Clone Name	FLbaf142h02
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY103818.1| Zea mays PCO124949 mRNA sequence	424	e-115
2	gb|BT016262.1| Zea mays clone Contig95 mRNA sequence	416	e-113
3	ref|NM_001066035.1| Oryza sativa (japonica cultivar-group) Os07g...	392	e-105
4	dbj|AK061408.1| Oryza sativa (japonica cultivar-group) cDNA clon...	392	e-105
5	dbj|AK061383.1| Oryza sativa (japonica cultivar-group) cDNA clon...	392	e-105
6	dbj|AB037153.1| Oryza sativa (japonica cultivar-group) OsRPN12 m...	392	e-105
7	dbj|AK101316.1| Oryza sativa (japonica cultivar-group) cDNA clon...	385	e-103
8	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	151	7e-33
9	dbj|AP005200.4| Oryza sativa (japonica cultivar-group) genomic D...	151	7e-33
10	ref|NM_123569.1| Arabidopsis thaliana peptidase (AT5G42040) mRNA...	98	8e-17
11	gb|AY258413.1| Arabidopsis thaliana 26S proteasome subunit RPN12...	98	8e-17
12	dbj|AB017067.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	90	2e-14
13	ref|NM_105127.2| Arabidopsis thaliana peptidase (AT1G64520) mRNA...	66	3e-07
14	gb|AY230847.1| Arabidopsis thaliana 26S proteasome subunit RPN12...	66	3e-07
15	gb|AY230846.1| Arabidopsis thaliana 26S proteasome subunit RPN12...	66	3e-07
16	gb|AY143888.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, com...	66	3e-07
17	gb|AF410265.1|AF410265 Arabidopsis thaliana At1g64520/F1N19_10 m...	66	3e-07
18	gb|AY039857.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, com...	66	3e-07
19	gb|AC009519.4|AC009519 Genomic sequence for Arabidopsis thaliana...	66	3e-07
20	emb|BX816010.1|CNS0ABWV Arabidopsis thaliana Full-length cDNA Co...	66	3e-07
21	emb|BX815245.1|CNS0AAGS Arabidopsis thaliana Full-length cDNA Co...	66	3e-07
22	gb|DQ869862.1| Camellia sinensis 26S proteasome regulatory parti...	58	7e-05
23	dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone...	52	0.004
24	gb|AC113514.9| Mus musculus chromosome 19, clone RP23-475D11, co...	44	1.1
25	gb|AC116128.15| Mus musculus chromosome 19, clone RP23-95H3, com...	44	1.1
26	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	44	1.1
27	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	44	1.1
28	gb|DQ301516.1| Tubocapsicum anomalum LEAFY (LFY) gene, intron II...	42	4.3
29	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	42	4.3
30	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	42	4.3
31	gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome	42	4.3
32	ref|XM_816110.1| Trypanosoma cruzi strain CL Brener hypothetical...	42	4.3
33	ref|XM_809423.1| Trypanosoma cruzi strain CL Brener hypothetical...	42	4.3
34	gb|AC104122.2| Homo sapiens chromosome 5 clone RP11-410P18, comp...	42	4.3
35	emb|AL590398.9| Human DNA sequence from clone RP11-446G24 on chr...	42	4.3
36	emb|AL356234.18| Human DNA sequence from clone RP11-95M15 on chr...	42	4.3
37	emb|BX044529.1|CNS096IT Single read from an extremity of a full-...	42	4.3
38	emb|BX044528.1|CNS096IS Single read from an extremity of a full-...	42	4.3
39	emb|BX043538.1|CNS095RA Single read from an extremity of a full-...	42	4.3
40	emb|BX043537.1|CNS095R9 Single read from an extremity of a full-...	42	4.3
41	emb|BX040987.1|CNS093SF Single read from an extremity of a full-...	42	4.3
42	gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, comp...	42	4.3
43	emb|BX031771.1|CNS08WOF Single read from an extremity of a full-...	42	4.3
44	emb|BX031770.1|CNS08WOE Single read from an extremity of a full-...	42	4.3
45	emb|BX028549.1|CNS08U6X Single read from an extremity of a full-...	42	4.3
46	emb|BX028548.1|CNS08U6W Single read from an extremity of a full-...	42	4.3
47	emb|BX027525.1|CNS08TEH Single read from an extremity of a full-...	42	4.3
48	emb|BX027524.1|CNS08TEG Single read from an extremity of a full-...	42	4.3
49	emb|BX021496.1|CNS08OR0 Single read from an extremity of a full-...	42	4.3
50	emb|BX006225.1|CNS08CYT Single read from an extremity of a full-...	42	4.3
51	emb|BX006224.1|CNS08CYS Single read from an extremity of a full-...	42	4.3
52	gb|AC154014.4| Mus musculus 6 BAC RP24-409C18 (Roswell Park Canc...	42	4.3
53	gb|AC087349.17| Homo sapiens chromosome 8, clone RP11-339A23, co...	42	4.3
54	emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chro...	42	4.3
55	emb|AL606917.12| Mouse DNA sequence from clone RP23-25K8 on chro...	42	4.3

---

>gb|AY103818.1| Zea mays PCO124949 mRNA sequence
          Length = 1251
 Score =  424 bits (214), Expect = e-115
 Identities = 595/722 (82%)
 Strand = Plus / Plus

                                                                       
Query: 164 gaggtgacgcagctgttcgaacgcttcaaggcggcctgcaagcgcagcgatctcgacgcc 223
           |||||||| ||| ||||||  |||||||||||||||| |   |||| ||| ||| || ||
Sbjct: 227 gaggtgacccagatgttcgcccgcttcaaggcggcctacgcccgcaacgacctcaacacc 286

