\| Mouse DNA sequence from clone RP23-284L6 on chr...	48	0.097
6	emb\|CT573126.9\| Zebrafish DNA sequence from clone CH73-1O10 in l...	46	0.38
7	gb\|AC135420.4\| Oryza sativa (japonica cultivar-group) chromosome...	46	0.38
8	gb\|AC147329.2\| Pan troglodytes BAC clone RP43-21F14 from 7, comp...	46	0.38
9	gb\|AY139113.1\| Mus musculus TSG-5B and TSG-5A gene, complete cds...	46	0.38
10	gb\|AC073048.7\| Homo sapiens BAC clone RP11-54E21 from 7, complet...	46	0.38
11	dbj\|AK005985.1\| Mus musculus adult male testis cDNA, RIKEN full-...	46	0.38
12	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.38
13	emb\|CR847503.8\| Zebrafish DNA sequence from clone DKEY-20D21 in ...	46	0.38
14	emb\|CR382286.9\| Zebrafish DNA sequence from clone CH211-12J10 in...	46	0.38
15	emb\|CR790375.9\| Zebrafish DNA sequence from clone CH211-251O16 i...	46	0.38
16	emb\|CR751229.6\| Zebrafish DNA sequence from clone CH211-116I17 i...	46	0.38
17	emb\|CR753834.5\| Zebrafish DNA sequence from clone DKEY-62E10 in ...	46	0.38
18	gb\|AC154323.3\| Mus musculus BAC clone RP23-307K19 from chromosom...	46	0.38
19	emb\|BX950214.7\| Zebrafish DNA sequence from clone CH211-214C2 in...	46	0.38
20	emb\|BX323589.10\| Zebrafish DNA sequence from clone DKEY-186H8 in...	46	0.38
21	emb\|BX088559.18\| Zebrafish DNA sequence from clone DKEY-238P16 i...	46	0.38
22	emb\|AL935185.11\| Zebrafish DNA sequence from clone CH211-250A16 ...	46	0.38
23	emb\|BX255929.7\| Zebrafish DNA sequence from clone CH211-271P5 in...	46	0.38
24	gb\|AC102183.6\| Mus musculus chromosome 15, clone RP24-146N2, com...	46	0.38
25	emb\|BX004974.21\| Zebrafish DNA sequence from clone CH211-74A16 i...	46	0.38
26	emb\|AL671907.6\| Mouse DNA sequence from clone RP23-245F8 on chro...	46	0.38
27	gb\|AC154407.2\| Mus musculus BAC clone RP24-257B4 from 14, comple...	46	0.38
28	emb\|BX511243.3\| Mouse DNA sequence from clone RP23-62N18 on chro...	46	0.38
29	emb\|CR753832.8\| Zebrafish DNA sequence from clone DKEY-71C18 in ...	46	0.38
30	emb\|CU019655.6\| Zebrafish DNA sequence from clone DKEY-212N16 in...	44	1.5
31	emb\|CT033824.16\| Zebrafish DNA sequence from clone CH211-167H3 i...	44	1.5
32	emb\|CR354538.29\| Zebrafish DNA sequence from clone CH211-16K18 i...	44	1.5
33	emb\|CT009491.6\| Zebrafish DNA sequence from clone CH73-152I3, co...	44	1.5
34	gb\|AC191983.4\| Rhesus Macaque BAC CH250-64G9 () complete sequence	44	1.5
35	emb\|CR855235.1\| Oryza sativa genomic DNA, chromosome 4, BAC clon...	44	1.5
36	gb\|AC191987.3\| Rhesus Macaque BAC CH250-384N22 () complete sequ...	44	1.5
37	emb\|CR450847.14\| Zebrafish DNA sequence from clone CH211-235J21 ...	44	1.5
38	ref\|NM_001072045.1\| Oryza sativa (japonica cultivar-group) Os10g...	44	1.5
39	ref\|NM_001065065.1\| Oryza sativa (japonica cultivar-group) Os06g...	44	1.5
40	emb\|BX927091.14\| Zebrafish DNA sequence from clone DKEY-94M1 in ...	44	1.5
41	gb\|AC187320.9\| Canis Familiaris chromosome 16, clone XX-49O13, c...	44	1.5
42	emb\|CT954308.7\| N.leucogenys DNA sequence from clone CH271-273H2...	44	1.5
43	gb\|AC190254.2\| Pan troglodytes BAC clone CH251-156A4 from chromo...	44	1.5
44	emb\|CT573143.8\| Zebrafish DNA sequence from clone CH211-74A19 in...	44	1.5
45	emb\|CR925774.22\| Zebrafish DNA sequence from clone DKEY-259J3 in...	44	1.5
46	emb\|CR788289.5\| Zebrafish DNA sequence from clone DKEY-176H21, c...	44	1.5
47	emb\|CR385040.11\| Zebrafish DNA sequence from clone DKEYP-101C8 i...	44	1.5
48	gb\|AC163700.3\| Gallus gallus BAC clone CH261-184J12 from chromos...	44	1.5
49	emb\|BX663516.23\| Zebrafish DNA sequence from clone DKEY-16F21 in...	44	1.5
50	emb\|CR383669.17\| Zebrafish DNA sequence from clone DKEY-25O1 in ...	44	1.5
51	gb\|AC167359.4\| Mus musculus BAC clone RP24-94F12 from chromosome...	44	1.5
52	gb\|AC167173.4\| Mus musculus BAC clone RP23-30D21 from chromosome...	44	1.5
53	gb\|AC166362.5\| Mus musculus BAC clone RP23-299O17 from chromosom...	44	1.5
54	gb\|AY775329.1\| Calyptorhynchus latirostris microsatellite Cl8 se...	44	1.5
55	gb\|AC116525.24\| Mus musculus chromosome 15, clone RP24-352I18, c...	44	1.5
56	gb\|AC111132.7\| Mus musculus chromosome 3, clone RP23-340B7, comp...	44	1.5
57	gb\|AC148004.3\| Mus musculus BAC clone RP23-352J18 from chromosom...	44	1.5
58	gb\|AC115928.10\| Mus musculus chromosome 18, clone RP24-530D22, c...	44	1.5
59	gb\|AC149031.1\| Rhinolophus ferrumequinum clone VMRC7-44G7, compl...	44	1.5
60	gb\|AC118610.9\| Mus musculus chromosome 6, clone RP23-178I17, com...	44	1.5
61	gb\|AC121356.10\| Mus musculus chromosome 6, clone RP23-52D17, com...	44	1.5
62	gb\|AC124770.4\| Mus musculus BAC clone RP23-8J2 from chromosome 1...	44	1.5
63	gb\|AC108797.8\| Mus musculus chromosome 3, clone RP23-349M18, com...	44	1.5
64	gb\|AY463691.1\| Oryza sativa (japonica cultivar-group) DUR3 (OSJN...	44	1.5
65	gb\|AC133654.4\| Mus musculus BAC clone RP24-332N10 from chromosom...	44	1.5
66	gb\|AC127353.3\| Mus musculus BAC clone RP23-81P21 from chromosome...	44	1.5
67	gb\|AC139334.3\| Mus musculus BAC clone RP23-449C21 from chromosom...	44	1.5
68	gb\|AC129201.3\| Mus musculus BAC clone RP24-224A15 from chromosom...	44	1.5
69	gb\|AC125117.4\| Mus musculus BAC clone RP24-261P10 from chromosom...	44	1.5
70	gb\|AC122404.4\| Mus musculus BAC clone RP24-116G1 from chromosome...	44	1.5
71	gb\|AC124202.3\| Mus musculus BAC clone RP23-337F21 from chromosom...	44	1.5
72	gb\|AC098886.4\| Mus musculus BAC clone RP23-122M21 from 4, comple...	44	1.5
73	gb\|AC104099.5\| Mus musculus BAC clone RP24-372J8 from 3, complet...	44	1.5
74	gb\|AC091685.4\| Homo sapiens BAC clone RP11-165H4 from 7, complet...	44	1.5
75	gb\|AF003131.2\| Caenorhabditis elegans cosmid C09D1, complete seq...	44	1.5
76	dbj\|AK128451.1\| Homo sapiens cDNA FLJ46594 fis, clone THYMU3045692	44	1.5
77	gb\|AC090229.15\| Homo sapiens chromosome 18, clone RP11-873E20, c...	44	1.5
78	gb\|AC123769.5\| Homo sapiens chromosome 17, clone RP11-1086I4, co...	44	1.5
79	gb\|AC048383.25\| Homo sapiens chromosome 15, clone RP11-543G18, c...	44	1.5
80	gb\|AC151265.3\| Mus musculus BAC clone RP24-372H7 from chromosome...	44	1.5
81	gb\|AC118757.12\| Homo sapiens chromosome 18, clone RP11-905K4, co...	44	1.5
82	gb\|AC024610.6\| Homo sapiens chromosome 17, clone RP11-17M24, com...	44	1.5
83	gb\|AC011419.7\| Homo sapiens chromosome 5 clone CTD-2029I9, compl...	44	1.5
84	emb\|CR377226.19\| Zebrafish DNA sequence from clone DKEY-120I4 in...	44	1.5
85	emb\|CR450794.8\| Zebrafish DNA sequence from clone CH211-259I2 in...	44	1.5
86	emb\|BX899180.11\| Zebrafish DNA sequence from clone DKEY-287G19 i...	44	1.5
87	emb\|CR407547.14\| Zebrafish DNA sequence from clone DKEY-62A12 in...	44	1.5
88	gb\|AC103948.4\| Homo sapiens chromosome 17, clone CTD-3058D16, co...	44	1.5
89	dbj\|AP008216.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
90	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
91	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
92	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
93	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
94	gb\|AF469961.1\| Oncorhynchus mykiss microsatellite OMM1173 sequence	44	1.5
95	emb\|BX928756.13\| Zebrafish DNA sequence from clone CH211-113K9 i...	44	1.5
96	emb\|AL359823.15\| Human DNA sequence from clone RP4-610L12 on chr...	44	1.5
97	emb\|AL683870.15\| Human DNA sequence from clone RP11-261P4 on chr...	44	1.5
98	emb\|AL158086.32\| Human DNA sequence from clone RP4-815O16 on chr...	44	1.5
99	emb\|AL138956.17\| Human DNA sequence from clone RP11-16D22 on chr...	44	1.5
100	emb\|AL133552.8\| Human DNA sequence from clone RP11-67B16 on chro...	44	1.5
101	emb\|AL022323.7\|HS243E7 Human DNA sequence from clone CTA-243E7 o...	44	1.5
102	emb\|CR936380.6\| Zebrafish DNA sequence from clone CH73-122H24 in...	44	1.5
103	emb\|BX640480.22\| Zebrafish DNA sequence from clone DKEYP-86F2 in...	44	1.5
104	emb\|BX664613.17\| Zebrafish DNA sequence from clone DKEY-5P5 in l...	44	1.5
105	emb\|BX323550.13\| Zebrafish DNA sequence from clone DKEYP-70F9 in...	44	1.5
106	gb\|AC137898.6\| Homo sapiens chromosome 17, clone RP11-101O21, co...	44	1.5
107	gb\|AC018727.10\| Oryza sativa chromosome 10 BAC OSJNBa0056G17 gen...	44	1.5
108	emb\|BX950851.1\| Erwinia carotovora subsp. atroseptica SCRI1043, ...	44	1.5
109	gb\|AC008586.6\|AC008586 Homo sapiens chromosome 5 clone CTC-568N2...	44	1.5
110	emb\|BX255905.4\| Zebrafish DNA sequence from clone DKEY-11B8 in l...	44	1.5
111	emb\|CR762483.10\| Zebrafish DNA sequence from clone DKEY-112K13 i...	44	1.5
112	emb\|CR385072.5\| Zebrafish DNA sequence from clone bGZ-142E16, co...	44	1.5
113	emb\|CR381625.6\| Zebrafish DNA sequence from clone CH211-226F10, ...	44	1.5
114	emb\|CR388091.9\| Zebrafish DNA sequence from clone CH211-114H16 i...	44	1.5
115	emb\|AL645747.11\| Mouse DNA sequence from clone RP23-436D9 on chr...	44	1.5
116	emb\|AL596255.17\| Mouse DNA sequence from clone RP23-6K20 on chro...	44	1.5
117	emb\|CR450720.5\| Zebrafish DNA sequence from clone DKEYP-51F11 in...	44	1.5
118	emb\|CR759748.6\| Zebrafish DNA sequence from clone DKEYP-118G11 i...	44	1.5
119	emb\|AL645788.6\| Zebrafish DNA sequence from clone BUSM1-17K08 Co...	44	1.5
120	emb\|AL929016.5\| Zebrafish DNA sequence from clone DKEY-24J9 in l...	44	1.5
121	emb\|CR394541.16\| Zebrafish DNA sequence from clone DKEY-51M5 in ...	44	1.5
122	gb\|AC152823.3\| Mus musculus BAC clone RP24-302N10 from chromosom...	44	1.5
123	gb\|AC019100.4\| Homo sapiens BAC clone RP11-443K8 from 2, complet...	44	1.5
124	emb\|BX323543.11\| Zebrafish DNA sequence from clone DKEYP-67E1 in...	44	1.5
125	dbj\|AP003621.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
126	emb\|BX537304.14\| Zebrafish DNA sequence from clone CH211-283H6 i...	44	1.5
127	dbj\|AP002913.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
128	dbj\|AP005175.4\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
129	dbj\|AP004869.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	1.5
130	emb\|BX510306.17\| Zebrafish DNA sequence from clone CH211-195F19 ...	44	1.5
131	emb\|BX005156.9\| Zebrafish DNA sequence from clone CH211-165F21 i...	44	1.5
132	emb\|BX530075.7\| Zebrafish DNA sequence from clone CH211-1O14 in ...	44	1.5
133	dbj\|AK070459.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	1.5
134	dbj\|AK066531.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	1.5
135	emb\|AL935146.13\| Zebrafish DNA sequence from clone CH211-171D11 ...	44	1.5
136	emb\|BX004980.8\| Zebrafish DNA sequence from clone DKEY-15N5 in l...	44	1.5
137	emb\|BX276117.5\| Zebrafish DNA sequence from clone CH211-112K18 i...	44	1.5
138	emb\|BX088594.5\| Zebrafish DNA sequence from clone RP71-1G17 in l...	44	1.5
139	gb\|AC005155.1\|AC005155 Homo sapiens PAC clone RP5-877J2 from 7p1...	44	1.5
140	emb\|AL163302.2\|HS21C102 Homo sapiens chromosome 21 segment HS21C102	44	1.5
141	gb\|AC138119.5\| Mus musculus BAC clone RP23-307D8 from chromosome...	44	1.5
142	gb\|AC113075.9\| Mus musculus chromosome 19, clone RP23-278F24, co...	44	1.5
143	gb\|AC151999.5\| Mus musculus BAC clone RP23-98D11 from chromosome...	44	1.5
144	emb\|AL928980.7\| Zebrafish DNA sequence from clone DKEY-77M16 in ...	44	1.5
145	emb\|CR847901.7\| Zebrafish DNA sequence from clone DKEY-215L17 in...	44	1.5
146	emb\|CT010473.14\| Mouse DNA sequence from clone RP23-238D5 on chr...	44	1.5
147	emb\|AL935293.11\| Zebrafish DNA sequence from clone CH211-251D10 ...	44	1.5
148	emb\|AL928952.15\| Zebrafish DNA sequence from clone CH211-225G23,...	44	1.5
149	emb\|BX322557.1\|HS112E20 Homo sapiens chromosome 21 from PAC RP1-...	44	1.5
150	gb\|AC147545.3\| Mus musculus BAC clone RP23-355L20 from 14, compl...	44	1.5
151	emb\|AL606967.14\| Mouse DNA sequence from clone RP23-304D5 on chr...	44	1.5
152	emb\|AL606907.9\| Mouse DNA sequence from clone RP23-230F2 on chro...	44	1.5
153	gb\|U88310.1\| Caenorhabditis elegans cosmid C24G7, complete sequence	44	1.5
154	gb\|AC156543.10\| Mus musculus chromosome 15, clone RP23-220F2, co...	44	1.5
155	gb\|AC114494.2\| Homo sapiens chromosome 1 clone RP11-439L8, compl...	44	1.5
156	dbj\|AB065701.1\| Homo sapiens gene for seven transmembrane helix ...	44	1.5
157	gb\|EF066619.1\| Scarus rubroviolaceus clone Sru-C121 microsatelli...	42	6.0
158	emb\|CT963081.7\| Zebrafish DNA sequence from clone CH73-194F15 in...	42	6.0
159	emb\|CR376742.16\| Zebrafish DNA sequence from clone CH211-207C17 ...	42	6.0
160	gb\|AC191886.2\| Pan troglodytes chromosome X clone CH251-89D5 map...	42	6.0
161	emb\|CT025894.23\| Zebrafish DNA sequence from clone CH211-153A20 ...	42	6.0
162	ref\|XM_001016190.1\| Tetrahymena thermophila SB210 Penicillin ami...	42	6.0
163	gb\|AC192815.2\| Pan troglodytes BAC clone CH251-56H1 from chromos...	42	6.0
164	gb\|AC191655.2\| Taeniopygia guttata BAC clone TGMCBa-26H12 from c...	42	6.0
165	gb\|DQ244258.1\| Zea mays clone 3955 mRNA sequence	42	6.0
166	emb\|CR848683.9\| Zebrafish DNA sequence from clone CH211-63I2 in ...	42	6.0
167	gb\|AC192582.2\| Pan troglodytes BAC clone CH251-599G11 from chrom...	42	6.0
168	emb\|CR925740.26\| Zebrafish DNA sequence from clone CH211-238G24 ...	42	6.0
169	emb\|CR318626.13\| Zebrafish DNA sequence from clone DKEY-29L7 in ...	42	6.0
170	emb\|CR847968.17\| Zebrafish DNA sequence from clone CH211-203D7 i...	42	6.0
171	gb\|AC190425.2\| Pan troglodytes chromosome X clone CH251-240E16 m...	42	6.0
