ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf157k15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY109110.1| Zea mays PCO118045 mRNA sequence 476 e-131
2ref|NM_001054735.1| Oryza sativa (japonica cultivar-group) Os02g... 289 8e-75
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 289 8e-75
4dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic D... 289 8e-75
5dbj|AK059956.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 8e-75
6dbj|AK058782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 8e-75
7emb|CT828155.1| Oryza sativa (indica cultivar-group) cDNA clone:... 272 2e-69
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 194 4e-46
9dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic D... 194 4e-46
10dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 194 4e-46
11emb|CT837718.1| Oryza sativa (indica cultivar-group) cDNA clone:... 167 8e-38
12ref|NM_001050638.1| Oryza sativa (japonica cultivar-group) Os01g... 165 3e-37
13ref|NM_001054736.1| Oryza sativa (japonica cultivar-group) Os02g... 155 3e-34
14dbj|AK068833.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 3e-34
15dbj|AK059923.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 3e-34
16emb|CT837687.1| Oryza sativa (indica cultivar-group) cDNA clone:... 100 2e-17
17gb|AY105094.1| Zea mays PCO088415 mRNA sequence 84 9e-13
18gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 68 5e-08
19gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 64 9e-07
20gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 64 9e-07
21emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 64 9e-07
22gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 64 9e-07
23ref|NM_121650.2| Arabidopsis thaliana unknown protein (AT5G16450... 58 5e-05
24ref|NM_180499.1| Arabidopsis thaliana unknown protein (AT5G16450... 58 5e-05
25gb|AY085206.1| Arabidopsis thaliana clone 13819 mRNA, complete s... 58 5e-05
26gb|BT005566.1| Arabidopsis thaliana clone U51333 unknown protein... 58 5e-05
27dbj|AK118745.1| Arabidopsis thaliana At5g16450 mRNA for putative... 58 5e-05
28dbj|AB005242.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 5e-05
29gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 52 0.003
30ref|NM_111145.2| Arabidopsis thaliana unknown protein (AT3G02770... 50 0.013
31gb|AC018363.8|ATAC018363 Arabidopsis thaliana chromosome III BAC... 50 0.013
32gb|AY086886.1| Arabidopsis thaliana clone 29093 mRNA, complete s... 50 0.013
33dbj|AK176633.1| Arabidopsis thaliana mRNA for putative S-adenosy... 50 0.013
34emb|BX825804.1|CNS0A6AA Arabidopsis thaliana Full-length cDNA Co... 50 0.013
35emb|AM261760.1| IncP-1alpha plasmid pBS228, complete sequence 46 0.20
36emb|AM260479.1| Ralstonia eutropha H16 chromosome 1 46 0.20
37gb|AY741093.1| Integration vector pJK202, complete sequence 46 0.20
38gb|AF327712.1| Cloning vector pRK310, complete sequence 46 0.20
39emb|AJ744860.1| uncultured bacterium pTB11 plasmid complete genome 46 0.20
40dbj|AB027255.2| Cloning vector pSB1 tetR, tetA genes with Agroba... 46 0.20
41dbj|AB201314.1| Cloning vector pSB4U DNA, complete sequence 46 0.20
42gb|AY218787.1| Cloning vector pAJ1, complete sequence 46 0.20
43emb|Y00448.1|PRK2KORB Plasmid RK2 korB gene involved in regulati... 46 0.20
44emb|X06543.1|KAPLKORB Klebsiella aerogenes plasmid RK2 korB gene... 46 0.20
45gb|AY532632.1| Cloning vector pLAFR, complete sequence 46 0.20
46dbj|AB027254.1| Cloning vector pSB4 tetR, tetA, hygromycin resis... 46 0.20
47gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence 46 0.20
48gb|L27758.1|BIACOMGEN Birmingham IncP-alpha plasmid (R18, R68, R... 46 0.20
49ref|XM_415815.2| PREDICTED: Gallus gallus similar to MGC80576 pr... 44 0.79
50emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 44 0.79
51gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, co... 44 0.79
52dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.79
53gb|AC019103.8| Homo sapiens BAC clone RP11-460I19 from 4, comple... 44 0.79
54gb|AC015535.11| Mus musculus chromosome 5, clone RP23-39M18, com... 44 0.79
55emb|AL837527.2|CNS08CAQ Oryza sativa chromosome 12, . BAC OSJNBb... 44 0.79
56gb|CP000479.1| Mycobacterium avium 104, complete genome 42 3.1
57gb|CP000459.1| Burkholderia cenocepacia HI2424 chromosome 2, com... 42 3.1
58ref|XM_001227389.1| Chaetomium globosum CBS 148.51 predicted pro... 42 3.1
59gb|DQ398041.1| Mycobacteriophage 244, complete genome 42 3.1
60gb|BC063738.1| Xenopus laevis hypothetical protein MGC68772, mRN... 42 3.1
61dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 42 3.1
62gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 42 3.1
63gb|AC025575.21| Homo sapiens 12 BAC RP11-934P3 (Roswell Park Can... 42 3.1
64dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 3.1
65dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 3.1
66emb|BX071178.1|CNS09R32 Single read from an extremity of a full-... 42 3.1
67emb|BX071177.1|CNS09R31 Single read from an extremity of a full-... 42 3.1
68emb|BX070151.1|CNS09QAJ Single read from an extremity of a full-... 42 3.1
69emb|BX067977.1|CNS09OM5 Single read from an extremity of a full-... 42 3.1
70emb|BX067976.1|CNS09OM4 Single read from an extremity of a full-... 42 3.1
71emb|BX065571.1|CNS09MRB Single read from an extremity of a full-... 42 3.1
72emb|BX065570.1|CNS09MRA Single read from an extremity of a full-... 42 3.1
73emb|BX063486.1|CNS09L5E Single read from an extremity of a full-... 42 3.1
74emb|BX062889.1|CNS09KOT Single read from an extremity of a full-... 42 3.1
75emb|BX055879.1|CNS09FA3 Single read from an extremity of a full-... 42 3.1
76emb|BX055878.1|CNS09FA2 Single read from an extremity of a full-... 42 3.1
77emb|BX052026.1|CNS09CB2 Single read from an extremity of a full-... 42 3.1
78emb|BX052018.1|CNS09CAU Single read from an extremity of a full-... 42 3.1
79emb|BX049735.1|CNS09AJF Single read from an extremity of a full-... 42 3.1
80emb|BX048137.1|CNS099B1 Single read from an extremity of a full-... 42 3.1
81emb|BX048136.1|CNS099B0 Single read from an extremity of a full-... 42 3.1
82emb|BX041708.1|CNS094CG Single read from an extremity of a full-... 42 3.1
83emb|BX041707.1|CNS094CF Single read from an extremity of a full-... 42 3.1
84emb|BX040627.1|CNS093IF Single read from an extremity of a full-... 42 3.1
85emb|BX037638.1|CNS0917E Single read from an extremity of a full-... 42 3.1
86emb|BX031711.1|CNS08WMR Single read from an extremity of a full-... 42 3.1
87emb|BX031710.1|CNS08WMQ Single read from an extremity of a full-... 42 3.1
88gb|AY129331.1| Mycobacteriophage CJW1, complete genome 42 3.1
89emb|BX018527.1|CNS08MGJ Single read from an extremity of a full-... 42 3.1
90emb|BX016186.1|CNS08KNI Single read from an extremity of a full-... 42 3.1
91emb|BX016185.1|CNS08KNH Single read from an extremity of a full-... 42 3.1
92emb|BX015329.1|CNS08JZP Single read from an extremity of a full-... 42 3.1
93emb|BX012465.1|CNS08HS5 Single read from an extremity of a full-... 42 3.1
94emb|BX012464.1|CNS08HS4 Single read from an extremity of a full-... 42 3.1
95gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 3.1
96emb|BX640447.1| Bordetella bronchiseptica strain RB50, complete ... 42 3.1
97emb|BX640428.1| Bordetella parapertussis strain 12822, complete ... 42 3.1
98emb|BX640414.1| Bordetella pertussis strain Tohama I, complete g... 42 3.1
99dbj|AP005605.3| Oryza sativa (japonica cultivar-group) genomic D... 42 3.1
100dbj|AP004995.3| Oryza sativa (japonica cultivar-group) genomic D... 42 3.1
101dbj|AP004994.2| Oryza sativa (japonica cultivar-group) genomic D... 42 3.1
102ref|XM_315431.2| Anopheles gambiae str. PEST ENSANGP00000007022 ... 42 3.1
103gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 42 3.1
104gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 42 3.1

>gb|AY109110.1| Zea mays PCO118045 mRNA sequence
          Length = 790
 Score =  476 bits (240), Expect = e-131
 Identities = 429/492 (87%)
 Strand = Plus / Plus

                                                                       
Query: 172 tatggcggccttgccattggccacggcggaagtctgtgacgccaactcgcacctgatcac 231
           |||||| ||| ||||| ||||||| || ||||| || ||||| ||| | |||||||||| 
Sbjct: 132 tatggctgccctgccactggccaccgccgaagtatgcgacgctaaccctcacctgatcat 191