                                                                       
Query: 224 tccgcgaccctcctctcgcagctcaaggtgctcctcaccaagttccccagcctccctccg 283
           | ||  ||||||||||||||||||||||| |  |||||| | ||||||||||| || || 
Sbjct: 287 tgcgtcaccctcctctcgcagctcaaggtccatctcacccaattccccagccttccgccc 346

                                                                       
Query: 284 ctcttccagcagacgcccaacgccgtggaggagctcaagctcgcgagggaaatttatgag 343
            | || |||||||| || |||   |||||||||||||| || || ||||| |||||||||
Sbjct: 347 ttgtttcagcagacaccgaacattgtggaggagctcaaacttgcaagggacatttatgag 406

                                                                       
Query: 344 catgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggacttctgc 403
           ||||| ||| |||||||||||||| | || || |||||||| |||||| | || ||||||
Sbjct: 407 catgctgttgttttgagtgtgaaacttgaggaccaagatgcgtttgaacgcgatttctgc 466

                                                                       
Query: 404 cagctcaagccttattacatggacacatgtggcatacttcctccatcttcaatggagtac 463
           ||||| ||||||||||||||||| |||||||||||| ||||  | ||  ||  |||||||
Sbjct: 467 cagctgaagccttattacatggatacatgtggcataattcccgcctcgccagaggagtac 526

                                                                       
Query: 464 ccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccac 523
           |||||  |||| || || ||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 527 ccaattttgggactcaatcttctgaggctgttggttcagaatagaattgccgagttccac 586

                                                                       
Query: 524 actgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagcacggggtt 583
           ||||||||||||||| | || | ||| || || ||| || ||||||||||||| |  || 
Sbjct: 587 actgagctggagcttttacctgtcaaggcactcgagcatccttgcatcaagcatgctgta 646

                                                                       
Query: 584 gagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcggcaaacc 643
           ||||| ||||| ||||| |||||||| ||||||||||| ||| | |||||||||||  | 
Sbjct: 647 gagcttgagcaatccttcatggagggtgcctacaaccgagtgttaagcgctcggcaggct 706

                                                                       
Query: 644 gcaccgcatgagacctacgtatacttcatggaccttctcgccaaaacggttagagacgag 703
           |  || |||||||||||||| |||||||| ||||||||||||||||| |||||||| |||
Sbjct: 707 gtgccacatgagacctacgtttacttcatcgaccttctcgccaaaacagttagagatgag 766

                                                                       
Query: 704 atagctgggtgcagcgagaagggatatgattacctgtcaataagcgatgcgaagcagatg 763
           || |||||||||||||| ||||| |||||||  || ||  | || ||||| ||||| |||
Sbjct: 767 atcgctgggtgcagcgaaaaggggtatgattctctatctgtgagtgatgcaaagcaaatg 826

                                                                       
Query: 764 tttatgttcagctccgacaaggaactgcagcagtacatcgcagaggaacaccccgagtgg 823
            |||||||||| || ||| | || |||||  |||||||| | ||||| ||||| || |||
Sbjct: 827 cttatgttcagttctgaccaagatctgcacgagtacatcactgaggagcacccggaatgg 886

                                                                       
Query: 824 gatgtcaaggacggcagcgtcttgttccagaaggcgaaggagtcgcagccctgcaaggag 883
           ||  | ||| ||||    ||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 887 gagattaagaacggtgctgtcttcttccagaaggcgaaggagtcacagccctgcaaggag 946

             
Query: 884 at 885
           ||
Sbjct: 947 at 948

---

>gb|BT016262.1| Zea mays clone Contig95 mRNA sequence
          Length = 1020

 Score =  416 bits (210), Expect = e-113
 Identities = 594/722 (82%)
 Strand = Plus / Plus

                                                                       
Query: 164 gaggtgacgcagctgttcgaacgcttcaaggcggcctgcaagcgcagcgatctcgacgcc 223
           |||||||| ||| ||||||  |||||||||||||||| |   |||| ||| ||| || ||
Sbjct: 21  gaggtgacccagatgttcgcccgcttcaaggcggcctacgcccgcaacgacctcaacacc 80

                                                                       
Query: 224 tccgcgaccctcctctcgcagctcaaggtgctcctcaccaagttccccagcctccctccg 283
           | ||  ||||||||||||||||||||||| |  |||||| | ||||||||||| || || 
Sbjct: 81  tgcgtcaccctcctctcgcagctcaaggtccatctcacccaattccccagccttccgccc 140

                                                                       
Query: 284 ctcttccagcagacgcccaacgccgtggaggagctcaagctcgcgagggaaatttatgag 343
            | || |||||||| || |||   |||||||||||||| || || ||||| |||||||||
Sbjct: 141 ttgtttcagcagacaccgaacattgtggaggagctcaaacttgcaagggacatttatgag 200

                                                                       
Query: 344 catgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggacttctgc 403
           ||||| ||| |||||||||||||| | || || |||||||| |||||| | || ||||||
Sbjct: 201 catgctgttgttttgagtgtgaaacttgaggaccaagatgcgtttgaacgcgatttctgc 260

                                                                       
Query: 404 cagctcaagccttattacatggacacatgtggcatacttcctccatcttcaatggagtac 463
           ||||| ||||||||||||||||| |||||||||||| ||||  | ||  ||  |||||||
Sbjct: 261 cagctgaagccttattacatggatacatgtggcataattcccgcctcgccagaggagtac 320