172	gb\|CP000473.1\| Solibacter usitatus Ellin6076, complete genome	42	6.0
173	emb\|CR356235.15\| Zebrafish DNA sequence from clone DKEY-14H16 in...	42	6.0
174	emb\|CR752641.12\| Zebrafish DNA sequence from clone DKEY-1P18 in ...	42	6.0
175	emb\|CR926460.7\| Zebrafish DNA sequence from clone DKEY-222P23 in...	42	6.0
176	emb\|CR940365.20\| Zebrafish DNA sequence from clone CH211-199H19 ...	42	6.0
177	emb\|CR388022.12\| Zebrafish DNA sequence from clone CH211-183H23 ...	42	6.0
178	gb\|DQ227283.1\| Canis familiaris developmental myosin heavy chain...	42	6.0
179	emb\|CR376862.18\| Zebrafish DNA sequence from clone DKEY-90K7 in ...	42	6.0
180	emb\|CR753862.32\| Zebrafish DNA sequence from clone DKEY-165L22 i...	42	6.0
181	emb\|CR387991.18\| Zebrafish DNA sequence from clone CH211-285C3 i...	42	6.0
182	emb\|CR854923.7\| Zebrafish DNA sequence from clone CH211-170J16 i...	42	6.0
183	gb\|DQ866809.1\| Homo sapiens endoglin (Osler-Rendu-Weber syndrome...	42	6.0
184	emb\|CR383675.13\| Zebrafish DNA sequence from clone DKEYP-10D4 in...	42	6.0
185	emb\|CR926461.10\| Zebrafish DNA sequence from clone DKEY-246B13, ...	42	6.0
186	emb\|CR749751.11\| Zebrafish DNA sequence from clone DKEY-24H18 in...	42	6.0
187	gb\|AE013599.4\| Drosophila melanogaster chromosome 2R, complete s...	42	6.0
188	emb\|CT868708.10\| Zebrafish DNA sequence from clone DKEY-257I7 in...	42	6.0
189	emb\|CR678488.7\| Zebrafish DNA sequence from clone DKEY-220D15 in...	42	6.0
190	emb\|BX571679.38\| Zebrafish DNA sequence from clone DKEYP-10C7 in...	42	6.0
191	gb\|AC164658.4\| Pan troglodytes BAC clone CH251-155M18 from chrom...	42	6.0
192	emb\|CR559931.20\| Zebrafish DNA sequence from clone DKEY-33G10 in...	42	6.0
193	gb\|AC188788.1\| Homo sapiens chromosome 3 clone ABC8_000043775400...	42	6.0
194	emb\|CR932059.8\| Zebrafish DNA sequence from clone DKEYP-67G8 in ...	42	6.0
195	emb\|CR974425.13\| Zebrafish DNA sequence from clone CH73-189A7 in...	42	6.0
196	emb\|CT030634.12\| Mouse DNA sequence from clone RP23-6A14 on chro...	42	6.0
197	emb\|CT009601.13\| Mouse DNA sequence from clone RP23-38D2 on chro...	42	6.0
198	gb\|AC182553.2\| Mus musculus BAC clone RP24-560H20 from chromosom...	42	6.0
199	emb\|BX936377.17\| Zebrafish DNA sequence from clone DKEY-149J2 in...	42	6.0
200	gb\|DQ229107.1\| Chara vulgaris chloroplast, complete genome	42	6.0
201	emb\|CR385031.17\| Zebrafish DNA sequence from clone DKEY-16K12 in...	42	6.0
202	emb\|BX897691.14\| Zebrafish DNA sequence from clone DKEY-168E3 in...	42	6.0
203	emb\|CR936518.13\| Zebrafish DNA sequence from clone DKEY-27E18 in...	42	6.0
204	emb\|CR558302.9\| Zebrafish DNA sequence from clone DKEY-33M11 in ...	42	6.0
205	emb\|BX284684.8\| Zebrafish DNA sequence from clone DKEY-14I10 in ...	42	6.0
206	gb\|DQ182353.1\| Carduelis tristis microsatellite CtC117 sequence	42	6.0
207	gb\|AC183833.2\| Pan troglodytes BAC clone CH251-141C5 from chromo...	42	6.0
208	gb\|AC183385.3\| Pan troglodytes BAC clone CH251-277F20 from chrom...	42	6.0
209	gb\|AC183680.3\| Pan troglodytes BAC clone CH251-425K14 from chrom...	42	6.0
210	gb\|AC148932.3\| Pan troglodytes BAC clone CH251-571G8 from chromo...	42	6.0
211	gb\|AC152001.3\| Ornithorhynchus anatinus BAC clone OABb-256A1 fro...	42	6.0
212	emb\|CR450684.10\| Zebrafish DNA sequence from clone DKEY-60D5 in ...	42	6.0
213	gb\|DQ483432.1\| Gymnogyps californianus contig 135H microsatellit...	42	6.0
214	gb\|DQ483387.1\| Gymnogyps californianus contig 90H microsatellite...	42	6.0
215	gb\|DQ483327.1\| Gymnogyps californianus contig 30H microsatellite...	42	6.0
216	emb\|CR847999.10\| Zebrafish DNA sequence from clone DKEY-216M6 in...	42	6.0
217	gb\|CP000319.1\| Nitrobacter hamburgensis X14, complete genome	42	6.0
218	emb\|CR388184.33\| Zebrafish DNA sequence from clone CH211-261O3 i...	42	6.0
219	emb\|BX901950.7\| Zebrafish DNA sequence from clone DKEY-111C4 in ...	42	6.0
220	emb\|CR925738.6\| Zebrafish DNA sequence from clone DKEY-164G12 in...	42	6.0
221	gb\|AC175467.3\| Pan troglodytes BAC clone CH251-302C22 from chrom...	42	6.0
222	emb\|CR388144.17\| Zebrafish DNA sequence from clone DKEY-21I17 in...	42	6.0
223	gb\|AC183302.2\| Pan troglodytes BAC clone CH251-258O5 from chromo...	42	6.0
224	emb\|CR381592.4\| Zebrafish DNA sequence from clone CH211-94B7 in ...	42	6.0
225	emb\|CR376776.19\| Zebrafish DNA sequence from clone CH211-13I23, ...	42	6.0
226	gb\|AC163102.5\| Mus musculus chromosome 18, clone RP23-270E10, co...	42	6.0
227	gb\|AC107762.8\| Mus musculus chromosome 1, clone RP23-183L12, com...	42	6.0
228	gb\|AC116758.11\| Mus musculus chromosome 8, clone RP23-383A10, co...	42	6.0
229	gb\|AC108429.11\| Mus musculus chromosome 7, clone RP23-161B5, com...	42	6.0
230	gb\|AC159318.4\| Mus musculus BAC clone RP23-76M13 from chromosome...	42	6.0
231	gb\|AC151980.3\| Mus musculus BAC clone RP24-83M3 from chromosome ...	42	6.0
232	gb\|AC164085.3\| Mus musculus BAC clone RP23-205G24 from chromosom...	42	6.0
233	gb\|DQ223122.1\| Alasmidonta heterodon microsatellite AheC5 sequence	42	6.0
234	gb\|AC169122.1\| Mus musculus BAC clone RP23-167K9 from chromosome...	42	6.0
235	gb\|AC110913.13\| Mus musculus chromosome 19, clone RP24-399E19, c...	42	6.0
236	gb\|AC100927.11\| Mus musculus chromosome 3, clone RP23-72A21, com...	42	6.0
237	gb\|AC125068.4\| Mus musculus chromosome UNKNOWN clone RP23-432M17...	42	6.0
238	gb\|AC161505.4\| Mus musculus chromosome 8, clone RP24-307K17, com...	42	6.0
239	gb\|AC003057.1\| Mouse Cosmid ma08m030 from 14D1-D2, complete sequ...	42	6.0
240	gb\|AC137842.8\| Mus musculus chromosome 15, clone RP23-91M6, comp...	42	6.0
241	gb\|AC126035.4\| Mus musculus chromosome UNKNOWN clone RP24-122B7,...	42	6.0
242	gb\|AC160995.4\| Mus musculus BAC clone RP23-96D5 from chromosome ...	42	6.0
243	gb\|AC101991.9\| Mus musculus chromosome 1, clone RP24-372E16, com...	42	6.0
244	gb\|AC116781.9\| Mus musculus chromosome 16, clone RP24-134G20, co...	42	6.0
245	gb\|AC101672.11\| Mus musculus chromosome 5, clone RP23-115F16, co...	42	6.0
246	gb\|AC138359.8\| Mus musculus chromosome 1, clone RP24-383H12, com...	42	6.0
247	gb\|AY723871.1\| Saccharomyces cerevisiae clone FLH006989.01X YPR1...	42	6.0
248	gb\|AC134933.2\| Oryza sativa (japonica cultivar-group) chromosome...	42	6.0
249	gb\|AC146430.4\| Pan troglodytes BAC clone RP43-21F8 from 7, compl...	42	6.0
250	gb\|AC110499.19\| Mus musculus chromosome 1, clone RP23-202J6, com...	42	6.0
251	gb\|AC127189.4\| Rattus norvegicus 1 BAC CH230-266M16 (Children's ...	42	6.0
252	gb\|AC137617.3\| Oryza sativa (japonica cultivar-group) chromosome...	42	6.0
253	gb\|AC131725.2\| Mus musculus BAC clone RP23-129H16 from chromosom...	42	6.0
254	gb\|AC140680.4\| Mus musculus BAC clone RP24-548A12 from chromosom...	42	6.0
255	gb\|AC134553.5\| Mus musculus BAC clone RP24-280H19 from chromosom...	42	6.0
256	gb\|AC130828.4\| Mus musculus BAC clone RP23-406H14 from chromosom...	42	6.0
257	gb\|AC125052.4\| Mus musculus BAC clone RP23-388L12 from chromosom...	42	6.0
258	gb\|AC117627.16\| Mus musculus chromosome 1, clone RP23-116N6, com...	42	6.0
259	gb\|AC158619.12\| Mus musculus 10 BAC RP23-291O3 (Roswell Park Can...	42	6.0
260	gb\|AC146189.3\| Pan troglodytes BAC clone CH251-490L21 from Y, co...	42	6.0
261	gb\|AC148934.2\| Pan troglodytes BAC clone CH251-557M20 from Y, co...	42	6.0
262	gb\|AE007273.1\| Sinorhizobium meliloti 1021 plasmid pSymA section...	42	6.0
263	gb\|AC153510.10\| Mus musculus 10 BAC RP23-151C4 (Roswell Park Can...	42	6.0
264	gb\|AC073162.9\| Homo sapiens chromosome 10 clone RP11-536J24, com...	42	6.0
265	gb\|AC146408.3\| Pan troglodytes BAC clone RP43-41L7 from 7, compl...	42	6.0
266	gb\|AC146428.3\| Pan troglodytes BAC clone RP43-22M18 from 7, comp...	42	6.0
267	gb\|AC129178.4\| Mus musculus BAC clone RP23-217G18 from chromosom...	42	6.0
268	gb\|AC125192.3\| Mus musculus BAC clone RP23-266B4 from chromosome...	42	6.0
269	gb\|AC140443.2\| Mus musculus BAC clone RP24-171A23 from chromosom...	42	6.0
270	gb\|AC145571.3\| Mus musculus BAC clone RP24-450H18 from chromosom...	42	6.0
271	gb\|AC129289.4\| Mus musculus BAC clone RP24-482E11 from chromosom...	42	6.0
272	gb\|AC132570.3\| Mus musculus BAC clone RP24-531D1 from chromosome...	42	6.0
273	gb\|AC165344.3\| Mus musculus BAC clone RP23-390P7 from chromosome...	42	6.0
274	gb\|AC157771.8\| Mus musculus chromosome 1, clone RP24-287N8, comp...	42	6.0
275	gb\|AC166993.4\| Mus musculus BAC clone RP23-467D18 from chromosom...	42	6.0
276	gb\|AC153608.10\| Mus musculus 6 BAC RP23-79A7 (Roswell Park Cance...	42	6.0
277	gb\|AC164084.5\| Mus musculus BAC clone RP23-15P15 from chromosome...	42	6.0
278	gb\|AC135422.2\| Oryza sativa (japonica cultivar-group) chromosome...	42	6.0
279	gb\|AC146716.1\| Oryza sativa (japonica cultivar-group) chromosome...	42	6.0
280	gb\|AC161442.5\| Mus musculus chromosome 5, clone RP23-384P12, com...	42	6.0
281	gb\|AC104200.12\| Mus musculus chromosome 13, clone RP24-512M2, co...	42	6.0
282	gb\|AC118476.15\| Mus musculus chromosome 9, clone RP23-242K3, com...	42	6.0
283	gb\|AC158347.4\| Mus musculus chromosome 3, clone RP23-380F8, comp...	42	6.0
284	gb\|AC165294.4\| Mus musculus BAC clone RP23-115J11 from chromosom...	42	6.0
285	gb\|AC164880.3\| Mus musculus BAC clone RP23-321G17 from chromosom...	42	6.0
286	gb\|AC162890.4\| Mus musculus chromosome 3, clone RP23-362E13, com...	42	6.0
287	gb\|AF228730.8\| Homo sapiens chromosome 8 clones SCb-332a23, CTB-...	42	6.0
288	gb\|AC158549.8\| Mus musculus chromosome 19, clone RP24-216K4, com...	42	6.0
289	gb\|AC091324.10\| Mus musculus chromosome 7, clone RP23-7G1, compl...	42	6.0
290	gb\|AC120181.10\| Mus musculus chromosome 12, clone RP24-500I11, c...	42	6.0
291	gb\|AC105265.4\| Homo sapiens chromosome 3 clone RP11-398A8, compl...	42	6.0
292	gb\|AY566236.1\| Homo sapiens fibroblast growth factor 23 (FGF23) ...	42	6.0
293	gb\|AC145299.3\| Mus musculus BAC clone RP24-129J23 from chromosom...	42	6.0
294	gb\|AC141875.4\| Mus musculus BAC clone RP24-316O22 from chromosom...	42	6.0
295	gb\|AC128670.3\| Mus musculus BAC clone RP23-137H4 from chromosome...	42	6.0
296	gb\|AC124374.5\| Mus musculus BAC clone RP24-567K8 from chromosome...	42	6.0
297	gb\|AC116111.17\| Mus musculus chromosome 10, clone RP23-23B18, co...	42	6.0
298	gb\|AC093168.3\| Homo sapiens BAC clone RP11-148M21 from 7, comple...	42	6.0
299	gb\|AC005056.2\| Homo sapiens BAC clone CTB-51J22 from 7, complete...	42	6.0
300	gb\|AC093734.3\| Homo sapiens BAC clone RP11-16P10 from 7, complet...	42	6.0
301	gb\|AC118211.10\| Mus musculus chromosome 8, clone RP24-223O5, com...	42	6.0
302	gb\|AC138093.7\| Mus musculus chromosome 16, clone RP24-559J21, co...	42	6.0
303	gb\|AC117118.4\| Rattus norvegicus 1 BAC CH230-161O8 (Children's H...	42	6.0
304	gb\|AC145344.2\| Mus musculus BAC clone RP24-134P13 from chromosom...	42	6.0
305	gb\|AC144581.3\| Mus musculus BAC clone RP24-341C2 from chromosome...	42	6.0
306	gb\|AC147341.2\| Pan troglodytes BAC clone CH251-31E16 from Y, com...	42	6.0
307	gb\|AC146234.3\| Pan troglodytes BAC clone CH251-199F20 from Y, co...	42	6.0
308	gb\|AC147151.2\| Pan troglodytes BAC clone CH251-205A10 from Y, co...	42	6.0
309	gb\|AC133950.4\| Mus musculus BAC clone RP24-243C16 from chromosom...	42	6.0
310	gb\|AY498860.1\| Homo sapiens tumor necrosis factor receptor super...	42	6.0
311	gb\|AC121909.3\| Mus musculus BAC clone RP24-179L9 from chromosome...	42	6.0
312	gb\|AC140469.2\| Mus musculus BAC clone RP24-396D20 from chromosom...	42	6.0
313	gb\|AC130721.3\| Mus musculus BAC clone RP24-333B3 from chromosome...	42	6.0
314	gb\|AC114000.5\| Mus musculus BAC clone RP23-161K1 from chromosome...	42	6.0
315	gb\|AC116997.3\| Mus musculus BAC clone RP23-8J15 from chromosome ...	42	6.0
316	gb\|AC132452.3\| Mus musculus BAC clone RP23-195K10 from chromosom...	42	6.0
317	gb\|AC126447.3\| Mus musculus BAC clone RP23-352G19 from chromosom...	42	6.0
318	gb\|AC133193.3\| Mus musculus BAC clone RP23-396L1 from chromosome...	42	6.0
319	gb\|AC125349.3\| Mus musculus BAC clone RP23-394P9 from chromosome...	42	6.0
320	gb\|AC122445.3\| Mus musculus BAC clone RP24-233P3 from chromosome...	42	6.0
321	gb\|AC125138.4\| Mus musculus BAC clone RP24-324N8 from chromosome...	42	6.0
322	gb\|AC124381.4\| Mus musculus BAC clone RP24-406E24 from chromosom...	42	6.0
323	gb\|AC122420.4\| Mus musculus BAC clone RP24-167C5 from chromosome...	42	6.0
324	gb\|AC121905.3\| Mus musculus BAC clone RP24-176A1 from chromosome...	42	6.0
325	gb\|AC124700.3\| Mus musculus BAC clone RP24-199L11 from chromosom...	42	6.0
326	gb\|AC122932.4\| Mus musculus BAC clone RP23-16A20 from 1, complet...	42	6.0
327	gb\|AC002287.1\|HUAC002287 Homo sapiens Chromosome 16 BAC clone CI...	42	6.0
328	gb\|AC007620.30\| Homo sapiens 3 BAC RP11-145M9 (Roswell Park Canc...	42	6.0
329	gb\|AC073864.29\| Homo sapiens 12 BAC RP11-227B21 (Roswell Park Ca...	42	6.0
330	gb\|AC087430.3\| Homo sapiens chromosome 3 clone RP11-242C8 map 3p...	42	6.0
331	gb\|AC098708.3\| Mus musculus BAC clone RP23-1I16 from 13, complet...	42	6.0
332	gb\|AC146458.3\| Pan troglodytes BAC clone CH251-72D14 from Y, com...	42	6.0
333	gb\|AC092648.3\| Homo sapiens BAC clone RP11-421N10 from 7, comple...	42	6.0
334	gb\|AC073871.7\| Homo sapiens BAC clone RP11-260H17 from 7, comple...	42	6.0
335	gb\|AC004928.2\| Homo sapiens PAC clone RP5-914M6 from 7, complete...	42	6.0
336	gb\|AC112990.7\| Mus musculus chromosome 19, clone RP24-317E20, co...	42	6.0
