ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf143a17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC091001.3| Papio anubis clone RP41-36M16, complete sequence 46 0.35
2gb|AC025048.8| Homo sapiens chromosome 17, clone CTD-2319I12, co... 46 0.35
3gb|AC161588.2| Mus musculus BAC clone RP24-447G12 from chromosom... 46 0.35
4gb|AY924304.1| Triticum aestivum serine/threonine protein kinase... 46 0.35
5gb|AC005702.1|AC005702 Homo sapiens chromosome 17, clone hRPK.17... 46 0.35
6gb|AF036693.1| Caenorhabditis elegans cosmid C49A9, complete seq... 44 1.4
7gb|AC130835.3| Mus musculus BAC clone RP24-132F18 from chromosom... 44 1.4
8ref|NM_068531.2| Caenorhabditis elegans C49A9.6 (C49A9.6) mRNA, ... 44 1.4
9gb|AC104423.4| Homo sapiens chromosome 18, clone RP11-1136J12, c... 44 1.4
10gb|AC090423.11| Homo sapiens Xp BAC RP11-86G5 (Roswell Park Canc... 44 1.4
11gb|AC008709.6| Homo sapiens chromosome 5 clone CTB-78O4, complet... 44 1.4
12gb|AC010275.6| Homo sapiens chromosome 5 clone CTC-499J9, comple... 44 1.4
13gb|AY170840.1| Axonopus compressus serine/threonine protein kina... 44 1.4
14gb|AC023090.12| Homo sapiens chromosome 18, clone RP11-800A18, c... 44 1.4
15gb|AC191656.2| Trichinella spiralis BAC clone TS195-10H12 from c... 42 5.5
16emb|CT027805.6| Zebrafish DNA sequence from clone CH211-212M6 in... 42 5.5
17gb|AC187043.1| Trichinella spiralis chromosome UNK clone TS195-3... 42 5.5
18ref|NM_001076437.1| Bos taurus hypothetical protein LOC616908 (L... 42 5.5
19ref|NM_118453.1| Arabidopsis thaliana ATP binding / protein kina... 42 5.5
20gb|AC093572.18| Pan troglodytes clone rp43-25g23, complete sequence 42 5.5
21gb|AC091907.4| Homo sapiens chromosome 5 clone RP11-195C11, comp... 42 5.5
22gb|AC160393.2| Mus musculus BAC clone RP23-136M3 from chromosome... 42 5.5
23emb|Z73121.1|SCYLL016W S.cerevisiae chromosome XII reading frame... 42 5.5
24emb|X97560.1|SC32KBF S.cerevisiae 32kb DNA fragment of chromosom... 42 5.5
25emb|X91488.1|SCCEN12RG S.cerevisiae DNA from CEN12 region includ... 42 5.5
26emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 42 5.5
27emb|AL022347.1|ATF21P8 Arabidopsis thaliana DNA chromosome 4, BA... 42 5.5
28gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, comple... 42 5.5
29gb|M26647.1|YSCSDC25 Saccharomyces cerevisiae SDC25 gene, comple... 42 5.5
30emb|BX323557.8| Zebrafish DNA sequence from clone DKEYP-86B9 in ... 42 5.5
31emb|BX072549.4| Zebrafish DNA sequence from clone CH211-114A17 i... 42 5.5
32gb|AC154658.2| Mus musculus BAC clone RP23-155K19 from 9, comple... 42 5.5
33emb|AL732610.16| Zebrafish DNA sequence from clone CH211-12N8, c... 42 5.5
34emb|AL831706.19| Mouse DNA sequence from clone RP23-74B12 on chr... 42 5.5

>gb|AC091001.3| Papio anubis clone RP41-36M16, complete sequence
          Length = 177066
 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 823   gtacaatggcgaaatctcggctc 845
             |||||||||||||||||||||||
Sbjct: 53125 gtacaatggcgaaatctcggctc 53103



to top

>gb|AC025048.8| Homo sapiens chromosome 17, clone CTD-2319I12, complete sequence
          Length = 137921

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 823   gtacaatggcgaaatctcggctc 845
             |||||||||||||||||||||||
Sbjct: 72608 gtacaatggcgaaatctcggctc 72630



to top

>gb|AC161588.2| Mus musculus BAC clone RP24-447G12 from chromosome 13, complete sequence
          Length = 211917

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1223   gatgaaaccaaatatttgcattc 1245
              |||||||||||||||||||||||
Sbjct: 110615 gatgaaaccaaatatttgcattc 110637



to top

>gb|AY924304.1| Triticum aestivum serine/threonine protein kinase gene, complete cds
          Length = 1525

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 833  gaaatctcggctcggtcagacatatatagtttagg 867
            |||| |||||| | |||||||||||||||||||||
Sbjct: 1043 gaaacctcggcccagtcagacatatatagtttagg 1077