                                                                       
Query: 464 ccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccac 523
           |||||  |||| || || ||||||||||||||||| |||||||||||||| || ||||||
Sbjct: 321 ccaattttgggactcaatcttctgaggctgttggttcagaatagaattgccgaattccac 380

                                                                       
Query: 524 actgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagcacggggtt 583
           ||||||||||||||| | || ||||| || || ||| || ||||||||||||| |  || 
Sbjct: 381 actgagctggagcttttacctgccaaggcactcgagcatccttgcatcaagcatgctgta 440

                                                                       
Query: 584 gagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcggcaaacc 643
           ||||| ||||| ||||| |||||||| ||||||||||| ||| | |||||||||||  | 
Sbjct: 441 gagcttgagcaatccttcatggagggtgcctacaaccgagtgttaagcgctcggcaggct 500

                                                                       
Query: 644 gcaccgcatgagacctacgtatacttcatggaccttctcgccaaaacggttagagacgag 703
           |  || |||||||||||||| |||||||| ||||||||||||||||| |||||||| |||
Sbjct: 501 gtgccacatgagacctacgtttacttcatcgaccttctcgccaaaacagttagagatgag 560

                                                                       
Query: 704 atagctgggtgcagcgagaagggatatgattacctgtcaataagcgatgcgaagcagatg 763
           || |||||||||||||| ||||| |||||||  || ||  | || ||||| ||||| |||
Sbjct: 561 atcgctgggtgcagcgaaaaggggtatgattctctatctgtgagtgatgcaaagcaaatg 620

                                                                       
Query: 764 tttatgttcagctccgacaaggaactgcagcagtacatcgcagaggaacaccccgagtgg 823
            |||||||||| || ||| | || |||||  |||||||| | ||||| ||||| || |||
Sbjct: 621 cttatgttcagttctgaccaagatctgcacgagtacatcactgaggagcacccggaatgg 680

                                                                       
Query: 824 gatgtcaaggacggcagcgtcttgttccagaaggcgaaggagtcgcagccctgcaaggag 883
           ||  | ||| ||||    ||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 681 gagattaagaacggtgctgtcttcttccagaaggcgaaggaatcacagccctgcaaggag 740

             
Query: 884 at 885
           ||
Sbjct: 741 at 742

---

>ref|NM_001066035.1| Oryza sativa (japonica cultivar-group) Os07g0435100 (Os07g0435100)
           mRNA, complete cds
          Length = 1230

 Score =  392 bits (198), Expect = e-105
 Identities = 537/650 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 298
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 185 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 244

                                                                       
Query: 299 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 358
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 245 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 304

                                                                       
Query: 359 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 418
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 305 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 364

                                                                       
Query: 419 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 478
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 365 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 424

                                                                       
Query: 479 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 538
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 425 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 484

                                                                       
Query: 539 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 598
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 485 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 544

                                                                       
Query: 599 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 658
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 545 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 604

                                                                       
Query: 659 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 718
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 605 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 664

                                                                       
Query: 719 gagaagggatatgattacctgtcaataagcgatgcgaagcagatgtttatgttcagctcc 778
           |||||||| ||||||||  ||||||||   || || |  ||  || | ||||||||||| 
Sbjct: 665 gagaagggttatgattatatgtcaatagctgaagcaagacaagtgctgatgttcagctct 724

                                                                       
Query: 779 gacaaggaactgcagcagtacatcgcagaggaacaccccgagtgggatgtcaaggacggc 838
           ||||| ||| |||| ||||||||||||||||| ||||| || ||||| || ||||| || 
Sbjct: 725 gacaaagaattgcaccagtacatcgcagaggagcaccctgaatgggaggtaaaggatggt 784

                                                             
Query: 839 agcgtcttgttccagaaggcgaaggagtcgcagccctgcaaggagatacc 888
             |||||| |||||||||||||||||| | ||||||||||||||||||||
Sbjct: 785 tccgtcttcttccagaaggcgaaggagacccagccctgcaaggagatacc 834



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 146 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 200
           |||||||||||| ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 92  atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 146

---

>dbj|AK061408.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-A10, full
           insert sequence
          Length = 1053

 Score =  392 bits (198), Expect = e-105
 Identities = 537/650 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 298
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 173 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 232

                                                                       
Query: 299 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 358
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 233 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 292

                                                                       
Query: 359 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 418
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 293 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 352

                                                                       
Query: 419 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 478
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 353 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 412

                                                                       
Query: 479 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 538
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 413 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 472

                                                                       
Query: 539 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 598
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 473 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 532

                                                                       
Query: 599 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 658
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 533 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 592

                                                                       
Query: 659 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 718
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 593 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 652

                                                                       
Query: 719 gagaagggatatgattacctgtcaataagcgatgcgaagcagatgtttatgttcagctcc 778
           |||||||| ||||||||  ||||||||   || || |  ||  || | ||||||||||| 
Sbjct: 653 gagaagggttatgattatatgtcaatagctgaagcaagacaagtgctgatgttcagctct 712

                                                                       
Query: 779 gacaaggaactgcagcagtacatcgcagaggaacaccccgagtgggatgtcaaggacggc 838
           ||||| ||| |||| ||||||||||||||||| ||||| || ||||| || ||||| || 
Sbjct: 713 gacaaagaattgcaccagtacatcgcagaggagcaccctgaatgggaggtaaaggatggt 772

                                                             
Query: 839 agcgtcttgttccagaaggcgaaggagtcgcagccctgcaaggagatacc 888
             |||||| |||||||||||||||||| | ||||||||||||||||||||
Sbjct: 773 tccgtcttcttccagaaggcgaaggagacccagccctgcaaggagatacc 822