337	gb\|AC123714.6\| Mus musculus chromosome 9, clone RP23-393E20, com...	42	6.0
338	gb\|AC123675.7\| Mus musculus chromosome 15, clone RP23-271I6, com...	42	6.0
339	gb\|AC110169.7\| Mus musculus chromosome 9, clone RP23-233D3, comp...	42	6.0
340	gb\|AC165082.2\| Mus musculus BAC clone RP23-412H17 from chromosom...	42	6.0
341	gb\|AC101994.3\| Mus musculus chromosome 1, clone RP24-406F14, com...	42	6.0
342	gb\|AC151835.4\| Mus musculus BAC clone RP23-333J1 from chromosome...	42	6.0
343	gb\|AC158914.4\| Mus musculus chromosome 5, clone RP24-249F11, com...	42	6.0
344	gb\|AC009030.10\| Homo sapiens chromosome 16 clone RP11-13G6, comp...	42	6.0
345	gb\|AC138364.8\| Mus musculus chromosome 7, clone RP23-243D10, com...	42	6.0
346	gb\|AC091783.9\| Genomic sequence for Mus musculus, clone RP23-16G...	42	6.0
347	gb\|AC125576.4\| Rattus norvegicus 18 BAC CH230-9F9 (Children's Ho...	42	6.0
348	ref\|NM_001047890.1\| Rattus norvegicus similar to Ab2-095 (RGD130...	42	6.0
349	gb\|AC177797.3\| Mus musculus BAC clone RP24-558G11 from chromosom...	42	6.0
350	gb\|AC162868.2\| Mus musculus chromosome 1, clone RP24-296M22, com...	42	6.0
351	gb\|AC007846.12\| Homo sapiens chromosome 17, clone CTC-803F22, co...	42	6.0
352	gb\|AC051649.21\| Homo sapiens chromosome 11, clone RP11-534I22, c...	42	6.0
353	gb\|AC150908.6\| Pan troglodytes BAC clone CH251-513A23 from chrom...	42	6.0
354	dbj\|BA000038.2\| Vibrio vulnificus YJ016 DNA, chromosome II, comp...	42	6.0
355	gb\|AC093176.6\| Mus musculus Strain C57BL6/J chromosome 6 BAC, RP...	42	6.0
356	gb\|AC169375.4\| Sorghum bicolor clone SB_BBc0020O07, complete seq...	42	6.0
357	gb\|AC161231.7\| Mus musculus chromosome 5, clone RP24-241P24, com...	42	6.0
358	gb\|AC159819.2\| Mus musculus BAC clone RP23-180C14 from chromosom...	42	6.0
359	gb\|AC153511.4\| Mus musculus 10 BAC RP23-102N12 (Roswell Park Can...	42	6.0
360	gb\|AC163355.2\| Mus musculus BAC clone RP23-11P15 from chromosome...	42	6.0
361	gb\|AC111399.4\| Rattus norvegicus Mcs BAC CH230-138L13 (Children'...	42	6.0
362	gb\|AC091588.6\| Homo sapiens chromosome 18, clone RP11-627G18, co...	42	6.0
363	gb\|AC117602.9\| Mus musculus chromosome 5, clone RP23-462C22, com...	42	6.0
364	gb\|AY172180.1\| Loxodonta africana microsatellite LaT18 sequence	42	6.0
365	gb\|AC122546.14\| Mus musculus chromosome 5, clone RP23-408A1, com...	42	6.0
366	gb\|AC161348.2\| Mus musculus chromosome 5, clone RP23-393E10, com...	42	6.0
367	emb\|BX901929.9\| Zebrafish DNA sequence from clone DKEY-11K24 in ...	42	6.0
368	emb\|CR381614.10\| Zebrafish DNA sequence from clone DKEY-72G4 in ...	42	6.0
369	emb\|AL772388.35\| Zebrafish DNA sequence from clone CH211-202M22 ...	42	6.0
370	gb\|AC108508.2\| Genomic sequence for Mus musculus, clone RP23-437...	42	6.0
371	gb\|AC022239.16\| Homo sapiens chromosome 8, clone RP11-148O21, co...	42	6.0
372	gb\|AC007834.40\| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cance...	42	6.0
373	gb\|AC163159.5\| Mus musculus chromosome 1, clone RP24-186A12, com...	42	6.0
374	gb\|AC105130.8\| Homo sapiens chromosome 8, clone RP11-357L10, com...	42	6.0
375	gb\|AC161757.5\| Mus musculus BAC clone RP24-87P2 from chromosome ...	42	6.0
376	gb\|AC011591.9\| Homo sapiens, clone RP11-118B18, complete sequence	42	6.0
377	gb\|AC080003.6\| Homo sapiens BAC clone RP11-344F9 from 4, complet...	42	6.0
378	gb\|AC126615.7\| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Canc...	42	6.0
379	dbj\|AK169549.1\| Mus musculus 3 days neonate thymus cDNA, RIKEN f...	42	6.0
380	gb\|AF512511.1\| Mus musculus NFIL3 (Nfil3) gene, promoter, 5' UTR...	42	6.0
381	dbj\|AK162789.1\| Mus musculus 16 days neonate thymus cDNA, RIKEN ...	42	6.0
382	gb\|AC010299.8\| Homo sapiens chromosome 5 clone CTB-174J2, comple...	42	6.0
383	gb\|AC121336.3\| Homo sapiens 12 BAC RP11-134P3 (Roswell Park Canc...	42	6.0
384	gb\|AC104849.2\| Homo sapiens chromosome 3 clone RP11-154D3, compl...	42	6.0
385	emb\|CR381579.22\| Zebrafish DNA sequence from clone CH211-229N1 i...	42	6.0
386	dbj\|AK043033.1\| Mus musculus 7 days neonate cerebellum cDNA, RIK...	42	6.0
387	emb\|CR381560.8\| Zebrafish DNA sequence from clone CH211-172L8 in...	42	6.0
388	gb\|AC110794.3\| Homo sapiens BAC clone RP11-598O12 from 4, comple...	42	6.0
389	emb\|AJ853975.1\| Diplosoma listerianum microsatellite DNA, locus ...	42	6.0
390	emb\|CR762485.16\| Zebrafish DNA sequence from clone DKEY-269K12 i...	42	6.0
391	gb\|AC105939.2\| Homo sapiens chromosome 3 clone RP11-241A5, compl...	42	6.0
392	gb\|AC106827.2\| Homo sapiens chromosome 3 clone RP11-320P11, comp...	42	6.0
393	emb\|BX908756.12\| Zebrafish DNA sequence from clone CH211-190D13 ...	42	6.0
394	emb\|CR450690.7\| Zebrafish DNA sequence from clone CH211-78C14 in...	42	6.0
395	emb\|BX601645.15\| Zebrafish DNA sequence from clone CH211-207J7 i...	42	6.0
396	emb\|CR933522.11\| Zebrafish DNA sequence from clone CH211-22N13 i...	42	6.0
397	emb\|CR388121.11\| Zebrafish DNA sequence from clone DKEY-161F5 in...	42	6.0
398	emb\|CR936360.14\| Human DNA sequence from clone RP13-440N7 on chr...	42	6.0
399	gb\|AC117403.4\| Homo sapiens 12 BAC RP11-239E14 (Roswell Park Can...	42	6.0
400	emb\|CR545479.12\| Zebrafish DNA sequence from clone CH211-219M24 ...	42	6.0
401	emb\|BX897684.8\| Zebrafish DNA sequence from clone CH211-107A4 in...	42	6.0
402	gb\|AC087894.15\| Homo sapiens 12 BAC RP11-749H20 (Roswell Park Ca...	42	6.0
403	gb\|AC018398.10\| Homo sapiens chromosome 8, clone RP11-16G12, com...	42	6.0
404	gb\|AC009260.13\| Homo sapiens 12 BAC RP11-435A10 (Roswell Park Ca...	42	6.0
405	emb\|BX088589.14\| Zebrafish DNA sequence from clone DKEY-27E7 in ...	42	6.0
406	gb\|AC087382.11\| Homo sapiens chromosome 15, clone RP11-653J6, co...	42	6.0
407	gb\|AC109600.2\| Homo sapiens chromosome 16 clone RP11-7O14, compl...	42	6.0
408	gb\|AC079955.9\| Homo sapiens chromosome 10 clone RP11-134O16, com...	42	6.0
409	emb\|CR933520.10\| Zebrafish DNA sequence from clone CH211-28A20 i...	42	6.0
410	emb\|CR450735.9\| Zebrafish DNA sequence from clone CH211-274B17 i...	42	6.0
411	emb\|CR735141.14\| Zebrafish DNA sequence from clone CH211-128E9 i...	42	6.0
412	dbj\|AK011772.1\| Mus musculus 10 days embryo whole body cDNA, RIK...	42	6.0
413	emb\|CR626904.15\| Zebrafish DNA sequence from clone DKEY-53D10 in...	42	6.0
414	emb\|CR848676.7\| Zebrafish DNA sequence from clone DKEY-265I7 in ...	42	6.0
415	gb\|AC105108.4\| Homo sapiens chromosome 8, clone CTD2-3179G6, com...	42	6.0
416	gb\|AC022022.10\| Homo sapiens chromosome 10 clone RP11-351O1, com...	42	6.0
417	emb\|CR376783.22\| Zebrafish DNA sequence from clone DKEY-41N20 in...	42	6.0
418	gb\|AC023823.7\| Homo sapiens chromosome 16 clone RP11-163K4, comp...	42	6.0
419	gb\|AC016168.18\| Homo sapiens chromosome 17, clone RP11-87G24, co...	42	6.0
420	gb\|AC007542.3\| Homo sapiens 12p12 BAC RPCI11-320J20 (Roswell Par...	42	6.0
421	gb\|AC026726.7\| Homo sapiens chromosome 5 clone CTD-2249K22, comp...	42	6.0
422	emb\|CR713112.2\|CNS0GD6S Tetraodon nigroviridis full-length cDNA	42	6.0
423	emb\|CR709741.2\|CNS0GAL5 Tetraodon nigroviridis full-length cDNA	42	6.0
424	gb\|AC090338.6\| Homo sapiens chromosome 18, clone RP11-704C2, com...	42	6.0
425	gb\|AC008012.8\| Homo sapiens 12p13 BAC RPCI11-388F6 (Roswell Park...	42	6.0
426	gb\|AC008660.5\| Homo sapiens chromosome 5 clone CTB-27N1, complet...	42	6.0
427	gb\|AC092183.6\| Homo sapiens 12p BAC RP11-6K23 (Roswell Park Canc...	42	6.0
428	gb\|AC092182.9\| Homo sapiens 12p BAC RP11-174D5 (Roswell Park Can...	42	6.0
429	gb\|AC073866.16\| Homo sapiens 12q BAC RP11-120B18 (Roswell Park C...	42	6.0
430	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	6.0
431	gb\|AC011847.9\| Homo sapiens chromosome 15, clone RP11-348J6, com...	42	6.0
432	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	6.0
433	gb\|AC093669.4\| Homo sapiens BAC clone RP11-540E16 from 4, comple...	42	6.0
434	gb\|AC008731.8\| Homo sapiens chromosome 16 clone CTD-2515A14, com...	42	6.0
435	gb\|AC011927.11\| Homo sapiens chromosome 15, clone RP11-15O14, co...	42	6.0
436	gb\|AC021818.9\| Homo sapiens chromosome 15, clone RP11-19J5, comp...	42	6.0
437	emb\|BX927062.11\| Zebrafish DNA sequence from clone CH211-227N20 ...	42	6.0
438	gb\|AC026467.6\| Homo sapiens chromosome 16 clone RP11-410M9, comp...	42	6.0
439	gb\|AC148299.3\| Pan troglodytes BAC clone CH251-484A18 from chrom...	42	6.0
440	gb\|AC175498.2\| Pan troglodytes BAC clone CH251-572B5 from chromo...	42	6.0
441	emb\|CR383667.11\| Zebrafish DNA sequence from clone CH211-229P19 ...	42	6.0
442	emb\|CR354558.20\| Zebrafish DNA sequence from clone CH211-12A23 i...	42	6.0
443	emb\|CR339051.6\| Zebrafish DNA sequence from clone DKEY-223N8 in ...	42	6.0
444	gb\|AC009433.11\| Homo sapiens, clone RP11-108N14, complete sequence	42	6.0
445	gb\|AC000385.2\| Homo sapiens chromosome 11 clone PAC pDJ392a17, c...	42	6.0
446	emb\|AL451109.1\|NCB11A5 Neurospora crassa DNA linkage group V BAC...	42	6.0
447	gb\|AC008885.5\| Homo sapiens chromosome 5 clone CTD-2218K11, comp...	42	6.0
448	gb\|AC108174.1\| Homo sapiens chromosome 5 clone RP11-78C3, comple...	42	6.0
449	gb\|AC108172.1\| Homo sapiens chromosome 5 clone RP11-171P23, comp...	42	6.0
450	gb\|AC096914.2\| Homo sapiens chromosome 3 clone RP11-16E8, comple...	42	6.0
451	emb\|BX571952.13\| Zebrafish DNA sequence from clone DKEY-35E8 in ...	42	6.0
452	emb\|CR352207.9\| Zebrafish DNA sequence from clone CH211-110B5 in...	42	6.0
453	emb\|CR392025.7\| Zebrafish DNA sequence from clone CH211-248P17 i...	42	6.0
454	gb\|AF315553.1\|AF315553 Homo sapiens PRKY gene, partial sequence,...	42	6.0
455	emb\|CR925794.8\| Zebrafish DNA sequence from clone CH211-202A23 i...	42	6.0
456	emb\|BX276112.19\| Zebrafish DNA sequence from clone CH211-220I12 ...	42	6.0
457	emb\|BX649466.19\| Zebrafish DNA sequence from clone DKEY-31C8 in ...	42	6.0
458	emb\|CR933523.10\| Zebrafish DNA sequence from clone CH211-127H20 ...	42	6.0
459	emb\|CR391930.9\| Zebrafish DNA sequence from clone CH211-154B16 i...	42	6.0
460	emb\|CR383660.9\| Zebrafish DNA sequence from clone DKEY-1H22 in l...	42	6.0
461	emb\|Z99916.1\|HS221G9 Human DNA sequence from clone CTA-221G9 on ...	42	6.0
462	emb\|Z81010.2\|HSN10C3 Human DNA sequence from clone LL22NC03-10C3...	42	6.0
463	emb\|Z97987.1\|HS453P22 Human DNA sequence from clone RP3-453P22 o...	42	6.0
464	emb\|Z95624.1\|HSU237H1 Human DNA sequence from clone LL0XNC01-237...	42	6.0
465	emb\|Z82189.1\|HS170A21 Human DNA sequence from clone RP1-170A21 o...	42	6.0
466	emb\|Z82202.1\|HS34P24 Human DNA sequence from clone RP1-34P24 on ...	42	6.0
467	emb\|CR769775.11\| Human DNA sequence from clone RP11-449H15 on ch...	42	6.0
468	emb\|BX908382.8\| Human DNA sequence from clone WI2-87105E3 on chr...	42	6.0
469	emb\|CR381612.5\| Zebrafish DNA sequence from clone DKEY-274K7, co...	42	6.0
470	emb\|AL953854.21\| Human DNA sequence from clone RP11-211P14 on ch...	42	6.0
471	emb\|BX004827.18\| Human DNA sequence from clone RP13-391G2 on chr...	42	6.0
472	emb\|AL732314.18\| Human DNA sequence from clone RP13-465B17 on ch...	42	6.0
473	emb\|AL732324.6\| Human DNA sequence from clone RP13-470G3 on chro...	42	6.0
474	emb\|AL929101.4\| Human DNA sequence from clone RP11-22B10 on chro...	42	6.0
475	emb\|AL672311.26\| Human DNA sequence from clone RP13-167H21 on ch...	42	6.0
476	emb\|AL672277.20\| Human DNA sequence from clone RP11-309M23 on ch...	42	6.0
477	emb\|AL593851.6\| Human DNA sequence from clone RP11-415H23 on chr...	42	6.0
478	emb\|AL590235.23\| Human DNA sequence from clone RP11-529E10 on ch...	42	6.0
479	emb\|AL590551.7\| Human DNA sequence from clone RP11-243O10 on chr...	42	6.0
480	emb\|AL450386.17\| Human DNA sequence from clone RP11-466B20 on ch...	42	6.0
481	emb\|AL512383.11\| Human DNA sequence from clone RP11-193J6 on chr...	42	6.0
482	emb\|AL513024.9\| Human DNA sequence from clone RP11-555B19 on chr...	42	6.0
483	emb\|AL391987.15\| Human DNA sequence from clone RP11-374M1 on chr...	42	6.0
484	emb\|AL445668.10\| Human DNA sequence from clone RP11-234O23 on ch...	42	6.0
485	emb\|AL445192.3\| Human DNA sequence from clone RP11-269H4 on chro...	42	6.0
486	emb\|AL365255.25\| Human DNA sequence from clone RP11-154H17 on ch...	42	6.0
487	emb\|AL390791.15\| Human DNA sequence from clone RP11-204A14 on ch...	42	6.0
488	gb\|AC064807.7\| Homo sapiens chromosome 8, clone RP11-546K22, com...	42	6.0
489	emb\|AL389889.11\| Human DNA sequence from clone RP11-164D18 on ch...	42	6.0
490	emb\|AL357934.29\| Human DNA sequence from clone RP11-565P9 on chr...	42	6.0
491	emb\|AL356953.17\| Human DNA sequence from clone RP11-572A16 on ch...	42	6.0
492	ref\|XM_681439.1\| PREDICTED: Danio rerio similar to OSJNBb0080H08...	42	6.0
493	emb\|AL358793.14\| Human DNA sequence from clone RP11-19M4 on chro...	42	6.0
494	gb\|AC015617.8\| Homo sapiens, clone RP11-45H23, complete sequence	42	6.0
495	emb\|AL357835.11\| Human DNA sequence from clone RP11-426M1 on chr...	42	6.0
496	emb\|AL356072.21\| Human DNA sequence from clone RP11-141M15 on ch...	42	6.0
497	emb\|AL354984.17\| Human DNA sequence from clone RP13-379L11 on ch...	42	6.0
498	emb\|AL356102.13\| Human DNA sequence from clone RP11-490P13 on ch...	42	6.0
499	emb\|AL161443.13\| Human DNA sequence from clone RP11-169L18 on ch...	42	6.0
500	emb\|BX005210.10\| Zebrafish DNA sequence from clone DKEY-222F8 in...	42	6.0