                                                                       
Query: 232 cggcggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtctt 291
              |||||||||||| |||||||||||||||||||||||||||||  |||| ||||||||
Sbjct: 192 gaacggcgagctccgcgcgctccagccaatcttccagatctacggacggcgccaggtctt 251

                                                                       
Query: 292 cgcagggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcct 351
           ||| || |||||||| ||||||||||| |  ||||||||||| || || |||||||||||
Sbjct: 252 cgccggccccatcgtcacgctcaaggtctacgaggacaacgtcctggtccgcgagttcct 311

                                                                       
Query: 352 ggaggagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgc 411
            |||||||| ||||| || ||||| || ||||| ||||||||||||||| |||| |||||
Sbjct: 312 cgaggagaaaggccacggtagggtcctcgtggtcgacggcggcggcagcatgcgctgcgc 371

                                                                       
Query: 412 catcctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgt 471
           |||||| ||||||||||||||||||||||||||||||||||||||||| || ||| | ||
Sbjct: 372 catccttggcggcaaccccgtccagcaggcgcagaacaacgggtgggctggtatcctggt 431

                                                                       
Query: 472 gaacggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccct 531
            |||||||||||| |||||||||| ||||||||||| ||||||||||| || || || ||
Sbjct: 432 caacggctgcatcagggacgtggatgagatcaacggctgcgacatcggtgtccgggctct 491

                                                                       
Query: 532 caactcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcac 591
           || ||| ||||| |||||||||||||||||||| ||||||||||||||||||||| ||| 
Sbjct: 492 cagctcgcaccctatgaaggccaacaagaaggggatgggcgagaagcacgtccccgtcaa 551

                                                                       
Query: 592 catcgcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatggcatcct 651
           |||||| || ||| |||| ||||||||||||||||||||||||||  |||||||||| ||
Sbjct: 552 catcgctggaaccaggatttgcgacggcgagtggctctacgccgatcccgatggcattct 611

                       
Query: 652 ggtctccaggac 663
            |||||||||||
Sbjct: 612 tgtctccaggac 623



to top

>ref|NM_001054735.1| Oryza sativa (japonica cultivar-group) Os02g0761900 (Os02g0761900)
           mRNA, complete cds
          Length = 917

 Score =  289 bits (146), Expect = 8e-75
 Identities = 344/410 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgca 295
           |||||||| || || ||||||||  |||||||  ||||||| ||||||||||| ||||| 
Sbjct: 350 ggcgagcttcgtgctctccagcccgtcttccaagtctacggaaggcggcaggttttcgcc 409

                                                                       
Query: 296 gggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggag 355
           || || ||||||||||| ||||| |  |||||||| ||||| || |||||||||||||||
Sbjct: 410 ggccctatcgtgacgctgaaggtctacgaggacaatgttcttgttcgcgagttcctggag 469

                                                                       
Query: 356 gagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccatc 415
           ||||||||||| |||||||| || ||||| || || || || ||||||||||||||||| 
Sbjct: 470 gagaagggccaaggcagggttctcgtggtcgatggtggtgggagcctgcggtgcgccatt 529

                                                                       
Query: 416 ctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaac 475
            |||| |||||||| || ||||||||||||||||| |||||||| ||||||||||| || 
Sbjct: 530 ttgggtggcaaccctgtgcagcaggcgcagaacaatgggtgggctggcatcgtcgtcaat 589

                                                                       
Query: 476 ggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaac 535
           || |||||| |||||||||| |||||||| || |||||||| || || || || || |||
Sbjct: 590 ggttgcatcagggacgtggatgagatcaatggctgcgacattggtgtccgagctctgaac 649

                                                                       
Query: 536 tcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcaccatc 595
           || ||||| ||||| || |||||||||||||| || |||||||| || ||  | ||||| 
Sbjct: 650 tcgcaccctatgaaagcaaacaagaagggcatcggggagaagcatgtgcctgtgaccatt 709

                                                             
Query: 596 gcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatgg 645
           || || ||| |||| |||||||| ||||||||||||||||| || |||||
Sbjct: 710 gcagggaccaggatttgcgacggggagtggctctacgccgatactgatgg 759



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score =  289 bits (146), Expect = 8e-75
 Identities = 344/410 (83%)
 Strand = Plus / Minus

                                                                            
Query: 236      ggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgca 295
                |||||||| || || ||||||||  |||||||  ||||||| ||||||||||| ||||| 
Sbjct: 32107191 ggcgagcttcgtgctctccagcccgtcttccaagtctacggaaggcggcaggttttcgcc 32107132

                                                                            
Query: 296      gggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggag 355
                || || ||||||||||| ||||| |  |||||||| ||||| || |||||||||||||||
Sbjct: 32107131 ggccctatcgtgacgctgaaggtctacgaggacaatgttcttgttcgcgagttcctggag 32107072

                                                                            
Query: 356      gagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccatc 415
                ||||||||||| |||||||| || ||||| || || || || ||||||||||||||||| 
Sbjct: 32107071 gagaagggccaaggcagggttctcgtggtcgatggtggtgggagcctgcggtgcgccatt 32107012

                                                                            
Query: 416      ctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaac 475
                 |||| |||||||| || ||||||||||||||||| |||||||| ||||||||||| || 
Sbjct: 32107011 ttgggtggcaaccctgtgcagcaggcgcagaacaatgggtgggctggcatcgtcgtcaat 32106952

                                                                            
Query: 476      ggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaac 535
                || |||||| |||||||||| |||||||| || |||||||| || || || || || |||
Sbjct: 32106951 ggttgcatcagggacgtggatgagatcaatggctgcgacattggtgtccgagctctgaac 32106892

                                                                            
Query: 536      tcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcaccatc 595
                || ||||| ||||| || |||||||||||||| || |||||||| || ||  | ||||| 
Sbjct: 32106891 tcgcaccctatgaaagcaaacaagaagggcatcggggagaagcatgtgcctgtgaccatt 32106832

                                                                  
Query: 596      gcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatgg 645
                || || ||| |||| |||||||| ||||||||||||||||| || |||||
Sbjct: 32106831 gcagggaccaggatttgcgacggggagtggctctacgccgatactgatgg 32106782



 Score =  155 bits (78), Expect = 3e-34
 Identities = 222/270 (82%)
 Strand = Plus / Minus

                                                                            
Query: 235      cggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgc 294
                |||||||||||| || ||||  || |||||| | |||||||||||||||||||| |||||
Sbjct: 32111817 cggcgagctccgcgccctccctcccatcttcaaaatctacgggaggcggcaggttttcgc 32111758

                                                                            
Query: 295      agggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctgga 354
                 || ||  ||| |||| | |||||||| ||||||||||| || || |||||| ||||  |
Sbjct: 32111757 cggcccagtcgcgacggtgaaggtgttcgaggacaacgtgctggtccgcgagctcctcca 32111698

                                                                            
Query: 355      ggagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccat 414
                ||||||||| || ||| ||||||| || || |||||||| || ||| |||| |||||| |
Sbjct: 32111697 ggagaagggacatggccgggtgctcgtcgtcgacggcggtggtagcgtgcgctgcgccct 32111638

                                                                            
Query: 415      cctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaa 474
                | |||||||||||| ||  |||| |||||||| ||| || ||||  ||||||||||| ||
Sbjct: 32111637 cttgggcggcaacctcgcgcagctggcgcagatcaatggatgggtcggcatcgtcgtcaa 32111578

                                              
Query: 475      cggctgcatccgggacgtggacgagatcaa 504
                 ||||||||| |||| ||||| ||||||||
Sbjct: 32111577 tggctgcatcagggatgtggatgagatcaa 32111548



 Score = 48.1 bits (24), Expect = 0.051
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 606      ggatctgcgacggcgagtggctctacgc 633
                |||| |||||||||||||||||||||||
Sbjct: 32111446 ggatttgcgacggcgagtggctctacgc 32111419



to top

>dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0486G03
          Length = 146713

 Score =  289 bits (146), Expect = 8e-75
 Identities = 344/410 (83%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgca 295
             |||||||| || || ||||||||  |||||||  ||||||| ||||||||||| ||||| 
Sbjct: 43847 ggcgagcttcgtgctctccagcccgtcttccaagtctacggaaggcggcaggttttcgcc 43788

                                                                         
Query: 296   gggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggag 355
             || || ||||||||||| ||||| |  |||||||| ||||| || |||||||||||||||
Sbjct: 43787 ggccctatcgtgacgctgaaggtctacgaggacaatgttcttgttcgcgagttcctggag 43728

                                                                         
Query: 356   gagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccatc 415
             ||||||||||| |||||||| || ||||| || || || || ||||||||||||||||| 
Sbjct: 43727 gagaagggccaaggcagggttctcgtggtcgatggtggtgggagcctgcggtgcgccatt 43668

                                                                         
Query: 416   ctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaac 475
              |||| |||||||| || ||||||||||||||||| |||||||| ||||||||||| || 
Sbjct: 43667 ttgggtggcaaccctgtgcagcaggcgcagaacaatgggtgggctggcatcgtcgtcaat 43608