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 146 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 200
           |||||||||||| ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 80  atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 134

---

>dbj|AK061383.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-H08, full
           insert sequence
          Length = 1230

 Score =  392 bits (198), Expect = e-105
 Identities = 537/650 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 298
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 185 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 244

                                                                       
Query: 299 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 358
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 245 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 304

                                                                       
Query: 359 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 418
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 305 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 364

                                                                       
Query: 419 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 478
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 365 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 424

                                                                       
Query: 479 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 538
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 425 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 484

                                                                       
Query: 539 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 598
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 485 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 544

                                                                       
Query: 599 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 658
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 545 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 604

                                                                       
Query: 659 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 718
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 605 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 664

                                                                       
Query: 719 gagaagggatatgattacctgtcaataagcgatgcgaagcagatgtttatgttcagctcc 778
           |||||||| ||||||||  ||||||||   || || |  ||  || | ||||||||||| 
Sbjct: 665 gagaagggttatgattatatgtcaatagctgaagcaagacaagtgctgatgttcagctct 724

                                                                       
Query: 779 gacaaggaactgcagcagtacatcgcagaggaacaccccgagtgggatgtcaaggacggc 838
           ||||| ||| |||| ||||||||||||||||| ||||| || ||||| || ||||| || 
Sbjct: 725 gacaaagaattgcaccagtacatcgcagaggagcaccctgaatgggaggtaaaggatggt 784

                                                             
Query: 839 agcgtcttgttccagaaggcgaaggagtcgcagccctgcaaggagatacc 888
             |||||| |||||||||||||||||| | ||||||||||||||||||||
Sbjct: 785 tccgtcttcttccagaaggcgaaggagacccagccctgcaaggagatacc 834



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 146 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 200
           |||||||||||| ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 92  atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 146

---

>dbj|AB037153.1| Oryza sativa (japonica cultivar-group) OsRPN12 mRNA for 26S
           proteasome regulatory particle non-ATPase subunit12,
           complete cds
          Length = 1063

 Score =  392 bits (198), Expect = e-105
 Identities = 537/650 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 298
           |||||||||||||| | ||||||||||||||||||||| |||||    || |||||||| 
Sbjct: 169 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 228

                                                                       
Query: 299 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 358
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 229 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 288

                                                                       
Query: 359 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 418
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 289 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 348

                                                                       
Query: 419 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 478
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 349 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 408

                                                                       
Query: 479 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 538
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 409 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 468

                                                                       
Query: 539 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 598
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 469 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 528

                                                                       
Query: 599 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 658
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 529 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 588

                                                                       
Query: 659 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 718
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 589 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 648

                                                                       
Query: 719 gagaagggatatgattacctgtcaataagcgatgcgaagcagatgtttatgttcagctcc 778
           |||||||| ||||||||  ||||||||   || || |  ||  || | ||||||||||| 
Sbjct: 649 gagaagggttatgattatatgtcaatagctgaagcaagacaagtgctgatgttcagctct 708

                                                                       
Query: 779 gacaaggaactgcagcagtacatcgcagaggaacaccccgagtgggatgtcaaggacggc 838
           ||||| ||| |||| ||||||||||||||||| ||||| || ||||| || ||||| || 
Sbjct: 709 gacaaagaattgcaccagtacatcgcagaggagcaccctgaatgggaggtaaaggatggt 768

                                                             
Query: 839 agcgtcttgttccagaaggcgaaggagtcgcagccctgcaaggagatacc 888
             |||||| |||||||||||||||||| | ||||||||||||||||||||
Sbjct: 769 tccgtcttcttccagaaggcgaaggagacccagccctgcaaggagatacc 818



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 146 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 200
           |||||||||||| ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 76  atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 130

---

>dbj|AK101316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034D03, full
           insert sequence
          Length = 1218

 Score =  385 bits (194), Expect = e-103
 Identities = 536/650 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 298
           |||||||||||||| | ||||||||||||||| ||||| |||||    || |||||||| 
Sbjct: 174 tcgcagctcaaggtccgcctcaccaagttcccaagccttcctccatcatttcagcagaca 233

                                                                       
Query: 299 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 358
           || || || ||||| ||||| ||  | |||||||| || ||||||||||||||| || ||
Sbjct: 234 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 293

                                                                       
Query: 359 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 418
           ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 294 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 353

                                                                       
Query: 419 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 478
           |||||||| ||||| |||||| |||| |||||  ||  |||||| |||||| |||| |||
Sbjct: 354 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 413

                                                                       
Query: 479 aaccttctgaggctgttggtccagaatagaattgcggagttccacactgagctggagctt 538
           || ||||| |||||||| || ||||| |||||||| |||||||||||||||||||| |||
Sbjct: 414 aatcttctaaggctgttagttcagaacagaattgcagagttccacactgagctggaactt 473

                                                                       
Query: 539 ctgcccgccaaagcgctggagaatgcttgcatcaagcacggggttgagctcgagcagtcc 598
           ||||| | || ||| || || ||| ||||||||||||| | ||| ||||| |||||||| 
Sbjct: 474 ctgccggtcacagcacttgaaaatccttgcatcaagcatgcggtggagcttgagcagtca 533

                                                                       
Query: 599 tttatggagggcgcctacaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacc 658
           ||||||||||| || |||||||| ||| |||||||||| ||  | |  || || || || 
Sbjct: 534 tttatggagggtgcttacaaccgagtgttgagcgctcgccaggctgtgccccacgaaaca 593