>emb|AL136119.16| Human DNA sequence from clone RP11-113F5 on chromosome 10, complete
             sequence
          Length = 91580
 Score = 48.1 bits (24), Expect = 0.097
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 411   tggatggatggatggatgcagttc 434
             ||||||||||||||||||||||||
Sbjct: 69732 tggatggatggatggatgcagttc 69709

to top

>emb|BX510640.4| Zebrafish DNA sequence from clone RP71-57J15 in linkage group 19,
             complete sequence
          Length = 139917

 Score = 48.1 bits (24), Expect = 0.097
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 409   tatggatggatggatggatgcagt 432
             ||||||||||||||||||||||||
Sbjct: 67658 tatggatggatggatggatgcagt 67681



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 54715 atggatggatggatggatgca 54695

to top

>emb|BX649520.20| Zebrafish DNA sequence from clone DKEY-174E3 in linkage group 13,
             complete sequence
          Length = 219709

 Score = 48.1 bits (24), Expect = 0.097
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 410   atggatggatggatggatgcagtt 433
             ||||||||||||||||||||||||
Sbjct: 27961 atggatggatggatggatgcagtt 27938



 Score = 48.1 bits (24), Expect = 0.097
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 410   atggatggatggatggatgcagtt 433
             ||||||||||||||||||||||||
Sbjct: 28108 atggatggatggatggatgcagtt 28085



 Score = 48.1 bits (24), Expect = 0.097
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 410   atggatggatggatggatgcagtt 433
             ||||||||||||||||||||||||
Sbjct: 28197 atggatggatggatggatgcagtt 28174



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 413   gatggatggatggatgcagtt 433
             |||||||||||||||||||||
Sbjct: 28449 gatggatggatggatgcagtt 28429



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 413   gatggatggatggatgcagtt 433
             |||||||||||||||||||||
Sbjct: 28576 gatggatggatggatgcagtt 28556

to top

>emb|BX936423.12| Zebrafish DNA sequence from clone DKEY-174M14 in linkage group 20,
            complete sequence
          Length = 170767

 Score = 48.1 bits (24), Expect = 0.097
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 405  tttctatggatggatggatggatg 428
            ||||||||||||||||||||||||
Sbjct: 6555 tttctatggatggatggatggatg 6578

to top

>emb|AL606977.28| Mouse DNA sequence from clone RP23-284L6 on chromosome 4, complete
             sequence
          Length = 199429

 Score = 48.1 bits (24), Expect = 0.097
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 410   atggatggatggatggatgcagtt 433
             ||||||||||||||||||||||||
Sbjct: 40898 atggatggatggatggatgcagtt 40875

to top

>emb|CT573126.9| Zebrafish DNA sequence from clone CH73-1O10 in linkage group 4,
             complete sequence
          Length = 89546

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 408   ctatggatggatggatggatgca 430
             |||||||||||||||||||||||
Sbjct: 51629 ctatggatggatggatggatgca 51607



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 51177 ctatggatggatggatggatg 51157



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 51301 ctatggatggatggatggatg 51281



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 51437 atggatggatggatggatgca 51417



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 51443 ctatggatggatggatggatg 51423



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 51491 atggatggatggatggatgca 51471



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 51521 ctatggatggatggatggatg 51501



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 407   tctatggatggatggatggat 427
             |||||||||||||||||||||
Sbjct: 54599 tctatggatggatggatggat 54579



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 407   tctatggatggatggatggat 427
             |||||||||||||||||||||
Sbjct: 54657 tctatggatggatggatggat 54637

to top

>gb|AC135420.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0060G17,
              complete sequence
          Length = 174949

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 410    atggatggatggatggatgcagt 432
              |||||||||||||||||||||||
Sbjct: 166425 atggatggatggatggatgcagt 166403

to top

>gb|AC147329.2| Pan troglodytes BAC clone RP43-21F14 from 7, complete sequence
          Length = 189770

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 402    ttatttctatggatggatggatggatg 428
              ||||||||||||| |||||||||||||
Sbjct: 153355 ttatttctatggagggatggatggatg 153329

to top

>gb|AY139113.1| Mus musculus TSG-5B and TSG-5A gene, complete cds; alternatively
             spliced
          Length = 27434

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 402   ttatttctatggatggatggatggatg 428
             |||||||||||||||||| ||||||||
Sbjct: 17277 ttatttctatggatggatagatggatg 17303

to top

>gb|AC073048.7| Homo sapiens BAC clone RP11-54E21 from 7, complete sequence
          Length = 166183

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 402    ttatttctatggatggatggatggatg 428
              ||||||||||||| |||||||||||||
Sbjct: 116875 ttatttctatggagggatggatggatg 116901

to top

>dbj|AK005985.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700014P11 product:laminin gamma 3, full
           insert sequence
          Length = 1172

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 410 atggatggatggatggatgcagt 432
           |||||||||||||||||||||||
Sbjct: 401 atggatggatggatggatgcagt 379