                                                                         
Query: 476   ggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaac 535
             || |||||| |||||||||| |||||||| || |||||||| || || || || || |||
Sbjct: 43607 ggttgcatcagggacgtggatgagatcaatggctgcgacattggtgtccgagctctgaac 43548

                                                                         
Query: 536   tcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcaccatc 595
             || ||||| ||||| || |||||||||||||| || |||||||| || ||  | ||||| 
Sbjct: 43547 tcgcaccctatgaaagcaaacaagaagggcatcggggagaagcatgtgcctgtgaccatt 43488

                                                               
Query: 596   gcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatgg 645
             || || ||| |||| |||||||| ||||||||||||||||| || |||||
Sbjct: 43487 gcagggaccaggatttgcgacggggagtggctctacgccgatactgatgg 43438



 Score =  155 bits (78), Expect = 3e-34
 Identities = 222/270 (82%)
 Strand = Plus / Minus

                                                                         
Query: 235   cggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgc 294
             |||||||||||| || ||||  || |||||| | |||||||||||||||||||| |||||
Sbjct: 48473 cggcgagctccgcgccctccctcccatcttcaaaatctacgggaggcggcaggttttcgc 48414

                                                                         
Query: 295   agggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctgga 354
              || ||  ||| |||| | |||||||| ||||||||||| || || |||||| ||||  |
Sbjct: 48413 cggcccagtcgcgacggtgaaggtgttcgaggacaacgtgctggtccgcgagctcctcca 48354

                                                                         
Query: 355   ggagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccat 414
             ||||||||| || ||| ||||||| || || |||||||| || ||| |||| |||||| |
Sbjct: 48353 ggagaagggacatggccgggtgctcgtcgtcgacggcggtggtagcgtgcgctgcgccct 48294

                                                                         
Query: 415   cctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaa 474
             | |||||||||||| ||  |||| |||||||| ||| || ||||  ||||||||||| ||
Sbjct: 48293 cttgggcggcaacctcgcgcagctggcgcagatcaatggatgggtcggcatcgtcgtcaa 48234

                                           
Query: 475   cggctgcatccgggacgtggacgagatcaa 504
              ||||||||| |||| ||||| ||||||||
Sbjct: 48233 tggctgcatcagggatgtggatgagatcaa 48204



 Score = 48.1 bits (24), Expect = 0.051
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 606   ggatctgcgacggcgagtggctctacgc 633
             |||| |||||||||||||||||||||||
Sbjct: 48102 ggatttgcgacggcgagtggctctacgc 48075



to top

>dbj|AK059956.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-D03, full
           insert sequence
          Length = 917

 Score =  289 bits (146), Expect = 8e-75
 Identities = 344/410 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgca 295
           |||||||| || || ||||||||  |||||||  ||||||| ||||||||||| ||||| 
Sbjct: 350 ggcgagcttcgtgctctccagcccgtcttccaagtctacggaaggcggcaggttttcgcc 409

                                                                       
Query: 296 gggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggag 355
           || || ||||||||||| ||||| |  |||||||| ||||| || |||||||||||||||
Sbjct: 410 ggccctatcgtgacgctgaaggtctacgaggacaatgttcttgttcgcgagttcctggag 469

                                                                       
Query: 356 gagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccatc 415
           ||||||||||| |||||||| || ||||| || || || || ||||||||||||||||| 
Sbjct: 470 gagaagggccaaggcagggttctcgtggtcgatggtggtgggagcctgcggtgcgccatt 529

                                                                       
Query: 416 ctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaac 475
            |||| |||||||| || ||||||||||||||||| |||||||| ||||||||||| || 
Sbjct: 530 ttgggtggcaaccctgtgcagcaggcgcagaacaatgggtgggctggcatcgtcgtcaat 589

                                                                       
Query: 476 ggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaac 535
           || |||||| |||||||||| |||||||| || |||||||| || || || || || |||
Sbjct: 590 ggttgcatcagggacgtggatgagatcaatggctgcgacattggtgtccgagctctgaac 649

                                                                       
Query: 536 tcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcaccatc 595
           || ||||| ||||| || |||||||||||||| || |||||||| || ||  | ||||| 
Sbjct: 650 tcgcaccctatgaaagcaaacaagaagggcatcggggagaagcatgtgcctgtgaccatt 709

                                                             
Query: 596 gcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatgg 645
           || || ||| |||| |||||||| ||||||||||||||||| || |||||
Sbjct: 710 gcagggaccaggatttgcgacggggagtggctctacgccgatactgatgg 759



to top

>dbj|AK058782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-C11, full
           insert sequence
          Length = 897

 Score =  289 bits (146), Expect = 8e-75
 Identities = 344/410 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgca 295
           |||||||| || || ||||||||  |||||||  ||||||| ||||||||||| ||||| 
Sbjct: 316 ggcgagcttcgtgctctccagcccgtcttccaagtctacggaaggcggcaggttttcgcc 375

                                                                       
Query: 296 gggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggag 355
           || || ||||||||||| ||||| |  |||||||| ||||| || |||||||||||||||
Sbjct: 376 ggccctatcgtgacgctgaaggtctacgaggacaatgttcttgttcgcgagttcctggag 435

                                                                       
Query: 356 gagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccatc 415
           ||||||||||| |||||||| || ||||| || || || || ||||||||||||||||| 
Sbjct: 436 gagaagggccaaggcagggttctcgtggtcgatggtggtgggagcctgcggtgcgccatt 495

                                                                       
Query: 416 ctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaac 475
            |||| |||||||| || ||||||||||||||||| |||||||| ||||||||||| || 
Sbjct: 496 ttgggtggcaaccctgtgcagcaggcgcagaacaatgggtgggctggcatcgtcgtcaat 555

                                                                       
Query: 476 ggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaac 535
           || |||||| |||||||||| |||||||| || |||||||| || || || || || |||
Sbjct: 556 ggttgcatcagggacgtggatgagatcaatggctgcgacattggtgtccgagctctgaac 615

                                                                       
Query: 536 tcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcaccatc 595
           || ||||| ||||| || |||||||||||||| || |||||||| || ||  | ||||| 
Sbjct: 616 tcgcaccctatgaaagcaaacaagaagggcatcggggagaagcatgtgcctgtgaccatt 675

                                                             
Query: 596 gcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatgg 645
           || || ||| |||| |||||||| ||||||||||||||||| || |||||
Sbjct: 676 gcagggaccaggatttgcgacggggagtggctctacgccgatactgatgg 725



to top

>emb|CT828155.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA333Z35, full
           insert sequence
          Length = 828

 Score =  272 bits (137), Expect = 2e-69
 Identities = 344/413 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgca 295
           |||||||| || || |||||||| |||||||| |||||||| ||||||||||| ||||| 
Sbjct: 236 ggcgagcttcgtgctctccagcccatcttccaaatctacggaaggcggcaggttttcgcc 295

                                                                       
Query: 296 gggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggag 355
           || || |||||||| || ||||| |  |||||||| |||||  | |||||||||||||||
Sbjct: 296 ggccctatcgtgacactgaaggtctacgaggacaatgttcttatccgcgagttcctggag 355

                                                                       
Query: 356 gagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccatc 415
           ||||||||||| |||||||| || ||||| || || || || |||||||| |||||||| 
Sbjct: 356 gagaagggccaaggcagggttctcgtggtcgatggtggtgggagcctgcgctgcgccatt 415

                                                                       
Query: 416 ctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaac 475
            |||| |||||||| || |||||||| |||||||| || ||||| ||||||||||| || 
Sbjct: 416 ttgggtggcaaccctgtgcagcaggcacagaacaatggatgggctggcatcgtcgtcaat 475

                                                                       
Query: 476 ggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaac 535
           || |||||| |||||||||| || ||||| || |||||||| || || || || || |||
Sbjct: 476 ggttgcatcagggacgtggatgaaatcaatggctgcgacattggtgtccgagctctgaac 535

                                                                       
Query: 536 tcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcaccatc 595
           |||||||| ||||| || ||||||||||| || || |||||||| || ||  | ||||||
Sbjct: 536 tcacaccctatgaaagcaaacaagaagggaataggggagaagcatgtgcctgtgaccatc 595

                                                                
Query: 596 gcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatggcat 648
           || || ||| |||| |||||||| |||||||||||||| || |||||||||||
Sbjct: 596 gcagggaccaggatttgcgacggggagtggctctacgcagataccgatggcat 648



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  194 bits (98), Expect = 4e-46
 Identities = 323/398 (81%)
 Strand = Plus / Plus

                                                                            
Query: 251      ctccagccaatcttccagatctacgggaggcggcaggtcttcgcagggcccatcgtgacg 310
                |||||||| |||||||| ||||| || ||||||||||| || || || || || ||||| 
Sbjct: 30130426 ctccagcccatcttccaaatctatggaaggcggcaggtttttgctggccctattgtgaca 30130485

                                                                            
Query: 311      ctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggaggagaagggccagggc 370
                || ||||| | ||||||||| |||||  | || |||||||| ||||||||||| || || 
Sbjct: 30130486 ctgaaggtctatgaggacaatgttcttatccgtgagttccttgaggagaagggtcatgga 30130545