                                                                       
Query: 659 tacgtatacttcatggaccttctcgccaaaacggttagagacgagatagctgggtgcagc 718
           || || ||||||||||| ||||| |||||||| || ||||| ||  | ||||| ||||| 
Sbjct: 594 tatgtgtacttcatggatcttcttgccaaaacagtcagagatgaactggctggttgcagt 653

                                                                       
Query: 719 gagaagggatatgattacctgtcaataagcgatgcgaagcagatgtttatgttcagctcc 778
           |||||||| ||||||||  ||||||||   || || |  ||  || | ||||||||||| 
Sbjct: 654 gagaagggttatgattatatgtcaatagctgaagcaagacaagtgctgatgttcagctct 713

                                                                       
Query: 779 gacaaggaactgcagcagtacatcgcagaggaacaccccgagtgggatgtcaaggacggc 838
           ||||| ||| |||| ||||||||||||||||| ||||| || ||||| || ||||| || 
Sbjct: 714 gacaaagaattgcaccagtacatcgcagaggagcaccctgaatgggaggtaaaggatggt 773

                                                             
Query: 839 agcgtcttgttccagaaggcgaaggagtcgcagccctgcaaggagatacc 888
             |||||| |||||||||||||||||| | ||||||||||||||||||||
Sbjct: 774 tccgtcttcttccagaaggcgaaggagacccagccctgcaaggagatacc 823



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 146 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 200
           |||||||||||| ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 81  atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 135

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score =  151 bits (76), Expect = 7e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                            
Query: 457      ggagtacccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcgga 516
                |||||| |||||| |||| ||||| ||||| |||||||| || ||||| |||||||| ||
Sbjct: 14474888 ggagtatccaatcttgggtcttaatcttctaaggctgttagttcagaacagaattgcaga 14474829

                                                                            
Query: 517      gttccacactgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagca 576
                |||||||||||||||||| |||||||| | || ||| || || ||| |||||||||||||
Sbjct: 14474828 gttccacactgagctggaacttctgccggtcacagcacttgaaaatccttgcatcaagca 14474769

                                                                            
Query: 577      cggggttgagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcg 636
                 | ||| ||||| |||||||| ||||||||||| || |||||||| ||| ||||||||||
Sbjct: 14474768 tgcggtggagcttgagcagtcatttatggagggtgcttacaaccgagtgttgagcgctcg 14474709



 Score =  117 bits (59), Expect = 9e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                            
Query: 338      tatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggac 397
                ||||||||||||||| || ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 14475455 tatgagcatgcagttgttctgagtgtgaaaattgaagaccaagatgcatttgaaagggac 14475396

                                                   
Query: 398      ttctgccagctcaagccttattacatggacacatg 432
                || || || ||||| |||||||||||||| |||||
Sbjct: 14475395 ttttgtcaactcaaaccttattacatggatacatg 14475361



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 841      cgtcttgttccagaaggcgaaggagtcgcagccctgcaaggagatacc 888
                |||||| |||||||||||||||||| | ||||||||||||||||||||
Sbjct: 14474314 cgtcttcttccagaaggcgaaggagacccagccctgcaaggagatacc 14474267



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                       
Query: 146      atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 200
                |||||||||||| ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 14476852 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 14476798



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                           
Query: 767      atgttcagctccgacaaggaactgcagcagtacatcgcagagg 809
                ||||||||||| ||||| ||| |||| ||||||||||||||||
Sbjct: 14474470 atgttcagctctgacaaagaattgcaccagtacatcgcagagg 14474428



 Score = 46.1 bits (23), Expect = 0.28
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 256      cctcaccaagttccccagcctccctcc 282
                ||||||||||||||||||||| |||||
Sbjct: 14476273 cctcaccaagttccccagccttcctcc 14476247

---

>dbj|AP005200.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0673E01
          Length = 125909

 Score =  151 bits (76), Expect = 7e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                         
Query: 457   ggagtacccaatcatggggcttaaccttctgaggctgttggtccagaatagaattgcgga 516
             |||||| |||||| |||| ||||| ||||| |||||||| || ||||| |||||||| ||
Sbjct: 95219 ggagtatccaatcttgggtcttaatcttctaaggctgttagttcagaacagaattgcaga 95160

                                                                         
Query: 517   gttccacactgagctggagcttctgcccgccaaagcgctggagaatgcttgcatcaagca 576
             |||||||||||||||||| |||||||| | || ||| || || ||| |||||||||||||
Sbjct: 95159 gttccacactgagctggaacttctgccggtcacagcacttgaaaatccttgcatcaagca 95100

                                                                         
Query: 577   cggggttgagctcgagcagtcctttatggagggcgcctacaaccgtgtgctgagcgctcg 636
              | ||| ||||| |||||||| ||||||||||| || |||||||| ||| ||||||||||
Sbjct: 95099 tgcggtggagcttgagcagtcatttatggagggtgcttacaaccgagtgttgagcgctcg 95040



 Score =  117 bits (59), Expect = 9e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                         
Query: 338   tatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggac 397
             ||||||||||||||| || ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 95786 tatgagcatgcagttgttctgagtgtgaaaattgaagaccaagatgcatttgaaagggac 95727

                                                
Query: 398   ttctgccagctcaagccttattacatggacacatg 432
             || || || ||||| |||||||||||||| |||||
Sbjct: 95726 ttttgtcaactcaaaccttattacatggatacatg 95692



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 841   cgtcttgttccagaaggcgaaggagtcgcagccctgcaaggagatacc 888
             |||||| |||||||||||||||||| | ||||||||||||||||||||
Sbjct: 94645 cgtcttcttccagaaggcgaaggagacccagccctgcaaggagatacc 94598



