ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf161e22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M35330.1|WHTREPTB T.monococcum aegilopoides repetitive DNA se... 50 0.010
2gb|AC161537.7| Mus musculus chromosome 15, clone RP23-471J11, co... 48 0.041
3gb|AC182767.3| Pan troglodytes BAC clone CH251-283B24 from chrom... 46 0.16
4gb|AC093136.3| Pan troglodytes clone RP43-116L11, complete sequence 46 0.16
5gb|AC006153.2| Homo sapiens BAC clone RP11-120J2 from 7, complet... 44 0.65
6gb|CP000481.1| Acidothermus cellulolyticus 11B, complete genome 42 2.6
7gb|AC183776.2| Pan troglodytes BAC clone CH251-246H3 from chromo... 42 2.6
8ref|XM_617538.2| PREDICTED: Bos taurus similar to Ryanodine rece... 42 2.6
9gb|AC147087.3| Pan troglodytes BAC clone RP43-59E13 from 7, comp... 42 2.6
10gb|AY522382.1| Secale cereale clone 16 tandem repeat region 42 2.6
11gb|AC161287.2| Pan troglodytes BAC clone CH251-267A11 from chrom... 42 2.6

>gb|M35330.1|WHTREPTB T.monococcum aegilopoides repetitive DNA sequence, clone pTbUCD2
          Length = 273
 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 560 tgtatgacttgagtgttggatcatgtgacccct 592
           |||||||||||||||| || |||||||||||||
Sbjct: 101 tgtatgacttgagtgtcgggtcatgtgacccct 133



to top

>gb|AC161537.7| Mus musculus chromosome 15, clone RP23-471J11, complete sequence
          Length = 188471

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 523   ttctgtacccagacatgttgtgct 546
             ||||||||||||||||||||||||
Sbjct: 87163 ttctgtacccagacatgttgtgct 87186



to top

>gb|AC182767.3| Pan troglodytes BAC clone CH251-283B24 from chromosome 7, complete
             sequence
          Length = 155153

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 290   gcccctccgtgttgttccttctc 312
             |||||||||||||||||||||||
Sbjct: 19223 gcccctccgtgttgttccttctc 19201



to top

>gb|AC093136.3| Pan troglodytes clone RP43-116L11, complete sequence
          Length = 179629

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 290   gcccctccgtgttgttccttctc 312
             |||||||||||||||||||||||
Sbjct: 28722 gcccctccgtgttgttccttctc 28744



to top

>gb|AC006153.2| Homo sapiens BAC clone RP11-120J2 from 7, complete sequence
          Length = 89678

 Score = 44.1 bits (22), Expect = 0.65
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 343   tgacattaatgaagagaggtac 364
             ||||||||||||||||||||||
Sbjct: 45130 tgacattaatgaagagaggtac 45109



to top

>gb|CP000481.1| Acidothermus cellulolyticus 11B, complete genome
          Length = 2443540

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 200    tcgagtccatcctcgtcgccg 220
              |||||||||||||||||||||
Sbjct: 660057 tcgagtccatcctcgtcgccg 660077



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 200    tcgagtccatcctcgtcgccg 220
              |||||||||||||||||||||
Sbjct: 667257 tcgagtccatcctcgtcgccg 667277



to top

>gb|AC183776.2| Pan troglodytes BAC clone CH251-246H3 from chromosome 7, complete
             sequence
          Length = 160056

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 343   tgacattaatgaagagaggta 363
             |||||||||||||||||||||
Sbjct: 13291 tgacattaatgaagagaggta 13311



to top

>ref|XM_617538.2| PREDICTED: Bos taurus similar to Ryanodine receptor 2 (Cardiac
            muscle-type ryanodine receptor) (RyR2) (RYR-2) (Cardiac
            muscle ryanodine receptor-calcium release channel)
            (hRYR-2) (LOC537376), partial mRNA
          Length = 13866

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 494  ttaggctctttcagccatttt 514
            |||||||||||||||||||||
Sbjct: 9188 ttaggctctttcagccatttt 9168



to top

>gb|AC147087.3| Pan troglodytes BAC clone RP43-59E13 from 7, complete sequence
          Length = 130280

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 343  tgacattaatgaagagaggta 363
            |||||||||||||||||||||
Sbjct: 2219 tgacattaatgaagagaggta 2239



to top

>gb|AY522382.1| Secale cereale clone 16 tandem repeat region
          Length = 984

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 560 tgtatgacttgagtgttggatcatgtgacccct 592
           ||||||||||| ||||||| ||||| |||||||
Sbjct: 287 tgtatgacttgtgtgttgggtcatgggacccct 319



to top

>gb|AC161287.2| Pan troglodytes BAC clone CH251-267A11 from chromosome 7, complete
             sequence
          Length = 166684

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 343   tgacattaatgaagagaggta 363
             |||||||||||||||||||||
Sbjct: 44130 tgacattaatgaagagaggta 44110


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 92,306,767
Number of extensions: 4538967
Number of successful extensions: 78474
Number of sequences better than 10.0: 11
Number of HSP's gapped: 78474
Number of HSP's successfully gapped: 12
Length of query: 682
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 660
Effective length of database: 18,508,616,841
Effective search space: 12215687115060
Effective search space used: 12215687115060
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top