                                                                            
Query: 371      agggtgctggtggtggacggcggcggcagcctgcggtgcgccatcctgggcggcaacccc 430
                ||||| || ||||| || || || || ||| |||| || |||||  |||| |||||||| 
Sbjct: 30130546 agggttctcgtggttgatggtggtgggagcttgcgctgtgccattttgggtggcaaccct 30130605

                                                                            
Query: 431      gtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggac 490
                || |||||||| |||||||| |||||||| ||||||||||| || || |||||| |||||
Sbjct: 30130606 gtgcagcaggcacagaacaatgggtgggctggcatcgtcgtcaatggttgcatcagggac 30130665

                                                                            
Query: 491      gtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaactcacacccgatgaag 550
                ||||| || ||||| || || ||||| || || || || || |||||||| || ||||||
Sbjct: 30130666 gtggatgaaatcaatggctgtgacattggtgtccgggctctgaactcacatcctatgaag 30130725

                                                                            
Query: 551      gccaacaagaagggcatgggcgagaagcacgtccccatcaccatcgcgggcacccggatc 610
                || ||||||||||| || || |||||||| || ||  | |||||||| || ||| |||| 
Sbjct: 30130726 gcaaacaagaagggaataggtgagaagcatgtgcctgtgaccatcgcagggaccaggatt 30130785

                                                      
Query: 611      tgcgacggcgagtggctctacgccgacaccgatggcat 648
                |||||||| ||||||||||| || || |||||||||||
Sbjct: 30130786 tgcgacggtgagtggctctatgcagataccgatggcat 30130823



to top

>dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0022F10
          Length = 150498

 Score =  194 bits (98), Expect = 4e-46
 Identities = 323/398 (81%)
 Strand = Plus / Plus

                                                                         
Query: 251   ctccagccaatcttccagatctacgggaggcggcaggtcttcgcagggcccatcgtgacg 310
             |||||||| |||||||| ||||| || ||||||||||| || || || || || ||||| 
Sbjct: 35248 ctccagcccatcttccaaatctatggaaggcggcaggtttttgctggccctattgtgaca 35307

                                                                         
Query: 311   ctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggaggagaagggccagggc 370
             || ||||| | ||||||||| |||||  | || |||||||| ||||||||||| || || 
Sbjct: 35308 ctgaaggtctatgaggacaatgttcttatccgtgagttccttgaggagaagggtcatgga 35367

                                                                         
Query: 371   agggtgctggtggtggacggcggcggcagcctgcggtgcgccatcctgggcggcaacccc 430
             ||||| || ||||| || || || || ||| |||| || |||||  |||| |||||||| 
Sbjct: 35368 agggttctcgtggttgatggtggtgggagcttgcgctgtgccattttgggtggcaaccct 35427

                                                                         
Query: 431   gtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggac 490
             || |||||||| |||||||| |||||||| ||||||||||| || || |||||| |||||
Sbjct: 35428 gtgcagcaggcacagaacaatgggtgggctggcatcgtcgtcaatggttgcatcagggac 35487

                                                                         
Query: 491   gtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaactcacacccgatgaag 550
             ||||| || ||||| || || ||||| || || || || || |||||||| || ||||||
Sbjct: 35488 gtggatgaaatcaatggctgtgacattggtgtccgggctctgaactcacatcctatgaag 35547

                                                                         
Query: 551   gccaacaagaagggcatgggcgagaagcacgtccccatcaccatcgcgggcacccggatc 610
             || ||||||||||| || || |||||||| || ||  | |||||||| || ||| |||| 
Sbjct: 35548 gcaaacaagaagggaataggtgagaagcatgtgcctgtgaccatcgcagggaccaggatt 35607

                                                   
Query: 611   tgcgacggcgagtggctctacgccgacaccgatggcat 648
             |||||||| ||||||||||| || || |||||||||||
Sbjct: 35608 tgcgacggtgagtggctctatgcagataccgatggcat 35645



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0690B02
          Length = 153116

 Score =  194 bits (98), Expect = 4e-46
 Identities = 323/398 (81%)
 Strand = Plus / Plus

                                                                          
Query: 251    ctccagccaatcttccagatctacgggaggcggcaggtcttcgcagggcccatcgtgacg 310
              |||||||| |||||||| ||||| || ||||||||||| || || || || || ||||| 
Sbjct: 126416 ctccagcccatcttccaaatctatggaaggcggcaggtttttgctggccctattgtgaca 126475

                                                                          
Query: 311    ctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggaggagaagggccagggc 370
              || ||||| | ||||||||| |||||  | || |||||||| ||||||||||| || || 
Sbjct: 126476 ctgaaggtctatgaggacaatgttcttatccgtgagttccttgaggagaagggtcatgga 126535

                                                                          
Query: 371    agggtgctggtggtggacggcggcggcagcctgcggtgcgccatcctgggcggcaacccc 430
              ||||| || ||||| || || || || ||| |||| || |||||  |||| |||||||| 
Sbjct: 126536 agggttctcgtggttgatggtggtgggagcttgcgctgtgccattttgggtggcaaccct 126595

                                                                          
Query: 431    gtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggac 490
              || |||||||| |||||||| |||||||| ||||||||||| || || |||||| |||||
Sbjct: 126596 gtgcagcaggcacagaacaatgggtgggctggcatcgtcgtcaatggttgcatcagggac 126655

                                                                          
Query: 491    gtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaactcacacccgatgaag 550
              ||||| || ||||| || || ||||| || || || || || |||||||| || ||||||
Sbjct: 126656 gtggatgaaatcaatggctgtgacattggtgtccgggctctgaactcacatcctatgaag 126715

                                                                          
Query: 551    gccaacaagaagggcatgggcgagaagcacgtccccatcaccatcgcgggcacccggatc 610
              || ||||||||||| || || |||||||| || ||  | |||||||| || ||| |||| 
Sbjct: 126716 gcaaacaagaagggaataggtgagaagcatgtgcctgtgaccatcgcagggaccaggatt 126775

                                                    
Query: 611    tgcgacggcgagtggctctacgccgacaccgatggcat 648
              |||||||| ||||||||||| || || |||||||||||
Sbjct: 126776 tgcgacggtgagtggctctatgcagataccgatggcat 126813



to top

>emb|CT837718.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA006M04, full
           insert sequence
          Length = 784

 Score =  167 bits (84), Expect = 8e-38
 Identities = 306/380 (80%)
 Strand = Plus / Plus

                                                                       
Query: 269 atctacgggaggcggcaggtcttcgcagggcccatcgtgacgctcaaggtgtttgaggac 328
           ||||| || ||||||||||| || || || || || ||||| || ||||| | |||||||
Sbjct: 187 atctatggaaggcggcaggtttttgctggccctattgtgacactgaaggtctatgaggac 246

                                                                       
Query: 329 aacgttctcgtgcgcgagttcctggaggagaagggccagggcagggtgctggtggtggac 388
           || |||||  | || |||||||| ||||||||||| || || ||||| || ||||| || 
Sbjct: 247 aatgttcttatccgtgagttccttgaggagaagggtcatggaagggttctcgtggttgat 306

                                                                       
Query: 389 ggcggcggcagcctgcggtgcgccatcctgggcggcaaccccgtccagcaggcgcagaac 448
           || || || ||| |||| || |||||  |||| |||||||| || |||||||| ||||||
Sbjct: 307 ggtggtgggagcttgcgctgtgccattttgggtggcaaccctgtgcagcaggcacagaac 366

                                                                       
Query: 449 aacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgagatcaacggg 508
           || || ||||| ||||||||||| || || |||||| |||||||||| || ||||| || 
Sbjct: 367 aatggatgggctggcatcgtcgtcaatggttgcatcagggacgtggatgaaatcaatggc 426

                                                                       
Query: 509 tgcgacatcggcgtgcgcgccctcaactcacacccgatgaaggccaacaagaagggcatg 568
           || ||||| || || || || || |||||||| || |||||||| ||||||||||| || 
Sbjct: 427 tgtgacattggtgtccgggctctgaactcacatcctatgaaggcaaacaagaagggaata 486

                                                                       
Query: 569 ggcgagaagcacgtccccatcaccatcgcgggcacccggatctgcgacggcgagtggctc 628
           || |||||||| || ||  | |||||||| || ||| |||| |||||||| |||||||||
Sbjct: 487 ggtgagaagcatgtgcctgtgaccatcgcagggaccaggatttgcgacggtgagtggctc 546

                               
Query: 629 tacgccgacaccgatggcat 648
           || || || |||||||||||
Sbjct: 547 tatgcagataccgatggcat 566



to top

>ref|NM_001050638.1| Oryza sativa (japonica cultivar-group) Os01g0722800 (Os01g0722800)
           mRNA, complete cds
          Length = 2466

 Score =  165 bits (83), Expect = 3e-37
 Identities = 296/367 (80%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctccagccaatcttccagatctacgggaggcggcaggtcttcgcagggcccatcgtgacg 310
           |||||||| |||||||| ||||| || ||||||||||| || || || || || ||||| 
Sbjct: 79  ctccagcccatcttccaaatctatggaaggcggcaggtttttgctggccctattgtgaca 138