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 146   atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 200
             |||||||||||| ||||||||||||||||||| |||   ||||||||||| ||||
Sbjct: 97183 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 97129



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 767   atgttcagctccgacaaggaactgcagcagtacatcgcagagg 809
             ||||||||||| ||||| ||| |||| ||||||||||||||||
Sbjct: 94801 atgttcagctctgacaaagaattgcaccagtacatcgcagagg 94759



 Score = 46.1 bits (23), Expect = 0.28
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 256   cctcaccaagttccccagcctccctcc 282
             ||||||||||||||||||||| |||||
Sbjct: 96604 cctcaccaagttccccagccttcctcc 96578

---

>ref|NM_123569.1| Arabidopsis thaliana peptidase (AT5G42040) mRNA, complete cds
          Length = 480

 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                       
Query: 555 tggagaatgcttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcct 614
           |||||||| ||||||||||||| | ||| ||||||||||| ||||| ||||| || || |
Sbjct: 86  tggagaatccttgcatcaagcatgcggtggagctcgagcaatccttcatggaaggtgctt 145

                                                                       
Query: 615 acaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacctacgtatacttcatgg 674
           | ||||||||| |||| ||| | |||||||||||  ||||||| ||||| || |||||||
Sbjct: 146 ataaccgtgtgttgagtgctagacaaaccgcacctgatgagacttacgtctatttcatgg 205

                                                            
Query: 675 accttctcgccaaaacggttagagacgagatagctgggtgcagcgagaa 723
           | ||  | || |||||  ||||||| || |||||||| ||||| |||||
Sbjct: 206 atctcttggcaaaaaccattagagatgaaatagctggatgcagtgagaa 254

---

>gb|AY258413.1| Arabidopsis thaliana 26S proteasome subunit RPN12b (RPN12b) mRNA,
           complete cds
          Length = 480

 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 139/169 (82%)
 Strand = Plus / Plus

                                                                       
Query: 555 tggagaatgcttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcct 614
           |||||||| ||||||||||||| | ||| ||||||||||| ||||| ||||| || || |
Sbjct: 86  tggagaatccttgcatcaagcatgcggtggagctcgagcaatccttcatggaaggtgctt 145

                                                                       
Query: 615 acaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacctacgtatacttcatgg 674
           | ||||||||| |||| ||| | |||||||||||  ||||||| ||||| || |||||||
Sbjct: 146 ataaccgtgtgttgagtgctagacaaaccgcacctgatgagacttacgtctatttcatgg 205

                                                            
Query: 675 accttctcgccaaaacggttagagacgagatagctgggtgcagcgagaa 723
           | ||  | || |||||  ||||||| || |||||||| ||||| |||||
Sbjct: 206 atctcttggcaaaaaccattagagatgaaatagctggatgcagtgagaa 254

---

>dbj|AB017067.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20
          Length = 83689

 Score = 89.7 bits (45), Expect = 2e-14
 Identities = 102/121 (84%)
 Strand = Plus / Minus

                                                                         
Query: 555   tggagaatgcttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcct 614
             |||||||| ||||||||||||| | ||| ||||||||||| ||||| ||||| || || |
Sbjct: 36544 tggagaatccttgcatcaagcatgcggtggagctcgagcaatccttcatggaaggtgctt 36485

                                                                         
Query: 615   acaaccgtgtgctgagcgctcggcaaaccgcaccgcatgagacctacgtatacttcatgg 674
             | ||||||||| |||| ||| | |||||||||||  ||||||| ||||| || |||||||
Sbjct: 36484 ataaccgtgtgttgagtgctagacaaaccgcacctgatgagacttacgtctatttcatgg 36425

              
Query: 675   a 675
             |
Sbjct: 36424 a 36424

---

>ref|NM_105127.2| Arabidopsis thaliana peptidase (AT1G64520) mRNA, complete cds
          Length = 1063

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 387 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 446

            
Query: 531 t 531
           |
Sbjct: 447 t 447



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 480 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 539

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 540 tgttgag 546



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 245 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 304

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 305 gagagagatttcttccagctgaaacctta 333

---

>gb|AY230847.1| Arabidopsis thaliana 26S proteasome subunit RPN12 (RPN12) mRNA,
           RPN12-2 allele, complete cds
          Length = 1054

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 359 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 418

            
Query: 531 t 531
           |
Sbjct: 419 t 419



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 452 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 511

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 512 tgttgag 518



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 217 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 276

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 277 gagagagatttcttccagctgaaacctta 305

---

>gb|AY230846.1| Arabidopsis thaliana 26S proteasome subunit RPN12 (RPN12) mRNA,
           RPN12-1 allele, complete cds
          Length = 1038

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 349 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 408

            
Query: 531 t 531
           |
Sbjct: 409 t 409



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 442 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 501

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 502 tgttgag 508



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 207 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 266

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 267 gagagagatttcttccagctgaaacctta 295

---

>gb|AY143888.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds
          Length = 804

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 326 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 385

            
Query: 531 t 531
           |
Sbjct: 386 t 386



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 419 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 478

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 479 tgttgag 485



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 184 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 243

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 244 gagagagatttcttccagctgaaacctta 272

---

>gb|AF410265.1|AF410265 Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds
          Length = 1008

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 372 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 431

            
Query: 531 t 531
           |
Sbjct: 432 t 432



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 465 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 524

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 525 tgttgag 531



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 230 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 289

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 290 gagagagatttcttccagctgaaacctta 318

---

>gb|AY039857.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds
          Length = 953

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 335 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 394

