>emb|BX017720.1|CNS08LU4 Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 3-PRIME end of
clone FK0AAA26DC01 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 617
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 563 ggaggagcaggagaagctgttca 541
>emb|BX017719.1|CNS08LU3 Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAA26DC01 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 838
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 764 ggaggagcaggagaagctgttca 786
>emb|BX017195.1|CNS08LFJ Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 3-PRIME end of
clone FK0AAA25DE01 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 740
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 548 ggaggagcaggagaagctgttca 526
>emb|BX017194.1|CNS08LFI Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAA25DE01 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 977
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 856 ggaggagcaggagaagctgttca 878
>emb|BX007670.1|CNS08E2Y Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 3-PRIME end of
clone FK0AAA12DB05 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 417
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 207 ggaggagcaggagaagctgttca 185
>emb|BX007669.1|CNS08E2X Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAA12DB05 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 925
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 755 ggaggagcaggagaagctgttca 777
>emb|BX005577.1|CNS08CGT Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 3-PRIME end of
clone FK0AAA1AE04 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 286
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 212 ggaggagcaggagaagctgttca 190
>emb|BX005576.1|CNS08CGS Single read from an extremity of a full-length cDNA clone made from
Anopheles gambiae total adult females. 5-PRIME end of
clone FK0AAA1AE04 of strain 6-9 of Anopheles gambiae
(African malaria mosquito)
Length = 972
Score = 46.1 bits (23), Expect = 0.27
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 467 ggaggagcaggagaagctgttca 489
|||||||||||||||||||||||
Sbjct: 846 ggaggagcaggagaagctgttca 868
>emb|AL078582.13|HSDJ130E4 Human DNA sequence from clone RP1-130E4 on chromosome 6q24.2-25.3
Contains the 3' end of the ESR1 gene for estrogen receptor
1, the 3' end of the synaptic nuclei expressed gene 1b
(SYNE-1) (nesprin-1 beta, MYNE1, SYNE1, KIAA0796),
complete sequence
Length = 108893
Score = 44.1 bits (22), Expect = 1.1
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 464 tgaggaggagcaggagaagctg 485
||||||||||||||||||||||
Sbjct: 73616 tgaggaggagcaggagaagctg 73637
>emb|AL133325.20| Human DNA sequence from clone RP5-984P4 on chromosome 20 Contains the
NKX2-2 gene for NK2 transcription factor related locus 2
(Drosophila), a hydroxysteroid (17-beta) dehydrogenase 12
(HSD17B12) pseudogene, the GSTM3P gene for glutathione
S-transferase M3 pseudogene, a novel gene and two CpG
islands, complete sequence
Length = 160013
Score = 42.1 bits (21), Expect = 4.2
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 265 cccgcgcggccgacgccgcca 285
|||||||||||||||||||||
Sbjct: 101607 cccgcgcggccgacgccgcca 101627
>gb|L10720.1|BPETOXOP Bordetella pertussis toxin liberation operon
Length = 9342
Score = 42.1 bits (21), Expect = 4.2
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 341 gcacgcgacgctggccaccgc 361
|||||||||||||||||||||
Sbjct: 2291 gcacgcgacgctggccaccgc 2311
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
Posted date: Dec 3, 2006 5:45 PM
Number of letters in database: 18,610,659,111
Number of sequences in database: 4,638,285
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 178,556,938
Number of extensions: 9395771
Number of successful extensions: 215253
Number of sequences better than 10.0: 79
Number of HSP's gapped: 215251
Number of HSP's successfully gapped: 118
Length of query: 1117
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1094
Effective length of database: 18,503,978,556
Effective search space: 20243352540264
Effective search space used: 20243352540264
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)