                                                                       
Query: 311 ctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggaggagaagggccagggc 370
           || ||||| | ||||||||| |||||  | || |||||||| ||||||||||| || || 
Sbjct: 139 ctgaaggtctatgaggacaatgttcttatccgtgagttccttgaggagaagggtcatgga 198

                                                                       
Query: 371 agggtgctggtggtggacggcggcggcagcctgcggtgcgccatcctgggcggcaacccc 430
           ||||| || ||||| || || || || ||| |||| || |||||  |||| |||||||| 
Sbjct: 199 agggttctcgtggttgatggtggtgggagcttgcgctgtgccattttgggtggcaaccct 258

                                                                       
Query: 431 gtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggac 490
           || |||||||| |||||||| |||||||| ||||||||||| || || |||||| |||||
Sbjct: 259 gtgcagcaggcacagaacaatgggtgggctggcatcgtcgtcaatggttgcatcagggac 318

                                                                       
Query: 491 gtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaactcacacccgatgaag 550
           ||||| || ||||| || || ||||| || || || || || |||||||| || ||||||
Sbjct: 319 gtggatgaaatcaatggctgtgacattggtgtccgggctctgaactcacatcctatgaag 378

                                                                       
Query: 551 gccaacaagaagggcatgggcgagaagcacgtccccatcaccatcgcgggcacccggatc 610
           || ||||||||||| || || |||||||| || ||  | |||||||| || ||| |||| 
Sbjct: 379 gcaaacaagaagggaataggtgagaagcatgtgcctgtgaccatcgcagggaccaggatt 438

                  
Query: 611 tgcgacg 617
           |||||||
Sbjct: 439 tgcgacg 445



to top

>ref|NM_001054736.1| Oryza sativa (japonica cultivar-group) Os02g0762100 (Os02g0762100)
            mRNA, complete cds
          Length = 1881

 Score =  155 bits (78), Expect = 3e-34
 Identities = 222/270 (82%)
 Strand = Plus / Plus

                                                                        
Query: 235  cggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgc 294
            |||||||||||| || ||||  || |||||| | |||||||||||||||||||| |||||
Sbjct: 1305 cggcgagctccgcgccctccctcccatcttcaaaatctacgggaggcggcaggttttcgc 1364

                                                                        
Query: 295  agggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctgga 354
             || ||  ||| |||| | |||||||| ||||||||||| || || |||||| ||||  |
Sbjct: 1365 cggcccagtcgcgacggtgaaggtgttcgaggacaacgtgctggtccgcgagctcctcca 1424

                                                                        
Query: 355  ggagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccat 414
            ||||||||| || ||| ||||||| || || |||||||| || ||| |||| |||||| |
Sbjct: 1425 ggagaagggacatggccgggtgctcgtcgtcgacggcggtggtagcgtgcgctgcgccct 1484

                                                                        
Query: 415  cctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaa 474
            | |||||||||||| ||  |||| |||||||| ||| || ||||  ||||||||||| ||
Sbjct: 1485 cttgggcggcaacctcgcgcagctggcgcagatcaatggatgggtcggcatcgtcgtcaa 1544

                                          
Query: 475  cggctgcatccgggacgtggacgagatcaa 504
             ||||||||| |||| ||||| ||||||||
Sbjct: 1545 tggctgcatcagggatgtggatgagatcaa 1574



 Score = 48.1 bits (24), Expect = 0.051
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 606  ggatctgcgacggcgagtggctctacgc 633
            |||| |||||||||||||||||||||||
Sbjct: 1676 ggatttgcgacggcgagtggctctacgc 1703



to top

>dbj|AK068833.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013159A13, full
            insert sequence
          Length = 1879

 Score =  155 bits (78), Expect = 3e-34
 Identities = 222/270 (82%)
 Strand = Plus / Plus

                                                                        
Query: 235  cggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgc 294
            |||||||||||| || ||||  || |||||| | |||||||||||||||||||| |||||
Sbjct: 1303 cggcgagctccgcgccctccctcccatcttcaaaatctacgggaggcggcaggttttcgc 1362

                                                                        
Query: 295  agggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctgga 354
             || ||  ||| |||| | |||||||| ||||||||||| || || |||||| ||||  |
Sbjct: 1363 cggcccagtcgcgacggtgaaggtgttcgaggacaacgtgctggtccgcgagctcctcca 1422

                                                                        
Query: 355  ggagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccat 414
            ||||||||| || ||| ||||||| || || |||||||| || ||| |||| |||||| |
Sbjct: 1423 ggagaagggacatggccgggtgctcgtcgtcgacggcggtggtagcgtgcgctgcgccct 1482

                                                                        
Query: 415  cctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaa 474
            | |||||||||||| ||  |||| |||||||| ||| || ||||  ||||||||||| ||
Sbjct: 1483 cttgggcggcaacctcgcgcagctggcgcagatcaatggatgggtcggcatcgtcgtcaa 1542

                                          
Query: 475  cggctgcatccgggacgtggacgagatcaa 504
             ||||||||| |||| ||||| ||||||||
Sbjct: 1543 tggctgcatcagggatgtggatgagatcaa 1572



 Score = 48.1 bits (24), Expect = 0.051
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 606  ggatctgcgacggcgagtggctctacgc 633
            |||| |||||||||||||||||||||||
Sbjct: 1674 ggatttgcgacggcgagtggctctacgc 1701



to top

>dbj|AK059923.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-H02, full
           insert sequence
          Length = 1241

 Score =  155 bits (78), Expect = 3e-34
 Identities = 222/270 (82%)
 Strand = Plus / Plus

                                                                       
Query: 235 cggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgc 294
           |||||||||||| || ||||  || |||||| | |||||||||||||||||||| |||||
Sbjct: 665 cggcgagctccgcgccctccctcccatcttcaaaatctacgggaggcggcaggttttcgc 724

                                                                       
Query: 295 agggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctgga 354
            || ||  ||| |||| | |||||||| ||||||||||| || || |||||| ||||  |
Sbjct: 725 cggcccagtcgcgacggtgaaggtgttcgaggacaacgtgctggtccgcgagctcctcca 784

                                                                       
Query: 355 ggagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccat 414
           ||||||||| || ||| ||||||| || || |||||||| || ||| |||| |||||| |
Sbjct: 785 ggagaagggacatggccgggtgctcgtcgtcgacggcggtggtagcgtgcgctgcgccct 844

                                                                       
Query: 415 cctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaa 474
           | |||||||||||| ||  |||| |||||||| ||| || ||||  ||||||||||| ||
Sbjct: 845 cttgggcggcaacctcgcgcagctggcgcagatcaatggatgggtcggcatcgtcgtcaa 904

                                         
Query: 475 cggctgcatccgggacgtggacgagatcaa 504
            ||||||||| |||| ||||| ||||||||
Sbjct: 905 tggctgcatcagggatgtggatgagatcaa 934



 Score = 48.1 bits (24), Expect = 0.051
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 606  ggatctgcgacggcgagtggctctacgc 633
            |||| |||||||||||||||||||||||
Sbjct: 1036 ggatttgcgacggcgagtggctctacgc 1063



to top

>emb|CT837687.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA333Z46, full
           insert sequence
          Length = 694

 Score = 99.6 bits (50), Expect = 2e-17
 Identities = 323/414 (78%)
 Strand = Plus / Plus

                                                                       
Query: 235 cggcgagctccgggcgctccagccaatcttccagatctacgggaggcggcaggtcttcgc 294
           |||||||||||| || ||||  || ||||||   ||||||||||||||| || |||||||
Sbjct: 119 cggcgagctccgtgccctccctcctatcttcagaatctacgggaggcggaagatcttcgc 178

                                                                       
Query: 295 agggcccatcgtgacgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctgga 354
            || ||  ||  |||| | ||||| || ||||| ||||| || || |||||| ||||  |
Sbjct: 179 cggcccagtcacgacggtgaaggtcttcgaggaaaacgtgctggtccgcgagctcctcca 238

                                                                       
Query: 355 ggagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccat 414
           |||||||||||| ||| | ||||| ||  | ||||| || |||||| |||  |||||| |
Sbjct: 239 ggagaagggccacggccgtgtgctcgtcattgacggtggtggcagcgtgcactgcgccct 298

                                                                       
Query: 415 cctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaa 474
           | |||| ||||||| ||  |||| |||||| | ||| || ||||  ||||||||||| ||
Sbjct: 299 cttgggtggcaacctcgcgcagctggcgcatatcaatggctgggttggcatcgtcgtcaa 358

                                                                       
Query: 475 cggctgcatccgggacgtggacgagatcaacgggtgcgacatcggcgtgcgcgccctcaa 534
            ||||||||| |||||||||| |||||||| || || ||||| || || || || || ||
Sbjct: 359 tggctgcatcagggacgtggatgagatcaatggctgtgacattggtgtccgtgctctgaa 418

                                                                       
Query: 535 ctcacacccgatgaaggccaacaagaagggcatgggcgagaagcacgtccccatcaccat 594
           ||| ||||| | |||| ||  ||||||| ||   || |||||||  || ||  | |||||
Sbjct: 419 ctctcaccctaagaagcccggcaagaagagcgccggtgagaagcgtgtgcctgtgaccat 478