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 410     atggatggatggatggatgcagt 432
               |||||||||||||||||||||||
Sbjct: 8076834 atggatggatggatggatgcagt 8076812



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 410     atggatggatggatggatgca 430
               |||||||||||||||||||||
Sbjct: 7352605 atggatggatggatggatgca 7352585



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 410      atggatggatggatggatgca 430
                |||||||||||||||||||||
Sbjct: 20279942 atggatggatggatggatgca 20279962

to top

>emb|CR847503.8| Zebrafish DNA sequence from clone DKEY-20D21 in linkage group 8, complete
              sequence
          Length = 217514

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 408    ctatggatggatggatggatgca 430
              |||||||||||||||||||||||
Sbjct: 204548 ctatggatggatggatggatgca 204526

to top

>emb|CR382286.9| Zebrafish DNA sequence from clone CH211-12J10 in linkage group 19,
             complete sequence
          Length = 149742

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 410   atggatggatggatggatgcagt 432
             |||||||||||||||||||||||
Sbjct: 33023 atggatggatggatggatgcagt 33001



 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 410   atggatggatggatggatgcagt 432
             |||||||||||||||||||||||
Sbjct: 33585 atggatggatggatggatgcagt 33563

to top

>emb|CR790375.9| Zebrafish DNA sequence from clone CH211-251O16 in linkage group 4,
             complete sequence
          Length = 153499

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 408   ctatggatggatggatggatgca 430
             |||||||||||||||||||||||
Sbjct: 53697 ctatggatggatggatggatgca 53719



 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 408   ctatggatggatggatggatgca 430
             |||||||||||||||||||||||
Sbjct: 53822 ctatggatggatggatggatgca 53844



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 407   tctatggatggatggatggat 427
             |||||||||||||||||||||
Sbjct: 50721 tctatggatggatggatggat 50741



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 51873 ctatggatggatggatggatg 51893



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 54207 ctatggatggatggatggatg 54227

to top

>emb|CR751229.6| Zebrafish DNA sequence from clone CH211-116I17 in linkage group 4,
            complete sequence
          Length = 58988

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 408  ctatggatggatggatggatgca 430
            |||||||||||||||||||||||
Sbjct: 7367 ctatggatggatggatggatgca 7389



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 407  tctatggatggatggatggat 427
            |||||||||||||||||||||
Sbjct: 4339 tctatggatggatggatggat 4359



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 407  tctatggatggatggatggat 427
            |||||||||||||||||||||
Sbjct: 4397 tctatggatggatggatggat 4417



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 408  ctatggatggatggatggatg 428
            |||||||||||||||||||||
Sbjct: 7475 ctatggatggatggatggatg 7495



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 7505 atggatggatggatggatgca 7525



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 408  ctatggatggatggatggatg 428
            |||||||||||||||||||||
Sbjct: 7553 ctatggatggatggatggatg 7573



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 7559 atggatggatggatggatgca 7579



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 408  ctatggatggatggatggatg 428
            |||||||||||||||||||||
Sbjct: 7695 ctatggatggatggatggatg 7715



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 408  ctatggatggatggatggatg 428
            |||||||||||||||||||||
Sbjct: 7819 ctatggatggatggatggatg 7839

to top

>emb|CR753834.5| Zebrafish DNA sequence from clone DKEY-62E10 in linkage group 5,
            complete sequence
          Length = 66261

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 406  ttctatggatggatggatggatg 428
            |||||||||||||||||||||||
Sbjct: 5576 ttctatggatggatggatggatg 5598

to top

>gb|AC154323.3| Mus musculus BAC clone RP23-307K19 from chromosome 14, complete
             sequence
          Length = 191902

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 402   ttatttctatggatggatggatggatg 428
             |||||||||||||||||| ||||||||
Sbjct: 32602 ttatttctatggatggatagatggatg 32576

to top

>emb|BX950214.7| Zebrafish DNA sequence from clone CH211-214C2 in linkage group 5,
              complete sequence
          Length = 197499

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 410    atggatggatggatggatgcagt 432
              |||||||||||||||||||||||
Sbjct: 165081 atggatggatggatggatgcagt 165059

to top

>emb|BX323589.10| Zebrafish DNA sequence from clone DKEY-186H8 in linkage group 5,
             complete sequence
          Length = 135266

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 406   ttctatggatggatggatggatg 428
             |||||||||||||||||||||||
Sbjct: 19700 ttctatggatggatggatggatg 19722

to top

>emb|BX088559.18| Zebrafish DNA sequence from clone DKEY-238P16 in linkage group 7,
              complete sequence
          Length = 159610

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 405    tttctatggatggatggatggat 427
              |||||||||||||||||||||||
Sbjct: 136841 tttctatggatggatggatggat 136819

to top

>emb|AL935185.11| Zebrafish DNA sequence from clone CH211-250A16 in linkage group 21,
            complete sequence
          Length = 191281

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 408  ctatggatggatggatggatgca 430
            |||||||||||||||||||||||
Sbjct: 1604 ctatggatggatggatggatgca 1626



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 78926 atggatggatggatggatgca 78946

to top

>emb|BX255929.7| Zebrafish DNA sequence from clone CH211-271P5 in linkage group 14,
            complete sequence
          Length = 147460

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 406  ttctatggatggatggatggatg 428
            |||||||||||||||||||||||
Sbjct: 3032 ttctatggatggatggatggatg 3010

to top

>gb|AC102183.6| Mus musculus chromosome 15, clone RP24-146N2, complete sequence
          Length = 148288

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 410   atggatggatggatggatgcagt 432
             |||||||||||||||||||||||
Sbjct: 52344 atggatggatggatggatgcagt 52322

to top

>emb|BX004974.21| Zebrafish DNA sequence from clone CH211-74A16 in linkage group 18,
              complete sequence
          Length = 186303

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 410    atggatggatggatggatgcagt 432
              |||||||||||||||||||||||
Sbjct: 134230 atggatggatggatggatgcagt 134252

to top

>emb|AL671907.6| Mouse DNA sequence from clone RP23-245F8 on chromosome X, complete
              sequence
          Length = 144116

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 410    atggatggatggatggatgcagt 432
              |||||||||||||||||||||||
Sbjct: 112093 atggatggatggatggatgcagt 112071

to top

>gb|AC154407.2| Mus musculus BAC clone RP24-257B4 from 14, complete sequence
          Length = 158436

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 402   ttatttctatggatggatggatggatg 428
             |||||||||||||||||| ||||||||
Sbjct: 20013 ttatttctatggatggatagatggatg 20039

to top

>emb|BX511243.3| Mouse DNA sequence from clone RP23-62N18 on chromosome 2, complete
             sequence
          Length = 58979

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 410   atggatggatggatggatgcagt 432
             |||||||||||||||||||||||
Sbjct: 32932 atggatggatggatggatgcagt 32954

to top

>emb|CR753832.8| Zebrafish DNA sequence from clone DKEY-71C18 in linkage group 5,
             complete sequence
          Length = 122496

 Score = 46.1 bits (23), Expect = 0.38
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 410   atggatggatggatggatgcagt 432
             |||||||||||||||||||||||
Sbjct: 64423 atggatggatggatggatgcagt 64445

to top

>emb|CU019655.6| Zebrafish DNA sequence from clone DKEY-212N16 in linkage group 10,
             complete sequence
          Length = 143004

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 63373 tctatggatggatggatggatg 63394



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 105801 atggatggatggatggatgcag 105780

to top

>emb|CT033824.16| Zebrafish DNA sequence from clone CH211-167H3 in linkage group 21,
             complete sequence
          Length = 141377

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 52829 atggatggatggatggatgcag 52850



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 53037 ctatggatggatggatggatg 53057

to top

>emb|CR354538.29| Zebrafish DNA sequence from clone CH211-16K18 in linkage group 2,
             complete sequence
          Length = 131275

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 85323 atggatggatggatggatgcag 85302



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 85563 atggatggatggatggatgcag 85542

to top

>emb|CT009491.6| Zebrafish DNA sequence from clone CH73-152I3, complete sequence
          Length = 111764

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 40976 tatggatggatggatggatgca 40997

to top

>gb|AC191983.4| Rhesus Macaque  BAC CH250-64G9 () complete sequence
          Length = 176364

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 162639 tatggatggatggatggatgca 162618

to top

>emb|CR855235.1| Oryza sativa genomic DNA, chromosome 4, BAC clone:
              OSIGBa0142I02-OSIGBa0101B20, complete sequence
          Length = 189880

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 182606 atggatggatggatggatgcag 182627

to top

>gb|AC191987.3| Rhesus Macaque  BAC CH250-384N22 () complete sequence
          Length = 147751

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 134255 tatggatggatggatggatgca 134234

to top

>emb|CR450847.14| Zebrafish DNA sequence from clone CH211-235J21 in linkage group 12,
              complete sequence
          Length = 160423

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 125755 atggatggatggatggatgcag 125776

to top

>ref|NM_001072045.1| Oryza sativa (japonica cultivar-group) Os10g0580400 (Os10g0580400)
            mRNA, complete cds
          Length = 2513

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 407  tctatggatggatggatggatg 428
            ||||||||||||||||||||||
Sbjct: 2301 tctatggatggatggatggatg 2280

to top

>ref|NM_001065065.1| Oryza sativa (japonica cultivar-group) Os06g0708000 (Os06g0708000)
           mRNA, complete cds
          Length = 2451

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 410 atggatggatggatggatgcag 431
           ||||||||||||||||||||||
Sbjct: 69  atggatggatggatggatgcag 48

to top

>emb|BX927091.14| Zebrafish DNA sequence from clone DKEY-94M1 in linkage group 10,
            complete sequence
          Length = 22527

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 403  tatttctatggatggatggatggatg 428
            ||||| ||||||||||||||||||||
Sbjct: 9261 tatttgtatggatggatggatggatg 9236

to top

>gb|AC187320.9| Canis Familiaris chromosome 16, clone XX-49O13, complete sequence
          Length = 163370

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 407    tctatggatggatggatggatg 428
              ||||||||||||||||||||||
Sbjct: 160380 tctatggatggatggatggatg 160359

to top

>emb|CT954308.7| N.leucogenys DNA sequence from clone CH271-273H20, complete sequence
          Length = 169822

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 77928 atggatggatggatggatgcag 77907



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 77580 atggatggatggatggatgca 77560



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 77684 atggatggatggatggatgca 77664



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 77820 atggatggatggatggatgca 77800



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 77956 atggatggatggatggatgca 77936



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 77988 atggatggatggatggatgca 77968

to top

>gb|AC190254.2| Pan troglodytes BAC clone CH251-156A4 from chromosome 7, complete
              sequence
          Length = 161590

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 109442 tatggatggatggatggatgca 109463



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 109463 atggatggatggatggatgca 109483

to top

>emb|CT573143.8| Zebrafish DNA sequence from clone CH211-74A19 in linkage group 11,
             complete sequence
          Length = 78553

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 45249 tatggatggatggatggatgca 45270

to top

>emb|CR925774.22| Zebrafish DNA sequence from clone DKEY-259J3 in linkage group 10,
              complete sequence
          Length = 153410

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 407    tctatggatggatggatggatg 428
              ||||||||||||||||||||||
Sbjct: 147370 tctatggatggatggatggatg 147349

to top

>emb|CR788289.5| Zebrafish DNA sequence from clone DKEY-176H21, complete sequence
          Length = 153071

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 105950 atggatggatggatggatgcag 105971

to top

>emb|CR385040.11| Zebrafish DNA sequence from clone DKEYP-101C8 in linkage group 12,
             complete sequence
          Length = 170728

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 48364 tctatggatggatggatggatg 48343

to top

>gb|AC163700.3| Gallus gallus BAC clone CH261-184J12 from chromosome ul, complete
             sequence
          Length = 210054

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 72066 atggatggatggatggatgcag 72087

to top

>emb|BX663516.23| Zebrafish DNA sequence from clone DKEY-16F21 in linkage group 10,
              complete sequence
          Length = 183367

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 149222 atggatggatggatggatgcag 149243

to top

>emb|CR383669.17| Zebrafish DNA sequence from clone DKEY-25O1 in linkage group 24, complete
              sequence
          Length = 185252

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 137090 atggatggatggatggatgcag 137111

to top

>gb|AC167359.4| Mus musculus BAC clone RP24-94F12 from chromosome 8, complete sequence
          Length = 176523

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 14490 atggatggatggatggatgcag 14469

to top

>gb|AC167173.4| Mus musculus BAC clone RP23-30D21 from chromosome 3, complete sequence
          Length = 203513

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 407    tctatggatggatggatggatg 428
              ||||||||||||||||||||||
Sbjct: 128634 tctatggatggatggatggatg 128655

to top

>gb|AC166362.5| Mus musculus BAC clone RP23-299O17 from chromosome 5, complete sequence
          Length = 188276

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 18     cgccgccgccaccccccacccc 39
              ||||||||||||||||||||||
Sbjct: 149009 cgccgccgccaccccccacccc 149030

to top

>gb|AY775329.1| Calyptorhynchus latirostris microsatellite Cl8 sequence
          Length = 530

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 410 atggatggatggatggatgcag 431
           ||||||||||||||||||||||
Sbjct: 419 atggatggatggatggatgcag 440

to top

>gb|AC116525.24| Mus musculus chromosome 15, clone RP24-352I18, complete sequence
          Length = 149726

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 45696 tctatggatggatggatggatg 45675

to top

>gb|AC111132.7| Mus musculus chromosome 3, clone RP23-340B7, complete sequence
          Length = 205647

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 182196 atggatggatggatggatgcag 182217

to top

>gb|AC148004.3| Mus musculus BAC clone RP23-352J18 from chromosome 18, complete
             sequence
          Length = 206275

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 30018 tctatggatggatggatggatg 29997

to top

>gb|AC115928.10| Mus musculus chromosome 18, clone RP24-530D22, complete sequence
          Length = 182777

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 173275 atggatggatggatggatgcag 173254

to top

>gb|AC149031.1| Rhinolophus ferrumequinum clone VMRC7-44G7, complete sequence
          Length = 192138

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 176791 atggatggatggatggatgcag 176812

to top

>gb|AC118610.9| Mus musculus chromosome 6, clone RP23-178I17, complete sequence
          Length = 255673

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 237839 atggatggatggatggatgcag 237860

to top

>gb|AC121356.10| Mus musculus chromosome 6, clone RP23-52D17, complete sequence
          Length = 178055

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 157106 atggatggatggatggatgcag 157085

to top

>gb|AC124770.4| Mus musculus BAC clone RP23-8J2 from chromosome 18, complete sequence
          Length = 216754

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 154833 atggatggatggatggatgcag 154854

to top

>gb|AC108797.8| Mus musculus chromosome 3, clone RP23-349M18, complete sequence
          Length = 208211

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 399    tacttatttctatggatggatggatggatg 428
              |||||||||  |||||||||||||||||||
Sbjct: 107534 tacttatttgaatggatggatggatggatg 107505

to top

>gb|AY463691.1| Oryza sativa (japonica cultivar-group) DUR3 (OSJNBa0056G17.4) mRNA,
            complete cds
          Length = 2478