            
Query: 531 t 531
           |
Sbjct: 395 t 395



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 428 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 487

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 488 tgttgag 494



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 193 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 252

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 253 gagagagatttcttccagctgaaacctta 281

---

>gb|AC009519.4|AC009519 Genomic sequence for Arabidopsis thaliana BAC F1N19 from chromosome I,
             complete sequence
          Length = 113172

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                         
Query: 471   tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
             |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 25746 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 25805

              
Query: 531   t 531
             |
Sbjct: 25806 t 25806



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                         
Query: 564   cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
             ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 25839 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 25898

                    
Query: 624   tgctgag 630
             || ||||
Sbjct: 25899 tgttgag 25905

---

>emb|BX816010.1|CNS0ABWV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZE10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 379 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 438

            
Query: 531 t 531
           |
Sbjct: 439 t 439



 Score = 46.1 bits (23), Expect = 0.28
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||| | ||||| |||||||| ||||| |||||||
Sbjct: 472 cttgcatcaagcatgcagtagagcttgagaaatccttcatggagggtgcctataaccgtg 531

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 532 tgttgag 538



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 237 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 296

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 297 gagagagatttcttccagctgaaacctta 325

---

>emb|BX815245.1|CNS0AAGS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS46ZA05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1025

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                       
Query: 471 tggggcttaaccttctgaggctgttggtccagaatagaattgcggagttccacactgagc 530
           |||| |||||||||||||||||| |||| || ||||||||||| || |||||||| ||||
Sbjct: 368 tgggtcttaaccttctgaggctgctggtacaaaatagaattgctgaattccacaccgagc 427

            
Query: 531 t 531
           |
Sbjct: 428 t 428



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 564 cttgcatcaagcacggggttgagctcgagcagtcctttatggagggcgcctacaaccgtg 623
           ||||||||||||| |  || ||||| ||||| ||||| |||||||| ||||| |||||||
Sbjct: 461 cttgcatcaagcatgcagtagagcttgagcaatccttcatggagggtgcctataaccgtg 520

                  
Query: 624 tgctgag 630
           || ||||
Sbjct: 521 tgttgag 527



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| |||||||||||||| ||| || | || || ||||  || ||||||||||| |||
Sbjct: 226 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 285

                                        
Query: 389 gaaagggacttctgccagctcaagcctta 417
           || || || |||| |||||| || |||||
Sbjct: 286 gagagagatttcttccagctgaaacctta 314

---

>gb|DQ869862.1| Camellia sinensis 26S proteasome regulatory particle non-ATPase
           subunit 12 mRNA, complete cds
          Length = 1145

 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 329 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 388
           ||||| || ||||||||||| ||| ||||||||||||| || || ||||| ||||| |||
Sbjct: 277 agggatatatatgagcatgctgttgttttgagtgtgaagattgaggatcaggatgccttt 336

                        
Query: 389 gaaagggacttct 401
           || ||||| ||||
Sbjct: 337 gagagggatttct 349

---

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 359   agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 418
             ||||||||||  || ||||||||||| ||||| ||||| |||| |||||| || ||||||
Sbjct: 83685 agtgtgaaaactgaggatcaagatgcctttgagagggatttcttccagctgaaaccttat 83626

               
Query: 419   ta 420
             ||
Sbjct: 83625 ta 83624

---

>gb|AC113514.9| Mus musculus chromosome 19, clone RP23-475D11, complete sequence
          Length = 170366

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 261    ccaagttccccagcctccctcc 282
              ||||||||||||||||||||||
Sbjct: 125636 ccaagttccccagcctccctcc 125657

---

>gb|AC116128.15| Mus musculus chromosome 19, clone RP23-95H3, complete sequence
          Length = 228363

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 261   ccaagttccccagcctccctcc 282
             ||||||||||||||||||||||
Sbjct: 13756 ccaagttccccagcctccctcc 13777

---

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 178     gttcgaacgcttcaaggcggcc 199
               ||||||||||||||||||||||
Sbjct: 4901285 gttcgaacgcttcaaggcggcc 4901264



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 893     gcgcccgtcatcaaccagacccttg 917
               |||||||||||| ||||||||||||
Sbjct: 4808951 gcgcccgtcatcgaccagacccttg 4808975

---

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 178     gttcgaacgcttcaaggcggcc 199
               ||||||||||||||||||||||
Sbjct: 4904302 gttcgaacgcttcaaggcggcc 4904281



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 893     gcgcccgtcatcaaccagacccttg 917
               |||||||||||| ||||||||||||
Sbjct: 4813862 gcgcccgtcatcgaccagacccttg 4813886

---

>gb|DQ301516.1| Tubocapsicum anomalum LEAFY (LFY) gene, intron II and partial cds
          Length = 1109

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 983  tttcccatgaagaggtggattattg 1007
            |||||||||||||||| ||||||||
Sbjct: 370  tttcccatgaagaggtagattattg 346

---

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 166     ggtgacgcagctgttcgaacgcttc 190
               |||||||||| ||||||||||||||
Sbjct: 2624545 ggtgacgcagttgttcgaacgcttc 2624521

---

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 180    tcgaacgcttcaaggcggcctgcaagcgc 208
              ||||||||||| ||||||| |||||||||
Sbjct: 411439 tcgaacgcttcgaggcggcgtgcaagcgc 411411

---

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 303     acgccgtggaggagctcaagctcgc 327
               |||||||||| ||||||||||||||
Sbjct: 2316349 acgccgtggatgagctcaagctcgc 2316373

---

>ref|XM_816110.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053510329.260) partial mRNA
          Length = 4551