                                                                 
Query: 595 cgcgggcacccggatctgcgacggcgagtggctctacgccgacaccgatggcat 648
            |  || ||| |||| ||||||||||||||||||||||| ||  ||||||||||
Sbjct: 479 tgaagggaccaggatttgcgacggcgagtggctctacgctgatgccgatggcat 532



to top

>gb|AY105094.1| Zea mays PCO088415 mRNA sequence
          Length = 879

 Score = 83.8 bits (42), Expect = 9e-13
 Identities = 210/266 (78%)
 Strand = Plus / Plus

                                                                       
Query: 320 tttgaggacaacgttctcgtgcgcgagttcctggaggagaagggccagggcagggtgctg 379
           |||||||| ||||||||  | ||||||||||| |||||||| || || |||||||| |||
Sbjct: 382 tttgaggataacgttctgctccgcgagttccttgaggagaaaggtcacggcagggtcctg 441

                                                                       
Query: 380 gtggtggacggcggcggcagcctgcggtgcgccatcctgggcggcaaccccgtccagcag 439
           ||||| || | ||| || ||| |||| || ||  |  |||| |||||||  | ||||| |
Sbjct: 442 gtggttgatgccggtgggagcatgcgttgtgcagttttgggtggcaaccttgcccagctg 501

                                                                       
Query: 440 gcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgag 499
             ||||||||| |||||||| || ||||| || || ||||||||| | || || ||||||
Sbjct: 502 atgcagaacaatgggtgggctggaatcgttgtcaatggctgcatcagagatgtcgacgag 561

                                                                       
Query: 500 atcaacgggtgcgacatcggcgtgcgcgccctcaactcacacccgatgaaggccaacaag 559
           || || || |||||| | || || || || || || |||||||| |||||| | ||||||
Sbjct: 562 ataaatggctgcgacgttggtgtccgggctctgaattcacaccctatgaagtctaacaag 621

                                     
Query: 560 aagggcatgggcgagaagcacgtccc 585
           |||||| | || |||||||| |||||
Sbjct: 622 aagggcgtcggtgagaagcatgtccc 647



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 67.9 bits (34), Expect = 5e-08
 Identities = 103/126 (81%)
 Strand = Plus / Minus

                                                                           
Query: 356     gagaagggccagggcagggtgctggtggtggacggcggcggcagcctgcggtgcgccatc 415
               |||||||||  |||| | ||||||||||| |||||||||||||||| ||| |||||  | 
Sbjct: 3092402 gagaagggcgcgggccgtgtgctggtggtcgacggcggcggcagccagcgctgcgcgctg 3092343

                                                                           
Query: 416     ctgggcggcaaccccgtccagcaggcgcagaacaacgggtgggcgggcatcgtcgtgaac 475
                ||||||||||||  |  |||   |||||  | ||||| ||||||||||||||| |||||
Sbjct: 3092342 gtgggcggcaaccttgcgcagatcgcgcaacagaacggttgggcgggcatcgtcctgaac 3092283

                     
Query: 476     ggctgc 481
               ||||||
Sbjct: 3092282 ggctgc 3092277



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 63.9 bits (32), Expect = 9e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                           
Query: 386     gacggcggcggcagcctgcggtgcgccatcctgggcggcaaccccgtccagcaggcgcag 445
               |||||||||||||||||||| |||||  || | |||||||||| || | |||  ||  ||
Sbjct: 1658696 gacggcggcggcagcctgcgttgcgcgctcgtcggcggcaacctcggcaagctcgccgag 1658637

                                                   
Query: 446     aacaacgggtgggcgggcatcgtcgtgaacggctgc 481
               || || || ||||| |||||||||||||||||||||
Sbjct: 1658636 aagaatggctgggccggcatcgtcgtgaacggctgc 1658601



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 63.9 bits (32), Expect = 9e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                           
Query: 386     gacggcggcggcagcctgcggtgcgccatcctgggcggcaaccccgtccagcaggcgcag 445
               |||||||||||||||||||| |||||  || | |||||||||| || | |||  ||  ||
Sbjct: 2903695 gacggcggcggcagcctgcgttgcgcgctcgtcggcggcaacctcggcaagctcgccgag 2903636

                                                   
Query: 446     aacaacgggtgggcgggcatcgtcgtgaacggctgc 481
               || || || ||||| |||||||||||||||||||||
Sbjct: 2903635 aagaatggctgggccggcatcgtcgtgaacggctgc 2903600



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 63.9 bits (32), Expect = 9e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                           
Query: 386     gacggcggcggcagcctgcggtgcgccatcctgggcggcaaccccgtccagcaggcgcag 445
               |||||||||||||||||||| |||||  || | |||||||||| || | |||  ||  ||
Sbjct: 2633781 gacggcggcggcagcctgcgttgcgcgctcgtcggcggcaacctcggcaagctcgccgag 2633722

                                                   
Query: 446     aacaacgggtgggcgggcatcgtcgtgaacggctgc 481
               || || || ||||| |||||||||||||||||||||
Sbjct: 2633721 aagaatggctgggccggcatcgtcgtgaacggctgc 2633686



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 63.9 bits (32), Expect = 9e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                           
Query: 386     gacggcggcggcagcctgcggtgcgccatcctgggcggcaaccccgtccagcaggcgcag 445
               |||||||||||||||||||| |||||  || | |||||||||| || | |||  ||  ||
Sbjct: 2255884 gacggcggcggcagcctgcgctgcgcgctcgttggcggcaacctcggcaagctcgccgag 2255943

                                                   
Query: 446     aacaacgggtgggcgggcatcgtcgtgaacggctgc 481
               || ||||| ||||  |||||||||||||||||||||
Sbjct: 2255944 aagaacggctgggtcggcatcgtcgtgaacggctgc 2255979



to top

>ref|NM_121650.2| Arabidopsis thaliana unknown protein (AT5G16450) mRNA, complete cds
          Length = 655

 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 443 cagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgagatc 502
           ||||||||||| ||||| || ||||| |||||||| |||||| | ||||| || ||||||
Sbjct: 302 cagaacaacggatgggcaggaatcgttgtgaacggatgcatcagagacgtcgatgagatc 361

                
Query: 503 aacgg 507
           |||||
Sbjct: 362 aacgg 366



to top

>ref|NM_180499.1| Arabidopsis thaliana unknown protein (AT5G16450) mRNA, complete cds
          Length = 681

 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 443 cagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgagatc 502
           ||||||||||| ||||| || ||||| |||||||| |||||| | ||||| || ||||||
Sbjct: 328 cagaacaacggatgggcaggaatcgttgtgaacggatgcatcagagacgtcgatgagatc 387

                
Query: 503 aacgg 507
           |||||
Sbjct: 388 aacgg 392



to top

>gb|AY085206.1| Arabidopsis thaliana clone 13819 mRNA, complete sequence
          Length = 648

 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 443 cagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgagatc 502
           ||||||||||| ||||| || ||||| |||||||| |||||| | ||||| || ||||||
Sbjct: 302 cagaacaacggatgggcaggaatcgttgtgaacggatgcatcagagacgtcgatgagatc 361

                
Query: 503 aacgg 507
           |||||
Sbjct: 362 aacgg 366



to top

>gb|BT005566.1| Arabidopsis thaliana clone U51333 unknown protein (At5g16450) mRNA,
           complete cds
          Length = 525

 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 443 cagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgagatc 502
           ||||||||||| ||||| || ||||| |||||||| |||||| | ||||| || ||||||
Sbjct: 265 cagaacaacggatgggcaggaatcgttgtgaacggatgcatcagagacgtcgatgagatc 324

                
Query: 503 aacgg 507
           |||||
Sbjct: 325 aacgg 329



to top

>dbj|AK118745.1| Arabidopsis thaliana At5g16450 mRNA for putative
           S-adenosylmethionine:2-demethylmenaquinone
           methyltransferase, complete cds, clone: RAFL21-09-H18
          Length = 588

 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 443 cagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgagatc 502
           ||||||||||| ||||| || ||||| |||||||| |||||| | ||||| || ||||||
Sbjct: 328 cagaacaacggatgggcaggaatcgttgtgaacggatgcatcagagacgtcgatgagatc 387

                
Query: 503 aacgg 507
           |||||
Sbjct: 388 aacgg 392



to top

>dbj|AB005242.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4
          Length = 82001

 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                         
Query: 443   cagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgagatc 502
             ||||||||||| ||||| || ||||| |||||||| |||||| | ||||| || ||||||
Sbjct: 41818 cagaacaacggatgggcaggaatcgttgtgaacggatgcatcagagacgtcgatgagatc 41877

                  
Query: 503   aacgg 507
             |||||
Sbjct: 41878 aacgg 41882



to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 366    agggcagggtgctggtggtggacggcggcggcagcctg 403
              ||||| |||||||||||||||||  |||||||||||||
Sbjct: 390742 agggccgggtgctggtggtggacaacggcggcagcctg 390779