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 407  tctatggatggatggatggatg 428
            ||||||||||||||||||||||
Sbjct: 2301 tctatggatggatggatggatg 2280

to top

>gb|AC133654.4| Mus musculus BAC clone RP24-332N10 from chromosome 15, complete
             sequence
          Length = 194622

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 13540 atggatggatggatggatgcag 13519

to top

>gb|AC127353.3| Mus musculus BAC clone RP23-81P21 from chromosome 18, complete sequence
          Length = 225658

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 407    tctatggatggatggatggatg 428
              ||||||||||||||||||||||
Sbjct: 143289 tctatggatggatggatggatg 143310

to top

>gb|AC139334.3| Mus musculus BAC clone RP23-449C21 from chromosome 18, complete
             sequence
          Length = 194665

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 38792 tctatggatggatggatggatg 38813

to top

>gb|AC129201.3| Mus musculus BAC clone RP24-224A15 from chromosome 5, complete sequence
          Length = 147253

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     cgccgccgccaccccccacccc 39
              ||||||||||||||||||||||
Sbjct: 120625 cgccgccgccaccccccacccc 120604

to top

>gb|AC125117.4| Mus musculus BAC clone RP24-261P10 from chromosome 14, complete
             sequence
          Length = 165313

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 403   tatttctatggatggatggatggatg 428
             ||||| ||||||||||||||||||||
Sbjct: 37889 tatttgtatggatggatggatggatg 37914

to top

>gb|AC122404.4| Mus musculus BAC clone RP24-116G1 from chromosome 8, complete sequence
          Length = 188197

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 157657 tatggatggatggatggatgca 157678

to top

>gb|AC124202.3| Mus musculus BAC clone RP23-337F21 from chromosome 14, complete
             sequence
          Length = 189556

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 92589 tatggatggatggatggatgca 92610



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 162930 atggatggatggatggatgca 162950



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 163030 atggatggatggatggatgca 163050

to top

>gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, complete sequence
          Length = 219825

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 128435 atggatggatggatggatgcag 128414

to top

>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence
          Length = 148259

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 144012 atggatggatggatggatgcag 143991

to top

>gb|AC091685.4| Homo sapiens BAC clone RP11-165H4 from 7, complete sequence
          Length = 68299

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 26578 atggatggatggatggatgcag 26599

to top

>gb|AF003131.2| Caenorhabditis elegans cosmid C09D1, complete sequence
          Length = 65649

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 55349 atggatggatggatggatgcag 55328

to top

>dbj|AK128451.1| Homo sapiens cDNA FLJ46594 fis, clone THYMU3045692
          Length = 2819

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 409 tatggatggatggatggatgca 430
           ||||||||||||||||||||||
Sbjct: 850 tatggatggatggatggatgca 829



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 26  atggatggatggatggatgca 6



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 298 atggatggatggatggatgca 278



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 429 atggatggatggatggatgca 409



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 701 atggatggatggatggatgca 681



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 813 atggatggatggatggatgca 793



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 1013 atggatggatggatggatgca 993

to top

>gb|AC090229.15| Homo sapiens chromosome 18, clone RP11-873E20, complete sequence
          Length = 192106

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 135566 atggatggatggatggatgcag 135587

to top

>gb|AC123769.5| Homo sapiens chromosome 17, clone RP11-1086I4, complete sequence
          Length = 190245

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 85876 tctatggatggatggatggatg 85897

to top

>gb|AC048383.25| Homo sapiens chromosome 15, clone RP11-543G18, complete sequence
          Length = 192235

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 168147 tatggatggatggatggatgca 168126



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 168299 tatggatggatggatggatgca 168278

to top

>gb|AC151265.3| Mus musculus BAC clone RP24-372H7 from chromosome 17, complete sequence
          Length = 191739

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 28856 tctatggatggatggatggatg 28835

to top

>gb|AC118757.12| Homo sapiens chromosome 18, clone RP11-905K4, complete sequence
          Length = 185308

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 159356 atggatggatggatggatgcag 159335

to top

>gb|AC024610.6| Homo sapiens chromosome 17, clone RP11-17M24, complete sequence
          Length = 176291

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 17907 tctatggatggatggatggatg 17928

to top

>gb|AC011419.7| Homo sapiens chromosome 5 clone CTD-2029I9, complete sequence
          Length = 145435

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 135811 tatggatggatggatggatgca 135832

to top

>emb|CR377226.19| Zebrafish DNA sequence from clone DKEY-120I4 in linkage group 8, complete
              sequence
          Length = 173122

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 140431 atggatggatggatggatgcag 140410

to top

>emb|CR450794.8| Zebrafish DNA sequence from clone CH211-259I2 in linkage group 14,
             complete sequence
          Length = 176875

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 34776 atggatggatggatggatgcag 34755

to top

>emb|BX899180.11| Zebrafish DNA sequence from clone DKEY-287G19 in linkage group 21,
             complete sequence
          Length = 182150

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 49613 tatggatggatggatggatgca 49634



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 49448 atggatggatggatggatgca 49468



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 49533 atggatggatggatggatgca 49553

to top

>emb|CR407547.14| Zebrafish DNA sequence from clone DKEY-62A12 in linkage group 9,
             complete sequence
          Length = 204067

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 70269 tctatggatggatggatggatg 70248



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 70254 atggatggatggatggatgca 70234

to top

>gb|AC103948.4| Homo sapiens chromosome 17, clone CTD-3058D16, complete sequence
          Length = 72416

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 44321 tctatggatggatggatggatg 44300

to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10
          Length = 22685906

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 407      tctatggatggatggatggatg 428
                ||||||||||||||||||||||
Sbjct: 22638993 tctatggatggatggatggatg 22638972

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 410      atggatggatggatggatgcag 431
                ||||||||||||||||||||||
Sbjct: 24698111 atggatggatggatggatgcag 24698090



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 410     atggatggatggatggatgca 430
               |||||||||||||||||||||
Sbjct: 1599745 atggatggatggatggatgca 1599725



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 410      atggatggatggatggatgca 430
                |||||||||||||||||||||
Sbjct: 29017290 atggatggatggatggatgca 29017310

to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6
          Length = 30731886

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 410      atggatggatggatggatgcag 431
                ||||||||||||||||||||||
Sbjct: 29434065 atggatggatggatggatgcag 29434044

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 410     atggatggatggatggatgcag 431
               ||||||||||||||||||||||
Sbjct: 5677692 atggatggatggatggatgcag 5677671



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 410     atggatggatggatggatgca 430
               |||||||||||||||||||||
Sbjct: 4865810 atggatggatggatggatgca 4865830



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 410     atggatggatggatggatgca 430
               |||||||||||||||||||||
Sbjct: 8963977 atggatggatggatggatgca 8963957

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 409     tatggatggatggatggatgca 430
               ||||||||||||||||||||||
Sbjct: 2168498 tatggatggatggatggatgca 2168477



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 410     atggatggatggatggatgca 430
               |||||||||||||||||||||
Sbjct: 5104293 atggatggatggatggatgca 5104313

to top

>gb|AF469961.1| Oncorhynchus mykiss microsatellite OMM1173 sequence
          Length = 381

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 410 atggatggatggatggatgcag 431
           ||||||||||||||||||||||
Sbjct: 134 atggatggatggatggatgcag 113

to top

>emb|BX928756.13| Zebrafish DNA sequence from clone CH211-113K9 in linkage group 21,
             complete sequence
          Length = 157210

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 12004 tatggatggatggatggatgca 12025



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 11839 atggatggatggatggatgca 11859



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 11924 atggatggatggatggatgca 11944

to top

>emb|AL359823.15| Human DNA sequence from clone RP4-610L12 on chromosome 1p12-13.3
             Contains part of the WARS2 gene for tryptophanyl tRNA
             synthetase 2 (mitochondrial), the 5' end of a novel gene,
             a CGI-79 protein (CGI-79) pseudogene and a ribosomal
             protein S3A (RPS3A) pseudogene, complete sequence
          Length = 74784

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 11629 tctatggatggatggatggatg 11608

to top

>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the
             3' end of the IL3RA gene for interleukin 3 receptor, alpha
             (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY,
             hIL-3Ra, MGC34174), the SLC25A6 gene for solute carrier
             family 25 (mitochondrial carrier; adenine nucleotide
             translocator), member 6 (ANT3, ANT3Y, MGC17525), the ASMTL
             gene for acetylserotonin O-methyltransferase-like
             (ASMTLX), a novel gene (LOC286530), a novel gene
             (FLJ13330) and six CpG islands, complete sequence
          Length = 162377

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 25339 atggatggatggatggatgcag 25360



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 27984 atggatggatggatggatgca 28004



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 130922 atggatggatggatggatgca 130902



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 145366 atggatggatggatggatgca 145346



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 145514 atggatggatggatggatgca 145494



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 145698 atggatggatggatggatgca 145678

to top

>emb|AL158086.32| Human DNA sequence from clone RP4-815O16 on chromosome 1p35.1-36.13
             Contains the C1QA gene for complement component 1( q
             subcomponent, alpha polypeptide), the C1QG gene for
             complement component 1 (q subcomponent, gamma
             polypeptide), the C1QB gene for complement component 1 (q
             subcomponent, beta polypeptide), the 5' end of the  EPHB2
             gene for EphB2 and a CpG island, complete sequence
          Length = 87320

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 31612 atggatggatggatggatgcag 31633



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 32027 atggatggatggatggatgcag 32048

to top

>emb|AL138956.17| Human DNA sequence from clone RP11-16D22 on chromosome 13 Contains the
             5' end of a novel gene, complete sequence
          Length = 165257

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 54372 atggatggatggatggatgcag 54393

to top

>emb|AL133552.8| Human DNA sequence from clone RP11-67B16 on chromosome 10 Contains a
             novel gene, complete sequence
          Length = 80955

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 11678 tatggatggatggatggatgca 11657



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 11633 atggatggatggatggatgca 11613



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 11657 atggatggatggatggatgca 11637

to top

>emb|AL022323.7|HS243E7 Human DNA sequence from clone CTA-243E7 on chromosome 22q12.1,
            complete sequence
          Length = 183113

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 409  tatggatggatggatggatgca 430
            ||||||||||||||||||||||
Sbjct: 1655 tatggatggatggatggatgca 1634

to top

>emb|CR936380.6| Zebrafish DNA sequence from clone CH73-122H24 in linkage group 22,
             complete sequence
          Length = 66129

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 403   tatttctatggatggatggatggatg 428
             ||||| ||||||||||||||||||||
Sbjct: 22645 tatttttatggatggatggatggatg 22620

to top

>emb|BX640480.22| Zebrafish DNA sequence from clone DKEYP-86F2 in linkage group 18,
              complete sequence
          Length = 186258

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 100161 tatggatggatggatggatgca 100182

to top

>emb|BX664613.17| Zebrafish DNA sequence from clone DKEY-5P5 in linkage group 22,
             complete sequence
          Length = 121435

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 403   tatttctatggatggatggatggatg 428
             |||||| |||||||||||||||||||
Sbjct: 11410 tatttcgatggatggatggatggatg 11435

to top

>emb|BX323550.13| Zebrafish DNA sequence from clone DKEYP-70F9 in linkage group 22,
             complete sequence
          Length = 200031

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 403   tatttctatggatggatggatggatg 428
             ||||| ||||||||||||||||||||
Sbjct: 35236 tatttttatggatggatggatggatg 35261

to top

>gb|AC137898.6| Homo sapiens chromosome 17, clone RP11-101O21, complete sequence
          Length = 133040

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 66248 atggatggatggatggatgcag 66269

to top

>gb|AC018727.10| Oryza sativa chromosome 10 BAC OSJNBa0056G17 genomic sequence, complete
             sequence
          Length = 139999

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 93662 tctatggatggatggatggatg 93641

to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 1459    tgctgtggtgtctgtgaaagtg 1480
               ||||||||||||||||||||||
Sbjct: 4980478 tgctgtggtgtctgtgaaagtg 4980457

to top

>gb|AC008586.6|AC008586 Homo sapiens chromosome 5 clone CTC-568N24, complete sequence
          Length = 133691

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 130056 tatggatggatggatggatgca 130035

to top

>emb|BX255905.4| Zebrafish DNA sequence from clone DKEY-11B8 in linkage group 20,
             complete sequence
          Length = 118677

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 411   tggatggatggatggatgcagt 432
             ||||||||||||||||||||||
Sbjct: 22680 tggatggatggatggatgcagt 22701

to top

>emb|CR762483.10| Zebrafish DNA sequence from clone DKEY-112K13 in linkage group 13,
             complete sequence
          Length = 79283

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 19738 atggatggatggatggatgcag 19759

to top

>emb|CR385072.5| Zebrafish DNA sequence from clone bGZ-142E16, complete sequence
          Length = 31940

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 30542 tatggatggatggatggatgca 30521

to top

>emb|CR381625.6| Zebrafish DNA sequence from clone CH211-226F10, complete sequence
          Length = 193233

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 105790 tatggatggatggatggatgca 105811

to top

>emb|CR388091.9| Zebrafish DNA sequence from clone CH211-114H16 in linkage group 15,
              complete sequence
          Length = 186423

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 138026 atggatggatggatggatgcag 138005

to top

>emb|AL645747.11| Mouse DNA sequence from clone RP23-436D9 on chromosome 11 Contains a
             novel gene and a signal transducing adaptor molecule (SH3
             domain and ITAM motif) 1 (Stam) pseudogene, complete
             sequence
          Length = 172052

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 60234 tatggatggatggatggatgca 60255

to top

>emb|AL596255.17| Mouse DNA sequence from clone RP23-6K20 on chromosome 11 Contains the
             3' end of the Myh13 gene for skeletal muscle myosin heavy
             polypeptide 13, the 5' end of the Gas7 gene for growth
             arrest specific 7, a novel gene and a CpG island, complete
             sequence
          Length = 251096

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 40916 atggatggatggatggatgcag 40895

to top

>emb|CR450720.5| Zebrafish DNA sequence from clone DKEYP-51F11 in linkage group 2,
            complete sequence
          Length = 200950

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 399  tacttatttctatggatggatggatggatg 428
            |||||||||| | |||||||||||||||||
Sbjct: 7723 tacttatttcaaaggatggatggatggatg 7752

to top

>emb|CR759748.6| Zebrafish DNA sequence from clone DKEYP-118G11 in linkage group 17,
             complete sequence
          Length = 165743

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 33167 atggatggatggatggatgcag 33188



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 33342 atggatggatggatggatgcag 33363



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 39684 atggatggatggatggatgca 39664



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 39720 atggatggatggatggatgca 39700



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 40202 atggatggatggatggatgca 40182

to top

>emb|AL645788.6| Zebrafish DNA sequence from clone BUSM1-17K08 Contains the 5' end of
             the alcam gene for activated leukocyte cell adhesion
             molecule, complete sequence
          Length = 85448

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 403   tatttctatggatggatggatggatg 428
             ||||| ||||||||||||||||||||
Sbjct: 17129 tatttgtatggatggatggatggatg 17104

to top

>emb|AL929016.5| Zebrafish DNA sequence from clone DKEY-24J9 in linkage group 4 Contains
              the gene for a novel protein (zgc:63880), the 3' end of the
              gene for a novel protein similar to vertebrate KCND2, the
              5' end of the ing3 gene for inhibitor of growth family
              member 3 and a CpG island, complete sequence
          Length = 200582