 Score = 44.1 bits (22), Expect = 1.4
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 522 tctgctatgaatacttgcctaaggggagccttcacaataatctttttggt 571
           |||| |||||||| || || || ||||||||||| || ||||||||||||
Sbjct: 511 tctgttatgaatatttacccaatgggagccttcaaaagaatctttttggt 560



to top

>gb|AC005702.1|AC005702 Homo sapiens chromosome 17, clone hRPK.178_C_3, complete sequence
          Length = 147686

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 823   gtacaatggcgaaatctcggctc 845
             |||||||||||||||||||||||
Sbjct: 42630 gtacaatggcgaaatctcggctc 42652



to top

>gb|AF036693.1| Caenorhabditis elegans cosmid C49A9, complete sequence
          Length = 32061

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 552   ttcacaataatctttttggtga 573
             ||||||||||||||||||||||
Sbjct: 13503 ttcacaataatctttttggtga 13524



to top

>gb|AC130835.3| Mus musculus BAC clone RP24-132F18 from chromosome 19, complete sequence
          Length = 170078

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 43     tattcatctcagatctgaagtt 64
              ||||||||||||||||||||||
Sbjct: 104870 tattcatctcagatctgaagtt 104891



to top

>ref|NM_068531.2| Caenorhabditis elegans C49A9.6 (C49A9.6) mRNA, complete cds
          Length = 1278

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 552 ttcacaataatctttttggtga 573
           ||||||||||||||||||||||
Sbjct: 299 ttcacaataatctttttggtga 320



to top

>gb|AC104423.4| Homo sapiens chromosome 18, clone RP11-1136J12, complete sequence
          Length = 165451

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1272  ataaataagaaaagtattaatg 1293
             ||||||||||||||||||||||
Sbjct: 93104 ataaataagaaaagtattaatg 93083



to top

>gb|AC090423.11| Homo sapiens Xp BAC RP11-86G5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 104901

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 610   aataaagggaatatgtgaaggt 631
             ||||||||||||||||||||||
Sbjct: 52486 aataaagggaatatgtgaaggt 52507



to top

>gb|AC008709.6| Homo sapiens chromosome 5 clone CTB-78O4, complete sequence
          Length = 114421

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 1273  taaataagaaaagtattaatgaaaag 1298
             |||| |||||||||||||||||||||
Sbjct: 49358 taaagaagaaaagtattaatgaaaag 49333



to top

>gb|AC010275.6| Homo sapiens chromosome 5 clone CTC-499J9, complete sequence
          Length = 197255

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 1273  taaataagaaaagtattaatgaaaag 1298
             |||| |||||||||||||||||||||
Sbjct: 68914 taaagaagaaaagtattaatgaaaag 68939



to top

>gb|AY170840.1| Axonopus compressus serine/threonine protein kinase mRNA, partial
           cds
          Length = 345

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 847 gtcagacatatatagtttaggc 868
           ||||||||||||||||||||||
Sbjct: 51  gtcagacatatatagtttaggc 72



to top

>gb|AC023090.12| Homo sapiens chromosome 18, clone RP11-800A18, complete sequence
          Length = 180016

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1272   ataaataagaaaagtattaatg 1293
              ||||||||||||||||||||||
Sbjct: 167916 ataaataagaaaagtattaatg 167937



to top

>gb|AC191656.2| Trichinella spiralis BAC clone TS195-10H12 from chromosome unknown,
              complete sequence
          Length = 138882

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 740    tcgagaatattcggccaagat 760
              |||||||||||||||||||||
Sbjct: 105059 tcgagaatattcggccaagat 105079



to top

>emb|CT027805.6| Zebrafish DNA sequence from clone CH211-212M6 in linkage group 15,
             complete sequence
          Length = 197979

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1333  agttgcaaatatatttagttttact 1357
             |||||||||||||||| ||||||||
Sbjct: 76939 agttgcaaatatattttgttttact 76915



to top

>gb|AC187043.1| Trichinella spiralis chromosome UNK clone TS195-32H12, complete
             sequence
          Length = 123053

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 740   tcgagaatattcggccaagat 760
             |||||||||||||||||||||
Sbjct: 84331 tcgagaatattcggccaagat 84351



to top

>ref|NM_001076437.1| Bos taurus hypothetical protein LOC616908 (LOC616908), mRNA
 gb|BC114744.1| Bos taurus hypothetical protein LOC616908, mRNA (cDNA clone
            MGC:137927 IMAGE:8083369), complete cds
          Length = 3575

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1339 aaatatatttagttttacttt 1359
            |||||||||||||||||||||
Sbjct: 3536 aaatatatttagttttacttt 3516



to top

>ref|NM_118453.1| Arabidopsis thaliana ATP binding / protein kinase/ protein
           serine/threonine kinase/ protein-tyrosine kinase
           (AT4G23240) mRNA, complete cds
          Length = 1059