 Score = 44.1 bits (22), Expect = 0.79
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 449    aacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtgg 494
              ||||| ||||| ||| |||| |||||||||||| | ||||||||||
Sbjct: 390825 aacggctgggcaggcgtcgttgtgaacggctgcgtgcgggacgtgg 390870



to top

>ref|NM_111145.2| Arabidopsis thaliana unknown protein (AT3G02770) mRNA, complete cds
          Length = 713

 Score = 50.1 bits (25), Expect = 0.013
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 440 gcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgag 499
           |||||||||||||| ||||| || ||| | ||||| || |||||| | ||||| || |||
Sbjct: 350 gcgcagaacaacggatgggcagggatcatagtgaatggatgcatcagagacgttgatgag 409

                            
Query: 500 atcaacgggtgcgacat 516
           ||||| || ||||||||
Sbjct: 410 atcaatggttgcgacat 426



to top

>gb|AC018363.8|ATAC018363 Arabidopsis thaliana chromosome III BAC F13E7 genomic sequence,
             complete sequence
          Length = 100559

 Score = 50.1 bits (25), Expect = 0.013
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                         
Query: 440   gcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgag 499
             |||||||||||||| ||||| || ||| | ||||| || |||||| | ||||| || |||
Sbjct: 85055 gcgcagaacaacggatgggcagggatcatagtgaatggatgcatcagagacgttgatgag 85114

                              
Query: 500   atcaacgggtgcgacat 516
             ||||| || ||||||||
Sbjct: 85115 atcaatggttgcgacat 85131



to top

>gb|AY086886.1| Arabidopsis thaliana clone 29093 mRNA, complete sequence
          Length = 668

 Score = 50.1 bits (25), Expect = 0.013
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 440 gcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgag 499
           |||||||||||||| ||||| || ||| | ||||| || |||||| | ||||| || |||
Sbjct: 322 gcgcagaacaacggatgggcagggatcatagtgaatggatgcatcagagacgttgatgag 381

                            
Query: 500 atcaacgggtgcgacat 516
           ||||| || ||||||||
Sbjct: 382 atcaatggttgcgacat 398



to top

>dbj|AK176633.1| Arabidopsis thaliana mRNA for putative
           S-adenosylmethionine:2-demethylmenaquinone
           methyltransferase, complete cds, clone: RAFL25-17-D12
          Length = 673

 Score = 50.1 bits (25), Expect = 0.013
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 440 gcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgag 499
           |||||||||||||| ||||| || ||| | ||||| || |||||| | ||||| || |||
Sbjct: 320 gcgcagaacaacggatgggcagggatcatagtgaatggatgcatcagagacgttgatgag 379

                            
Query: 500 atcaacgggtgcgacat 516
           ||||| || ||||||||
Sbjct: 380 atcaatggttgcgacat 396



to top

>emb|BX825804.1|CNS0A6AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL63ZH02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 713

 Score = 50.1 bits (25), Expect = 0.013
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 440 gcgcagaacaacgggtgggcgggcatcgtcgtgaacggctgcatccgggacgtggacgag 499
           |||||||||||||| ||||| || ||| | ||||| || |||||| | ||||| || |||
Sbjct: 350 gcgcagaacaacggatgggcagggatcatagtgaatggatgcatcagagacgttgatgag 409

                            
Query: 500 atcaacgggtgcgacat 516
           ||||| || ||||||||
Sbjct: 410 atcaatggttgcgacat 426



to top

>emb|AM261760.1| IncP-1alpha plasmid pBS228, complete sequence
          Length = 89147

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 339   tgcgcgagttcctggaggagaagggcc 365
             |||||||||||||||| ||||||||||
Sbjct: 86575 tgcgcgagttcctggacgagaagggcc 86549



to top

>emb|AM260479.1| Ralstonia eutropha H16 chromosome 1
          Length = 4052032

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                          
Query: 444     agaacaacgggtgggcgggcatcgtcgtgaacggctgcatccg 486
               |||| ||||| ||||  ||||||||||| ||||||||||||||
Sbjct: 2421795 agaagaacggctgggtcggcatcgtcgtcaacggctgcatccg 2421753



to top

>gb|AY741093.1| Integration vector pJK202, complete sequence
          Length = 53204

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 339   tgcgcgagttcctggaggagaagggcc 365
             |||||||||||||||| ||||||||||
Sbjct: 41303 tgcgcgagttcctggacgagaagggcc 41277



to top

>gb|AF327712.1| Cloning vector pRK310, complete sequence
          Length = 19041

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 339  tgcgcgagttcctggaggagaagggcc 365
            |||||||||||||||| ||||||||||
Sbjct: 6848 tgcgcgagttcctggacgagaagggcc 6822



to top

>emb|AJ744860.1| uncultured bacterium pTB11 plasmid complete genome
          Length = 68869

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 339   tgcgcgagttcctggaggagaagggcc 365
             |||||||||||||||| ||||||||||
Sbjct: 61782 tgcgcgagttcctggacgagaagggcc 61756



to top

>dbj|AB027255.2| Cloning vector pSB1 tetR, tetA genes with Agrobacterium tumefaciens DNA
             insert
          Length = 36909

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 339   tgcgcgagttcctggaggagaagggcc 365
             |||||||||||||||| ||||||||||
Sbjct: 32916 tgcgcgagttcctggacgagaagggcc 32890



to top

>dbj|AB201314.1| Cloning vector pSB4U DNA, complete sequence
          Length = 41385

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 339   tgcgcgagttcctggaggagaagggcc 365
             |||||||||||||||| ||||||||||
Sbjct: 37392 tgcgcgagttcctggacgagaagggcc 37366



to top

>gb|AY218787.1| Cloning vector pAJ1, complete sequence
          Length = 28708

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 339  tgcgcgagttcctggaggagaagggcc 365
            |||||||||||||||| ||||||||||
Sbjct: 9273 tgcgcgagttcctggacgagaagggcc 9247



to top

>emb|Y00448.1|PRK2KORB Plasmid RK2 korB gene involved in regulation of copy number
          Length = 1451

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 339 tgcgcgagttcctggaggagaagggcc 365
           |||||||||||||||| ||||||||||
Sbjct: 843 tgcgcgagttcctggacgagaagggcc 869



to top

>emb|X06543.1|KAPLKORB Klebsiella aerogenes plasmid RK2 korB gene for replication control
          Length = 1167

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 339 tgcgcgagttcctggaggagaagggcc 365
           |||||||||||||||| ||||||||||
Sbjct: 805 tgcgcgagttcctggacgagaagggcc 831



to top

>gb|AY532632.1| Cloning vector pLAFR, complete sequence
          Length = 20352

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 339  tgcgcgagttcctggaggagaagggcc 365
            |||||||||||||||| ||||||||||
Sbjct: 2575 tgcgcgagttcctggacgagaagggcc 2601



to top

>dbj|AB027254.1| Cloning vector pSB4 tetR, tetA, hygromycin resistance genes with
             Agrobacterium tumefaciens DNA insert
          Length = 39902

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 339   tgcgcgagttcctggaggagaagggcc 365
             |||||||||||||||| ||||||||||
Sbjct: 35909 tgcgcgagttcctggacgagaagggcc 35883



to top

>gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence
          Length = 27608

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 339  tgcgcgagttcctggaggagaagggcc 365
            |||||||||||||||| ||||||||||
Sbjct: 9344 tgcgcgagttcctggacgagaagggcc 9370



to top

>gb|L27758.1|BIACOMGEN Birmingham IncP-alpha plasmid (R18, R68, RK2, RP1, RP4) complete genome
          Length = 60099

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 339   tgcgcgagttcctggaggagaagggcc 365
             |||||||||||||||| ||||||||||
Sbjct: 57527 tgcgcgagttcctggacgagaagggcc 57501



to top

>ref|XM_415815.2| PREDICTED: Gallus gallus similar to MGC80576 protein (LOC417569),
           mRNA
          Length = 1698

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 96  ccgccctccgctgcctcctcgctccc 121
           |||||| |||||||||||||||||||
Sbjct: 56  ccgcccgccgctgcctcctcgctccc 81



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                           
Query: 308     acgctcaaggtgtttgaggacaacgttctcgtgcgcgagttcctggaggagaagggccag 367
               |||||||||||||| ||||||||||  || |||||||   | |||||| ||  |||| ||
Sbjct: 1442329 acgctcaaggtgttcgaggacaacggcctggtgcgcgccatgctggagcagccgggcgag 1442388

                                             
Query: 368     ggcagggtgctggtggtggacggcggcggc 397
               ||  | |||||||| || ||||||||||||
Sbjct: 1442389 gggcgcgtgctggtcgtcgacggcggcggc 1442418



to top

>gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, complete sequence
          Length = 268984

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 97    cgccctccgctgcctcctcgct 118
             ||||||||||||||||||||||
Sbjct: 41570 cgccctccgctgcctcctcgct 41591



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 88       tccaccctccgccctccgctgcctcc 113
                ||||||||||||||||||| ||||||
Sbjct: 19682293 tccaccctccgccctccgccgcctcc 19682268



to top

>gb|AC019103.8| Homo sapiens BAC clone RP11-460I19 from 4, complete sequence
          Length = 177950