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 403    tatttctatggatggatggatggatg 428
              ||||| ||||||||||||||||||||
Sbjct: 134214 tatttttatggatggatggatggatg 134189

to top

>emb|CR394541.16| Zebrafish DNA sequence from clone DKEY-51M5 in linkage group 22,
             complete sequence
          Length = 64881

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 403   tatttctatggatggatggatggatg 428
             |||||| |||||||||||||||||||
Sbjct: 32224 tatttcgatggatggatggatggatg 32199

to top

>gb|AC152823.3| Mus musculus BAC clone RP24-302N10 from chromosome 15, complete
             sequence
          Length = 211214

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 21780 tctatggatggatggatggatg 21759

to top

>gb|AC019100.4| Homo sapiens BAC clone RP11-443K8 from 2, complete sequence
          Length = 213475

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 200679 atggatggatggatggatgcag 200700

to top

>emb|BX323543.11| Zebrafish DNA sequence from clone DKEYP-67E1 in linkage group 25,
              complete sequence
          Length = 181520

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 130569 atggatggatggatggatgcag 130548

to top

>dbj|AP003621.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0621D05
          Length = 180250

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 144946 atggatggatggatggatgcag 144925

to top

>emb|BX537304.14| Zebrafish DNA sequence from clone CH211-283H6 in linkage group 5,
             complete sequence
          Length = 157564

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 10658 atggatggatggatggatgcag 10679

to top

>dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0480E02
          Length = 141862

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 89610 tatggatggatggatggatgca 89589

to top

>dbj|AP005175.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBb0040H10
          Length = 132919

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 54048 atggatggatggatggatgcag 54027

to top

>dbj|AP004869.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0419A09
          Length = 168064

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 105428 atggatggatggatggatgcag 105407

to top

>emb|BX510306.17| Zebrafish DNA sequence from clone CH211-195F19 in linkage group 13,
              complete sequence
          Length = 194184

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 169500 tatggatggatggatggatgca 169521



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 169536 tatggatggatggatggatgca 169557

to top

>emb|BX005156.9| Zebrafish DNA sequence from clone CH211-165F21 in linkage group 8,
             complete sequence
          Length = 77418

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 407   tctatggatggatggatggatg 428
             ||||||||||||||||||||||
Sbjct: 28358 tctatggatggatggatggatg 28379

to top

>emb|BX530075.7| Zebrafish DNA sequence from clone CH211-1O14 in linkage group 5,
             complete sequence
          Length = 176078

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 93103 tatggatggatggatggatgca 93124



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 93362 tatggatggatggatggatgca 93383



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 92880 atggatggatggatggatgca 92900



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 93139 atggatggatggatggatgca 93159



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 93533 atggatggatggatggatgca 93553

to top

>dbj|AK070459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050G05, full
            insert sequence
          Length = 2513

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 407  tctatggatggatggatggatg 428
            ||||||||||||||||||||||
Sbjct: 2301 tctatggatggatggatggatg 2280

to top

>dbj|AK066531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074K13, full
           insert sequence
          Length = 2452

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 410 atggatggatggatggatgcag 431
           ||||||||||||||||||||||
Sbjct: 70  atggatggatggatggatgcag 49

to top

>emb|AL935146.13| Zebrafish DNA sequence from clone CH211-171D11 in linkage group 22,
              complete sequence
          Length = 161161

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 403    tatttctatggatggatggatggatg 428
              ||||| ||||||||||||||||||||
Sbjct: 128440 tatttttatggatggatggatggatg 128465

to top

>emb|BX004980.8| Zebrafish DNA sequence from clone DKEY-15N5 in linkage group 14,
            complete sequence
          Length = 159333

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 410  atggatggatggatggatgcag 431
            ||||||||||||||||||||||
Sbjct: 2987 atggatggatggatggatgcag 3008

to top

>emb|BX276117.5| Zebrafish DNA sequence from clone CH211-112K18 in linkage group 17,
             complete sequence
          Length = 181677

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 24368 atggatggatggatggatgcag 24389

to top

>emb|BX088594.5| Zebrafish DNA sequence from clone RP71-1G17 in linkage group 1, complete
              sequence
          Length = 144022

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 132122 atggatggatggatggatgcag 132143

to top

>gb|AC005155.1|AC005155 Homo sapiens PAC clone RP5-877J2 from 7p14-p15, complete sequence
          Length = 127282

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 63408 tatggatggatggatggatgca 63387

to top

>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102
          Length = 340000

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 39153 atggatggatggatggatgcag 39132

to top

>gb|AC138119.5| Mus musculus BAC clone RP23-307D8 from chromosome 5, complete sequence
          Length = 196908

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     cgccgccgccaccccccacccc 39
              ||||||||||||||||||||||
Sbjct: 134212 cgccgccgccaccccccacccc 134191

to top

>gb|AC113075.9| Mus musculus chromosome 19, clone RP23-278F24, complete sequence
          Length = 171837

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 410  atggatggatggatggatgcag 431
            ||||||||||||||||||||||
Sbjct: 5271 atggatggatggatggatgcag 5292



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 410  atggatggatggatggatgcag 431
            ||||||||||||||||||||||
Sbjct: 5307 atggatggatggatggatgcag 5328



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 410  atggatggatggatggatgcag 431
            ||||||||||||||||||||||
Sbjct: 5343 atggatggatggatggatgcag 5364

to top

>gb|AC151999.5| Mus musculus BAC clone RP23-98D11 from chromosome 8, complete sequence
          Length = 229414

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 218326 atggatggatggatggatgcag 218305

to top

>emb|AL928980.7| Zebrafish DNA sequence from clone DKEY-77M16 in linkage group 11,
              complete sequence
          Length = 167387

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 408    ctatggatggatggatggatgc 429
              ||||||||||||||||||||||
Sbjct: 116880 ctatggatggatggatggatgc 116859

to top

>emb|CR847901.7| Zebrafish DNA sequence from clone DKEY-215L17 in linkage group 10,
             complete sequence
          Length = 106274

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 406   ttctatggatggatggatggat 427
             ||||||||||||||||||||||
Sbjct: 77370 ttctatggatggatggatggat 77391

to top

>emb|CT010473.14| Mouse DNA sequence from clone RP23-238D5 on chromosome 17, complete
              sequence
          Length = 173998

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 407    tctatggatggatggatggatg 428
              ||||||||||||||||||||||
Sbjct: 105337 tctatggatggatggatggatg 105316

to top

>emb|AL935293.11| Zebrafish DNA sequence from clone CH211-251D10 in linkage group 10,
             complete sequence
          Length = 188908

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 16836 tatggatggatggatggatgca 16815



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 16803 atggatggatggatggatgca 16783

to top

>emb|AL928952.15| Zebrafish DNA sequence from clone CH211-225G23, complete sequence
          Length = 182212

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 407    tctatggatggatggatggatg 428
              ||||||||||||||||||||||
Sbjct: 153121 tctatggatggatggatggatg 153142

to top

>emb|BX322557.1|HS112E20 Homo sapiens chromosome 21 from PAC RP1-112E20 map 21q22.3 region
              D21S171-LA161, complete sequence
          Length = 124074

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 106370 atggatggatggatggatgcag 106349

to top

>gb|AC147545.3| Mus musculus BAC clone RP23-355L20 from 14, complete sequence
          Length = 211446

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 403    tatttctatggatggatggatggatg 428
              ||||| ||||||||||||||||||||
Sbjct: 206608 tatttgtatggatggatggatggatg 206583

to top

>emb|AL606967.14| Mouse DNA sequence from clone RP23-304D5 on chromosome 4, complete
              sequence
          Length = 188425

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 147355 atggatggatggatggatgcag 147376



 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1139   cttgtttttaatcttatcatat 1160
              ||||||||||||||||||||||
Sbjct: 183175 cttgtttttaatcttatcatat 183196

to top

>emb|AL606907.9| Mouse DNA sequence from clone RP23-230F2 on chromosome 4, complete
              sequence
          Length = 208265

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 410    atggatggatggatggatgcag 431
              ||||||||||||||||||||||
Sbjct: 116874 atggatggatggatggatgcag 116853

to top

>gb|U88310.1| Caenorhabditis elegans cosmid C24G7, complete sequence
          Length = 46996

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 410   atggatggatggatggatgcag 431
             ||||||||||||||||||||||
Sbjct: 14700 atggatggatggatggatgcag 14679

to top

>gb|AC156543.10| Mus musculus chromosome 15, clone RP23-220F2, complete sequence
          Length = 199715

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 407    tctatggatggatggatggatg 428
              ||||||||||||||||||||||
Sbjct: 157322 tctatggatggatggatggatg 157301

to top

>gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, complete sequence
          Length = 146301

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 409    tatggatggatggatggatgca 430
              ||||||||||||||||||||||
Sbjct: 141088 tatggatggatggatggatgca 141067



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 140256 atggatggatggatggatgca 140236



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 140536 atggatggatggatggatgca 140516



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 140667 atggatggatggatggatgca 140647



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 140939 atggatggatggatggatgca 140919



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 141051 atggatggatggatggatgca 141031



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 141251 atggatggatggatggatgca 141231

to top

>dbj|AB065701.1| Homo sapiens gene for seven transmembrane helix receptor, complete cds,
             isolate:CBRC7TM_264
          Length = 15576

 Score = 44.1 bits (22), Expect = 1.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 409   tatggatggatggatggatgca 430
             ||||||||||||||||||||||
Sbjct: 12936 tatggatggatggatggatgca 12915

to top

>gb|EF066619.1| Scarus rubroviolaceus clone Sru-C121 microsatellite sequence
          Length = 573

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 514 atggatggatggatggatgca 494

to top

>emb|CT963081.7| Zebrafish DNA sequence from clone CH73-194F15 in linkage group 12,
             complete sequence
          Length = 83456

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 20811 ctatggatggatggatggatg 20831

to top

>emb|CR376742.16| Zebrafish DNA sequence from clone CH211-207C17 in linkage group 24,
              complete sequence
          Length = 206722

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 101030 atggatggatggatggatgca 101050

to top

>gb|AC191886.2| Pan troglodytes chromosome X clone CH251-89D5 map human ortholog p11.3,
             complete sequence
          Length = 139932

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 97167 atggatggatggatggatgca 97187

to top

>emb|CT025894.23| Zebrafish DNA sequence from clone CH211-153A20 in linkage group 13,
             complete sequence
          Length = 175138

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 63523 atggatggatggatggatgca 63543

to top

>ref|XM_001016190.1| Tetrahymena thermophila SB210 Penicillin amidase family protein
            (TTHERM_00125110) mRNA, complete cds
          Length = 2640

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1039 agatgataaaaatcttgttgatgga 1063
            |||||||||| ||||||||||||||
Sbjct: 1122 agatgataaatatcttgttgatgga 1146

to top

>gb|AC192815.2| Pan troglodytes BAC clone CH251-56H1 from chromosome 7, complete
             sequence
          Length = 165704

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 32932 atggatggatggatggatgca 32952

to top

>gb|AC191655.2| Taeniopygia guttata BAC clone TGMCBa-26H12 from chromosome unknown,
            complete sequence
          Length = 127151

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 8655 atggatggatggatggatgca 8635

to top

>gb|DQ244258.1| Zea mays clone 3955 mRNA sequence
          Length = 889

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 76  atggatggatggatggatgca 56

to top

>emb|CR848683.9| Zebrafish DNA sequence from clone CH211-63I2 in linkage group 15,
              complete sequence
          Length = 161350

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 137187 atggatggatggatggatgca 137167

to top

>gb|AC192582.2| Pan troglodytes BAC clone CH251-599G11 from chromosome 11, complete
              sequence
          Length = 219063

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 131526 atggatggatggatggatgca 131506

to top

>emb|CR925740.26| Zebrafish DNA sequence from clone CH211-238G24 in linkage group 1,
             complete sequence
          Length = 179131

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 60647 atggatggatggatggatgca 60667

to top

>emb|CR318626.13| Zebrafish DNA sequence from clone DKEY-29L7 in linkage group 7, complete
              sequence
          Length = 233344

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 179268 atggatggatggatggatgca 179248

to top

>emb|CR847968.17| Zebrafish DNA sequence from clone CH211-203D7 in linkage group 12,
             complete sequence
          Length = 155707

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 67335 atggatggatggatggatgca 67315

to top

>gb|AC190425.2| Pan troglodytes chromosome X clone CH251-240E16 map human ortholog
             p11.3, complete sequence
          Length = 169607

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 45821 atggatggatggatggatgca 45841

to top

>gb|CP000473.1| Solibacter usitatus Ellin6076, complete genome
          Length = 9965640

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 8      cctcgcgcatcgccgccgcca 28
              |||||||||||||||||||||
Sbjct: 946860 cctcgcgcatcgccgccgcca 946840

to top

>emb|CR356235.15| Zebrafish DNA sequence from clone DKEY-14H16 in linkage group 25,
             complete sequence
          Length = 101619

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 34236 ctatggatggatggatggatg 34256

to top

>emb|CR752641.12| Zebrafish DNA sequence from clone DKEY-1P18 in linkage group 25,
             complete sequence
          Length = 238675

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 60153 atggatggatggatggatgca 60173

to top

>emb|CR926460.7| Zebrafish DNA sequence from clone DKEY-222P23 in linkage group 6,
             complete sequence
          Length = 26686

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 11465 atggatggatggatggatgca 11485

to top

>emb|CR940365.20| Zebrafish DNA sequence from clone CH211-199H19 in linkage group 2,
              complete sequence
          Length = 183723

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 161821 atggatggatggatggatgca 161801

to top

>emb|CR388022.12| Zebrafish DNA sequence from clone CH211-183H23 in linkage group 25,
             complete sequence
          Length = 175540

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 80407 atggatggatggatggatgca 80387

to top

>gb|DQ227283.1| Canis familiaris developmental myosin heavy chain neonatal gene,
            complete cds
          Length = 27299

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 1530 ttcaataatattttcagaggaagag 1554
            ||||| |||||||||||||||||||
Sbjct: 1885 ttcaaaaatattttcagaggaagag 1861

to top

>emb|CR376862.18| Zebrafish DNA sequence from clone DKEY-90K7 in linkage group 20, complete
              sequence
          Length = 180428

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 115601 atggatggatggatggatgca 115581

to top

>emb|CR753862.32| Zebrafish DNA sequence from clone DKEY-165L22 in linkage group 9,
             complete sequence
          Length = 201337

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 57465 atggatggatggatggatgca 57485

to top

>emb|CR387991.18| Zebrafish DNA sequence from clone CH211-285C3 in linkage group 6,
             complete sequence
          Length = 137472

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 17871 atggatggatggatggatgca 17891

to top

>emb|CR854923.7| Zebrafish DNA sequence from clone CH211-170J16 in linkage group 25,
             complete sequence
          Length = 77085