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 708 atatgaaaccgaaaattgcggattttggt 736
           ||||||| |||||||| ||||||||||||
Sbjct: 482 atatgaacccgaaaatcgcggattttggt 510



to top

>gb|AC093572.18| Pan troglodytes clone rp43-25g23, complete sequence
          Length = 195652

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 823   gtacaatggcgaaatctcggctcgg 847
             ||||||||||| |||||||||||||
Sbjct: 45711 gtacaatggcgcaatctcggctcgg 45735



to top

>gb|AC091907.4| Homo sapiens chromosome 5 clone RP11-195C11, complete sequence
          Length = 150401

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 630   gtatacattttctacatacct 650
             |||||||||||||||||||||
Sbjct: 56740 gtatacattttctacatacct 56720



to top

>gb|AC160393.2| Mus musculus BAC clone RP23-136M3 from chromosome 12, complete sequence
          Length = 215692

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 324   gtggggtggttgctgtgaagaaact 348
             ||||||| |||||||||||||||||
Sbjct: 87427 gtggggtcgttgctgtgaagaaact 87451



to top

>emb|Z73121.1|SCYLL016W S.cerevisiae chromosome XII reading frame ORF YLL016w
          Length = 3886

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1224 atgaaaccaaatatttgcatt 1244
            |||||||||||||||||||||
Sbjct: 592  atgaaaccaaatatttgcatt 572



to top

>emb|X97560.1|SC32KBF S.cerevisiae 32kb DNA fragment of chromosome XII, left arm
          Length = 32088

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1224  atgaaaccaaatatttgcatt 1244
             |||||||||||||||||||||
Sbjct: 22272 atgaaaccaaatatttgcatt 22252



to top

>emb|X91488.1|SCCEN12RG S.cerevisiae DNA from CEN12 region including ATS/APSG, SCD25, SOF1,
            DRS1, MMM1 and DNM1 genes
          Length = 43676

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1224 atgaaaccaaatatttgcatt 1244
            |||||||||||||||||||||
Sbjct: 1805 atgaaaccaaatatttgcatt 1785



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 708   atatgaaaccgaaaattgcggattttggt 736
             ||||||| |||||||| ||||||||||||
Sbjct: 14842 atatgaacccgaaaatcgcggattttggt 14814



to top

>emb|AL022347.1|ATF21P8 Arabidopsis thaliana DNA chromosome 4, BAC clone F21P8 (ESSA project)
          Length = 85785

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 708   atatgaaaccgaaaattgcggattttggt 736
             ||||||| |||||||| ||||||||||||
Sbjct: 49196 atatgaacccgaaaatcgcggattttggt 49168



to top

>gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, complete sequence
          Length = 172344

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1187   ataaagtaaaataagatcaat 1207
              |||||||||||||||||||||
Sbjct: 156111 ataaagtaaaataagatcaat 156091



to top

>gb|M26647.1|YSCSDC25 Saccharomyces cerevisiae SDC25 gene, complete cds
          Length = 5064

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1224 atgaaaccaaatatttgcatt 1244
            |||||||||||||||||||||
Sbjct: 1033 atgaaaccaaatatttgcatt 1013



to top

>emb|BX323557.8| Zebrafish DNA sequence from clone DKEYP-86B9 in linkage group 5,
             complete sequence
          Length = 223754

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1220  gatgatgaaaccaaatatttgcatt 1244
             ||||||||||||||||| |||||||
Sbjct: 30745 gatgatgaaaccaaataattgcatt 30721



to top

>emb|BX072549.4| Zebrafish DNA sequence from clone CH211-114A17 in linkage group 5,
             complete sequence
          Length = 167182

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1220  gatgatgaaaccaaatatttgcatt 1244
             ||||||||||||||||| |||||||
Sbjct: 67199 gatgatgaaaccaaataattgcatt 67175



to top

>gb|AC154658.2| Mus musculus BAC clone RP23-155K19 from 9, complete sequence
          Length = 205427

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 944    gatggagtaaaagaaaattgg 964
              |||||||||||||||||||||
Sbjct: 155213 gatggagtaaaagaaaattgg 155193



to top

>emb|AL732610.16| Zebrafish DNA sequence from clone CH211-12N8, complete sequence
          Length = 176982

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1224  atgaaaccaaatatttgcatt 1244
             |||||||||||||||||||||
Sbjct: 90882 atgaaaccaaatatttgcatt 90862



to top

>emb|AL831706.19| Mouse DNA sequence from clone RP23-74B12 on chromosome 2, complete
              sequence
          Length = 193178

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 958    aaattggacactggagaaaat 978
              |||||||||||||||||||||
Sbjct: 186593 aaattggacactggagaaaat 186613


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 286,554,388
Number of extensions: 15996909
Number of successful extensions: 326289
Number of sequences better than 10.0: 34
Number of HSP's gapped: 326289
Number of HSP's successfully gapped: 35
Length of query: 1434
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1411
Effective length of database: 18,503,978,556
Effective search space: 26109113742516
Effective search space used: 26109113742516
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top