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 87    ctccaccctccgccctccgctg 108
             ||||||||||||||||||||||
Sbjct: 99727 ctccaccctccgccctccgctg 99706



to top

>gb|AC015535.11| Mus musculus chromosome 5, clone RP23-39M18, complete sequence
          Length = 263382

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 14     cccttccctcccctctgattcc 35
              ||||||||||||||||||||||
Sbjct: 116936 cccttccctcccctctgattcc 116957



to top

>emb|AL837527.2|CNS08CAQ Oryza sativa chromosome 12, . BAC OSJNBb0078B20 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 133659

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 88    tccaccctccgccctccgctgcctcc 113
             ||||||||||||||||||| ||||||
Sbjct: 44700 tccaccctccgccctccgccgcctcc 44725



to top

>gb|CP000479.1| Mycobacterium avium 104, complete genome
          Length = 5475491

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 380     gtggtggacggcggcggcagcctgc 404
               |||||||||||||||||| ||||||
Sbjct: 4832304 gtggtggacggcggcggcggcctgc 4832328



to top

>gb|CP000459.1| Burkholderia cenocepacia HI2424 chromosome 2, complete genome
          Length = 2998664

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 382    ggtggacggcggcggcagcct 402
              |||||||||||||||||||||
Sbjct: 383102 ggtggacggcggcggcagcct 383122



to top

>ref|XM_001227389.1| Chaetomium globosum CBS 148.51 predicted protein (CHGG_09463) mRNA,
            complete cds
          Length = 1533

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 97   cgccctccgctgcctcctcgc 117
            |||||||||||||||||||||
Sbjct: 1206 cgccctccgctgcctcctcgc 1226



to top

>gb|DQ398041.1| Mycobacteriophage 244, complete genome
          Length = 74483

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 333  ttctcgtgcgcgagttcctgg 353
            |||||||||||||||||||||
Sbjct: 6204 ttctcgtgcgcgagttcctgg 6184



to top

>gb|BC063738.1| Xenopus laevis hypothetical protein MGC68772, mRNA (cDNA clone
            MGC:68772 IMAGE:4175707), complete cds
          Length = 5682

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 729  tgcttgtctgtaacatgatggatga 753
            |||||||||| ||||||||||||||
Sbjct: 1552 tgcttgtctgaaacatgatggatga 1528



to top

>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 372     gggtgctggtggtggacggcg 392
               |||||||||||||||||||||
Sbjct: 3486320 gggtgctggtggtggacggcg 3486340



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                           
Query: 130    cgacaccca-ccggcgacgcgcggcgagc 157
              ||||||||| |||||||||||||||||||
Sbjct: 825967 cgacacccagccggcgacgcgcggcgagc 825995



to top

>gb|AC025575.21| Homo sapiens 12 BAC RP11-934P3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 158531

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 311    ctcaaggtgtttgaggacaac 331
              |||||||||||||||||||||
Sbjct: 142836 ctcaaggtgtttgaggacaac 142816



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8
          Length = 28434780

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 120     cccacggcggcgacacccacc 140
               |||||||||||||||||||||
Sbjct: 3841432 cccacggcggcgacacccacc 3841412



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6
          Length = 30731886

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 86      gctccaccctccgccctccgctgcc 110
               ||||| |||||||||||||||||||
Sbjct: 7217529 gctccgccctccgccctccgctgcc 7217505



to top

>emb|BX071178.1|CNS09R32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 406 gtgcgcgagttcctggaggag 386



to top

>emb|BX071177.1|CNS09R31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 623 gtgcgcgagttcctggaggag 643



to top

>emb|BX070151.1|CNS09QAJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 772

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 592 gtgcgcgagttcctggaggag 612



to top

>emb|BX067977.1|CNS09OM5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 397 gtgcgcgagttcctggaggag 377



to top

>emb|BX067976.1|CNS09OM4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 620 gtgcgcgagttcctggaggag 640



to top

>emb|BX065571.1|CNS09MRB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 502

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 413 gtgcgcgagttcctggaggag 393



to top

>emb|BX065570.1|CNS09MRA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 625 gtgcgcgagttcctggaggag 645



to top

>emb|BX063486.1|CNS09L5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 252 gtgcgcgagttcctggaggag 272



to top

>emb|BX062889.1|CNS09KOT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 566 gtgcgcgagttcctggaggag 586



to top

>emb|BX055879.1|CNS09FA3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 437 gtgcgcgagttcctggaggag 417



to top

>emb|BX055878.1|CNS09FA2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 651 gtgcgcgagttcctggaggag 671



to top

>emb|BX052026.1|CNS09CB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 329

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 52  gtgcgcgagttcctggaggag 32



to top

>emb|BX052018.1|CNS09CAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 281

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 121 gtgcgcgagttcctggaggag 101



to top

>emb|BX049735.1|CNS09AJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 415 gtgcgcgagttcctggaggag 395



to top

>emb|BX048137.1|CNS099B1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 449 gtgcgcgagttcctggaggag 429



to top

>emb|BX048136.1|CNS099B0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 624 gtgcgcgagttcctggaggag 644



to top

>emb|BX041708.1|CNS094CG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 474

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 429 gtgcgcgagttcctggaggag 409



to top

>emb|BX041707.1|CNS094CF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 661

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 599 gtgcgcgagttcctggaggag 619



to top

>emb|BX040627.1|CNS093IF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 591 gtgcgcgagttcctggaggag 611



to top

>emb|BX037638.1|CNS0917E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 415 gtgcgcgagttcctggaggag 395



to top

>emb|BX031711.1|CNS08WMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 619

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 401 gtgcgcgagttcctggaggag 381



to top

>emb|BX031710.1|CNS08WMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 615 gtgcgcgagttcctggaggag 635



to top

>gb|AY129331.1| Mycobacteriophage CJW1, complete genome
          Length = 75931

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 333  ttctcgtgcgcgagttcctgg 353
            |||||||||||||||||||||
Sbjct: 7206 ttctcgtgcgcgagttcctgg 7186



to top

>emb|BX018527.1|CNS08MGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 665 gtgcgcgagttcctggaggag 685



to top

>emb|BX016186.1|CNS08KNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 402 gtgcgcgagttcctggaggag 382



to top

>emb|BX016185.1|CNS08KNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 641 gtgcgcgagttcctggaggag 661



to top

>emb|BX015329.1|CNS08JZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 399 gtgcgcgagttcctggaggag 379



to top

>emb|BX012465.1|CNS08HS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 416 gtgcgcgagttcctggaggag 396



to top

>emb|BX012464.1|CNS08HS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 696

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 520 gtgcgcgagttcctggaggag 540



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 365     cagggcagggtgctggtggtggacg 389
               |||||| ||||||||||||||||||
Sbjct: 4714783 cagggctgggtgctggtggtggacg 4714807



to top

>emb|BX640447.1| Bordetella bronchiseptica strain RB50, complete genome; segment 11/16
          Length = 349442

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 383   gtggacggcggcggcagcctg 403
             |||||||||||||||||||||
Sbjct: 18562 gtggacggcggcggcagcctg 18542



to top

>emb|BX640428.1| Bordetella parapertussis strain 12822, complete genome; segment 6/14
          Length = 348525

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 383    gtggacggcggcggcagcctg 403
              |||||||||||||||||||||
Sbjct: 216754 gtggacggcggcggcagcctg 216774



to top

>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12
          Length = 343243

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 383    gtggacggcggcggcagcctg 403
              |||||||||||||||||||||
Sbjct: 242485 gtggacggcggcggcagcctg 242505



to top

>dbj|AP005605.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1449_C01
          Length = 192857

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 120    cccacggcggcgacacccacc 140
              |||||||||||||||||||||
Sbjct: 106649 cccacggcggcgacacccacc 106629



to top

>dbj|AP004995.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0068B06
          Length = 143712

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 86    gctccaccctccgccctccgctgcc 110
             ||||| |||||||||||||||||||
Sbjct: 94940 gctccgccctccgccctccgctgcc 94916



to top

>dbj|AP004994.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0052G07
          Length = 156207

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 86    gctccaccctccgccctccgctgcc 110
             ||||| |||||||||||||||||||
Sbjct: 52533 gctccgccctccgccctccgctgcc 52509



to top

>ref|XM_315431.2| Anopheles gambiae str. PEST ENSANGP00000007022
           (ENSANGG00000005296), partial mRNA
          Length = 690

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 338 gtgcgcgagttcctggaggag 358
           |||||||||||||||||||||
Sbjct: 517 gtgcgcgagttcctggaggag 537



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 380     gtggtggacggcggcggcagcctgc 404
               |||||||||||||||||| ||||||
Sbjct: 4401007 gtggtggacggcggcggcggcctgc 4400983



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 374    gtgctggtggtggacggcggcggcagcct 402
              ||||| ||||||||||||||||| |||||
Sbjct: 870207 gtgcttgtggtggacggcggcgggagcct 870235


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 121,810,324
Number of extensions: 6997567
Number of successful extensions: 175018
Number of sequences better than 10.0: 104
Number of HSP's gapped: 175012
Number of HSP's successfully gapped: 115
Length of query: 833
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 811
Effective length of database: 18,508,616,841
Effective search space: 15010488258051
Effective search space used: 15010488258051
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top