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 772 cagctccgacaaggaactgcagcag 796
           |||||||||||||||||||| ||||
Sbjct: 939 cagctccgacaaggaactgcggcag 963

---

>ref|XM_809423.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053507257.50) partial mRNA
          Length = 5997

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 772 cagctccgacaaggaactgcagcag 796
           |||||||||||||||||||| ||||
Sbjct: 939 cagctccgacaaggaactgcggcag 963



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 772  cagctccgacaaggaactgcagcag 796
            |||||||||||||||||||| ||||
Sbjct: 1662 cagctccgacaaggaactgcggcag 1686



 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 772  cagctccgacaaggaactgcagcag 796
            |||||||||||||||||||| ||||
Sbjct: 2385 cagctccgacaaggaactgcggcag 2409

---

>gb|AC104122.2| Homo sapiens chromosome 5 clone RP11-410P18, complete sequence
          Length = 142636

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   aagatcaagatgcatttgaaa 392
             |||||||||||||||||||||
Sbjct: 45212 aagatcaagatgcatttgaaa 45192

---

>emb|AL590398.9| Human DNA sequence from clone RP11-446G24 on chromosome 6 Contains the
             5' end of the HDAC2 gene for histone deacetylase 2 (human
             transcriptional regulator homolog RPD3, YAF1), two
             putative novel genes, a pseudogene similar to mouse D7Rp2e
             (DNA segment, Chr7, Roswell Park 2 complex, expressed) and
             a CpG island, complete sequence
          Length = 78366

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 950   tttgcctctcttttctttcaa 970
             |||||||||||||||||||||
Sbjct: 12937 tttgcctctcttttctttcaa 12917

---

>emb|AL356234.18| Human DNA sequence from clone RP11-95M15 on chromosome 6 Contains a
             novel gene and a protein tyrosine phosphatase non-receptor
             type 11 (Nooan syndrome) (PTPN11) pseudogene, complete
             sequence
          Length = 115224

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 376   tcaagatgcatttgaaaggga 396
             |||||||||||||||||||||
Sbjct: 56493 tcaagatgcatttgaaaggga 56473

---

>emb|BX044529.1|CNS096IT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC18BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 569 gagtttcacaccgagctggagctgctgcccgcc 537

---

>emb|BX044528.1|CNS096IS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 479 gagtttcacaccgagctggagctgctgcccgcc 511

---

>emb|BX043538.1|CNS095RA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 577 gagtttcacaccgagctggagctgctgcccgcc 545

---

>emb|BX043537.1|CNS095R9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 477 gagtttcacaccgagctggagctgctgcccgcc 509

---

>emb|BX040987.1|CNS093SF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 449 gagtttcacaccgagctggagctgctgcccgcc 481

---

>gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, complete sequence
          Length = 140016

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    aagatcaagatgcatttgaaa 392
              |||||||||||||||||||||
Sbjct: 103937 aagatcaagatgcatttgaaa 103917

---

>emb|BX031771.1|CNS08WOF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 537 gagtttcacaccgagctggagctgctgcccgcc 505

---

>emb|BX031770.1|CNS08WOE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 449 gagtttcacaccgagctggagctgctgcccgcc 481

---

>emb|BX028549.1|CNS08U6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 543 gagtttcacaccgagctggagctgctgcccgcc 511

---

>emb|BX028548.1|CNS08U6W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 470 gagtttcacaccgagctggagctgctgcccgcc 502

---

>emb|BX027525.1|CNS08TEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 551 gagtttcacaccgagctggagctgctgcccgcc 519

---

>emb|BX027524.1|CNS08TEG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1062

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 486 gagtttcacaccgagctggagctgctgcccgcc 518

---

>emb|BX021496.1|CNS08OR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1081

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 500 gagtttcacaccgagctggagctgctgcccgcc 532

---

>emb|BX006225.1|CNS08CYT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 477 gagtttcacaccgagctggagctgctgcccgcc 445

---

>emb|BX006224.1|CNS08CYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 515 gagttccacactgagctggagcttctgcccgcc 547
           ||||| ||||| ||||||||||| |||||||||
Sbjct: 406 gagtttcacaccgagctggagctgctgcccgcc 438

---

>gb|AC154014.4| Mus musculus 6 BAC RP24-409C18 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 161963

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 351   ttcttttgagtgtgaaaatgg 371
             |||||||||||||||||||||
Sbjct: 65231 ttcttttgagtgtgaaaatgg 65251

---

>gb|AC087349.17| Homo sapiens chromosome 8, clone RP11-339A23, complete sequence
          Length = 96337

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 666   acttcatggaccttctcgcca 686
             |||||||||||||||||||||
Sbjct: 48710 acttcatggaccttctcgcca 48730

---

>emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chromosome 4, complete
             sequence
          Length = 151555

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 360   gtgtgaaaatggaagatcaag 380
             |||||||||||||||||||||
Sbjct: 65908 gtgtgaaaatggaagatcaag 65888

---

>emb|AL606917.12| Mouse DNA sequence from clone RP23-25K8 on chromosome 4, complete
             sequence
          Length = 52163

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 256   cctcaccaagttccccagcct 276
             |||||||||||||||||||||
Sbjct: 48847 cctcaccaagttccccagcct 48867


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 179,050,328
Number of extensions: 10069870
Number of successful extensions: 204130
Number of sequences better than 10.0: 55
Number of HSP's gapped: 204119
Number of HSP's successfully gapped: 105
Length of query: 1141
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1118
Effective length of database: 18,503,978,556
Effective search space: 20687448025608
Effective search space used: 20687448025608
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)

---