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 21634 atggatggatggatggatgca 21654

to top

>gb|DQ866809.1| Homo sapiens endoglin (Osler-Rendu-Weber syndrome 1) (ENG) gene,
             complete cds
          Length = 43713

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 18943 atggatggatggatggatgca 18963

to top

>emb|CR383675.13| Zebrafish DNA sequence from clone DKEYP-10D4 in linkage group 21,
             complete sequence
          Length = 155653

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 49746 ctatggatggatggatggatg 49766

to top

>emb|CR926461.10| Zebrafish DNA sequence from clone DKEY-246B13, complete sequence
          Length = 164056

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 140828 atggatggatggatggatgca 140848



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 141029 atggatggatggatggatgca 141049

to top

>emb|CR749751.11| Zebrafish DNA sequence from clone DKEY-24H18 in linkage group 12,
              complete sequence
          Length = 219731

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1188   atatgaactttttggaagtgc 1208
              |||||||||||||||||||||
Sbjct: 176124 atatgaactttttggaagtgc 176104

to top

>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence
          Length = 21146708

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 410     atggatggatggatggatgca 430
               |||||||||||||||||||||
Sbjct: 8973745 atggatggatggatggatgca 8973765



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 410     atggatggatggatggatgca 430
               |||||||||||||||||||||
Sbjct: 8988454 atggatggatggatggatgca 8988434



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 410      atggatggatggatggatgcagttc 434
                ||||||||||||||||||| |||||
Sbjct: 16112500 atggatggatggatggatggagttc 16112524

to top

>emb|CT868708.10| Zebrafish DNA sequence from clone DKEY-257I7 in linkage group 4,
            complete sequence
          Length = 75079

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 408  ctatggatggatggatggatg 428
            |||||||||||||||||||||
Sbjct: 4938 ctatggatggatggatggatg 4958

to top

>emb|CR678488.7| Zebrafish DNA sequence from clone DKEY-220D15 in linkage group 23,
            complete sequence
          Length = 49603

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 1544 atggatggatggatggatgca 1524

to top

>emb|BX571679.38| Zebrafish DNA sequence from clone DKEYP-10C7 in linkage group 23,
              complete sequence
          Length = 171155

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 130992 atggatggatggatggatgca 130972

to top

>gb|AC164658.4| Pan troglodytes BAC clone CH251-155M18 from chromosome 11, complete
             sequence
          Length = 171828

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 31221 atggatggatggatggatgca 31201

to top

>emb|CR559931.20| Zebrafish DNA sequence from clone DKEY-33G10 in linkage group 11,
              complete sequence
          Length = 210732

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 132297 atggatggatggatggatgca 132317

to top

>gb|AC188788.1| Homo sapiens chromosome 3 clone ABC8_000043775400_J6, complete sequence
          Length = 32410

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 12893 atggatggatggatggatgca 12873



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 12981 atggatggatggatggatgca 12961



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 13073 atggatggatggatggatgca 13053

to top

>emb|CR932059.8| Zebrafish DNA sequence from clone DKEYP-67G8 in linkage group 12,
            complete sequence
          Length = 106170

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 408  ctatggatggatggatggatg 428
            |||||||||||||||||||||
Sbjct: 2895 ctatggatggatggatggatg 2915

to top

>emb|CR974425.13| Zebrafish DNA sequence from clone CH73-189A7 in linkage group 22,
             complete sequence
          Length = 108280

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 75317 atggatggatggatggatgca 75297

to top

>emb|CT030634.12| Mouse DNA sequence from clone RP23-6A14 on chromosome 14, complete
             sequence
          Length = 209296

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 36050 atggatggatggatggatgca 36070

to top

>emb|CT009601.13| Mouse DNA sequence from clone RP23-38D2 on chromosome 14, complete
              sequence
          Length = 223345

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 203254 atggatggatggatggatgca 203234

to top

>gb|AC182553.2| Mus musculus BAC clone RP24-560H20 from chromosome y, complete sequence
          Length = 145752

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 18781 atggatggatggatggatgca 18801

to top

>emb|BX936377.17| Zebrafish DNA sequence from clone DKEY-149J2 in linkage group 17,
              complete sequence
          Length = 129573

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 115657 atggatggatggatggatgca 115677

to top

>gb|DQ229107.1| Chara vulgaris chloroplast, complete genome
          Length = 184933

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1140  ttgtttttaatcttatcatatttcg 1164
             ||||||||||||||||| |||||||
Sbjct: 55614 ttgtttttaatcttatcttatttcg 55638

to top

>emb|CR385031.17| Zebrafish DNA sequence from clone DKEY-16K12 in linkage group 10,
            complete sequence
          Length = 174515

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1188 atatgaactttttggaagtgc 1208
            |||||||||||||||||||||
Sbjct: 5417 atatgaactttttggaagtgc 5397

to top

>emb|BX897691.14| Zebrafish DNA sequence from clone DKEY-168E3 in linkage group 7, complete
              sequence
          Length = 207478

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1188   atatgaactttttggaagtgc 1208
              |||||||||||||||||||||
Sbjct: 161644 atatgaactttttggaagtgc 161624

to top

>emb|CR936518.13| Zebrafish DNA sequence from clone DKEY-27E18 in linkage group 7,
             complete sequence
          Length = 283397

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 59857 atggatggatggatggatgca 59877

to top

>emb|CR558302.9| Zebrafish DNA sequence from clone DKEY-33M11 in linkage group 11,
              complete sequence
          Length = 199875

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 180442 atggatggatggatggatgca 180462

to top

>emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in linkage group 8,
             complete sequence
          Length = 163766

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 16852 ctatggatggatggatggatg 16832



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 408   ctatggatggatggatggatg 428
             |||||||||||||||||||||
Sbjct: 17086 ctatggatggatggatggatg 17066



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 100398 atggatggatggatggatgca 100418

to top

>gb|DQ182353.1| Carduelis tristis microsatellite CtC117 sequence
          Length = 454

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 269 atggatggatggatggatgca 249

to top

>gb|AC183833.2| Pan troglodytes BAC clone CH251-141C5 from chromosome 7, complete
             sequence
          Length = 155911

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 60085 atggatggatggatggatgca 60065



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 60269 atggatggatggatggatgca 60249

to top

>gb|AC183385.3| Pan troglodytes BAC clone CH251-277F20 from chromosome 7, complete
              sequence
          Length = 148939

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 127020 atggatggatggatggatgca 127000

to top

>gb|AC183680.3| Pan troglodytes BAC clone CH251-425K14 from chromosome 9, complete
              sequence
          Length = 163619

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 108634 atggatggatggatggatgca 108654

to top

>gb|AC148932.3| Pan troglodytes BAC clone CH251-571G8 from chromosome 7, complete
            sequence
          Length = 232604

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 7703 atggatggatggatggatgca 7723

to top

>gb|AC152001.3| Ornithorhynchus anatinus BAC clone OABb-256A1 from chromosome unknown,
              complete sequence
          Length = 162942

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 116885 atggatggatggatggatgca 116905

to top

>emb|CR450684.10| Zebrafish DNA sequence from clone DKEY-60D5 in linkage group 10,
             complete sequence
          Length = 121080

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 11781 atggatggatggatggatgca 11761

to top

>gb|DQ483432.1| Gymnogyps californianus contig 135H microsatellite sequence
          Length = 538

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 298 atggatggatggatggatgca 278

to top

>gb|DQ483387.1| Gymnogyps californianus contig 90H microsatellite sequence
          Length = 534

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 298 atggatggatggatggatgca 278

to top

>gb|DQ483327.1| Gymnogyps californianus contig 30H microsatellite sequence
          Length = 388

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 263 atggatggatggatggatgca 243

to top

>emb|CR847999.10| Zebrafish DNA sequence from clone DKEY-216M6 in linkage group 11,
              complete sequence
          Length = 192191

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 103153 atggatggatggatggatgca 103133

to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 8       cctcgcgcatcgccgccgcca 28
               |||||||||||||||||||||
Sbjct: 1723168 cctcgcgcatcgccgccgcca 1723148

to top

>emb|CR388184.33| Zebrafish DNA sequence from clone CH211-261O3 in linkage group 8,
              complete sequence
          Length = 180216

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 105551 atggatggatggatggatgca 105531

to top

>emb|BX901950.7| Zebrafish DNA sequence from clone DKEY-111C4 in linkage group 6,
             complete sequence
          Length = 146043

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 60419 atggatggatggatggatgca 60439



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 60591 atggatggatggatggatgca 60611



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 61167 atggatggatggatggatgca 61187



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 61359 atggatggatggatggatgca 61379

to top

>emb|CR925738.6| Zebrafish DNA sequence from clone DKEY-164G12 in linkage group 10,
             complete sequence
          Length = 155003

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 44078 atggatggatggatggatgca 44098

to top

>gb|AC175467.3| Pan troglodytes BAC clone CH251-302C22 from chromosome unknown,
             complete sequence
          Length = 186532

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 94875 atggatggatggatggatgca 94855

to top

>emb|CR388144.17| Zebrafish DNA sequence from clone DKEY-21I17 in linkage group 14,
              complete sequence
          Length = 211706

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 139811 atggatggatggatggatgca 139831

to top

>gb|AC183302.2| Pan troglodytes BAC clone CH251-258O5 from chromosome unknown,
            complete sequence
          Length = 211208

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 5635 atggatggatggatggatgca 5655

to top

>emb|CR381592.4| Zebrafish DNA sequence from clone CH211-94B7 in linkage group 7,
           complete sequence
          Length = 116100

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 933 atggatggatggatggatgca 913

to top

>emb|CR376776.19| Zebrafish DNA sequence from clone CH211-13I23, complete sequence
          Length = 179675

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 8851 atggatggatggatggatgca 8831

to top

>gb|AC163102.5| Mus musculus chromosome 18, clone RP23-270E10, complete sequence
          Length = 179127

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 14120 atggatggatggatggatgca 14100

to top

>gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, complete sequence
          Length = 187760

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 166738 atggatggatggatggatgca 166758

to top

>gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, complete sequence
          Length = 190294

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 90135 atggatggatggatggatgca 90155

to top

>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 26804 atggatggatggatggatgca 26824



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 160332 atggatggatggatggatgca 160312

to top

>gb|AC159318.4| Mus musculus BAC clone RP23-76M13 from chromosome 12, complete sequence
          Length = 269200

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 690    ctgagacttgcctgcctccta 710
              |||||||||||||||||||||
Sbjct: 129321 ctgagacttgcctgcctccta 129341

to top

>gb|AC151980.3| Mus musculus BAC clone RP24-83M3 from chromosome 8, complete sequence
          Length = 253457

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 9154 atggatggatggatggatgca 9174

to top

>gb|AC164085.3| Mus musculus BAC clone RP23-205G24 from chromosome 5, complete sequence
          Length = 235124

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 72418 atggatggatggatggatgca 72398

to top

>gb|DQ223122.1| Alasmidonta heterodon microsatellite AheC5 sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 atggatggatggatggatgca 430
           |||||||||||||||||||||
Sbjct: 235 atggatggatggatggatgca 215

to top

>gb|AC169122.1| Mus musculus BAC clone RP23-167K9 from chromosome 17, complete sequence
          Length = 127115

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 34268 atggatggatggatggatgca 34288

to top

>gb|AC110913.13| Mus musculus chromosome 19, clone RP24-399E19, complete sequence
          Length = 208309

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 404   atttctatggatggatggatggatg 428
             ||||| |||||||||||||||||||
Sbjct: 65647 atttcaatggatggatggatggatg 65623

to top

>gb|AC100927.11| Mus musculus chromosome 3, clone RP23-72A21, complete sequence
          Length = 196709

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 53747 atggatggatggatggatgca 53727



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 53811 atggatggatggatggatgca 53791

to top

>gb|AC125068.4| Mus musculus chromosome UNKNOWN clone RP23-432M17, complete sequence
          Length = 205831

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 57474 atggatggatggatggatgca 57494

to top

>gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, complete sequence
          Length = 215514

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 109775 atggatggatggatggatgca 109755

to top

>gb|AC003057.1| Mouse Cosmid ma08m030 from 14D1-D2, complete sequence
          Length = 33608

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 20864 atggatggatggatggatgca 20884

to top

>gb|AC137842.8| Mus musculus chromosome 15, clone RP23-91M6, complete sequence
          Length = 230609

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 180834 atggatggatggatggatgca 180854

to top

>gb|AC126035.4| Mus musculus chromosome UNKNOWN clone RP24-122B7, complete sequence
          Length = 211301

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 187887 atggatggatggatggatgca 187907

to top

>gb|AC160995.4| Mus musculus BAC clone RP23-96D5 from chromosome 13, complete sequence
          Length = 235237

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 86491 atggatggatggatggatgca 86511

to top

>gb|AC101991.9| Mus musculus chromosome 1, clone RP24-372E16, complete sequence
          Length = 135000

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 132510 atggatggatggatggatgca 132530

to top

>gb|AC116781.9| Mus musculus chromosome 16, clone RP24-134G20, complete sequence
          Length = 166568

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 165486 atggatggatggatggatgca 165506

to top

>gb|AC101672.11| Mus musculus chromosome 5, clone RP23-115F16, complete sequence
          Length = 204025

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 164294 atggatggatggatggatgca 164314

to top

>gb|AC138359.8| Mus musculus chromosome 1, clone RP24-383H12, complete sequence
          Length = 217891

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 22780 atggatggatggatggatgca 22760

to top

>gb|AY723871.1| Saccharomyces cerevisiae clone FLH006989.01X YPR162C gene, complete
            cds
          Length = 1590

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1418 attcatggcagtgaagaaaaa 1438
            |||||||||||||||||||||
Sbjct: 469  attcatggcagtgaagaaaaa 489

to top

>gb|AC134933.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05,
             complete sequence
          Length = 107407

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   atggatggatggatggatgca 430
             |||||||||||||||||||||
Sbjct: 13532 atggatggatggatggatgca 13552

to top

>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence
          Length = 179251

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 173372 atggatggatggatggatgca 173392



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 173468 atggatggatggatggatgca 173488



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 173580 atggatggatggatggatgca 173600



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 173648 atggatggatggatggatgca 173668



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 173760 atggatggatggatggatgca 173780



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 173796 atggatggatggatggatgca 173816



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 173932 atggatggatggatggatgca 173952



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 174060 atggatggatggatggatgca 174080



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 174179 atggatggatggatggatgca 174199



 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    atggatggatggatggatgca 430
              |||||||||||||||||||||
Sbjct: 174275 atggatggatggatggatgca 174295

to top

>gb|AC110499.19| Mus musculus chromosome 1, clone RP23-202J6, complete sequence
          Length = 212282

 Score = 42.1 bits (21), Expect = 6.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  atggatggatggatggatgca 430
            |||||||||||||||||||||
Sbjct: 4339 atggatggatggatggatgca 4319


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 286,293,176
Number of extensions: 17677122
Number of successful extensions: 688127
Number of sequences better than 10.0: 966
Number of HSP's gapped: 686830
Number of HSP's successfully gapped: 1294
Length of query: 1569
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1546
Effective length of database: 18,503,978,556
Effective search space: 28607150847576
Effective search space used: 28607150847576
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result