| Clone Name | FLbaf141j02 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_001054125.1| Oryza sativa (japonica cultivar-group) Os02g0651000 (Os02g0651000) mRNA, complete cds Length = 659 Score = 448 bits (226), Expect = e-122 Identities = 400/458 (87%) Strand = Plus / Plus Query: 439 tatgagaagagtagcatcacttgtgccagatctctatgctgtagatgcggattacgcact 498 ||||||||||| || || ||||||| ||||||||||| | ||||| ||||| ||||| Sbjct: 1 tatgagaagagccgcgtcttttgtgccggatctctatgccatcgatgcagattatgcact 60 Query: 499 ttcggagttgtgcaaagatgagcaaaaacttgagaaagtgcttctcggcagggagttcca 558 ||| ||||||||||| ||||| ||||| ||||||||||||||||| |||||||||| || Sbjct: 61 ttccgagttgtgcaaggatgaacaaaagcttgagaaagtgcttctgagcagggagtttca 120 Query: 559 tgtaagcttaggaagaactgttggaattcaggtgcatcaaattgactccctcgtcgcaat 618 |||||| |||||||||||||||| ||||||||||||||||||||| ||||| |||||||| Sbjct: 121 tgtaagtttaggaagaactgttgcaattcaggtgcatcaaattgagtcccttgtcgcaat 180 Query: 619 gcttcgtcagaagtttcagtcacaacagcggtactggatggacttgaacaaatgggagca 678 |||||| || ||||| | ||||| || ||||| ||||||||||| |||||||||||||| Sbjct: 181 gcttcggcaaaagttccgctcacagcaacggtattggatggacttcaacaaatgggagca 240 Query: 679 ttttgtcaatgatgattctacacgatcatttctttcactagaggttacaagaactgggtt 738 ||||||||||||||||| |||||| ||||||||||| ||||| |||||||| |||||||| Sbjct: 241 ttttgtcaatgatgattgtacacggtcatttctttcgctagaagttacaagtactgggtt 300 Query: 739 accagagatcagtaaacaaatacatatggttgatgaagtatatcgattgcacggtcttcc 798 |||||||| |||||||| ||| ||||| ||||| ||||||||||| || || ||||| Sbjct: 301 gccagagattagtaaacagataacgatggtagatgatgtatatcgattacatgggcttcc 360 Query: 799 tgagttttacaagaatccccggccacacatatcattggcgtgggcattgggtgatgttag 858 ||| || || |||||||| |||||||| |||||| ||||||||||||||||||||||||| Sbjct: 361 tgaattctataagaatccacggccacatatatcactggcgtgggcattgggtgatgttag 420 Query: 859 ctccaaactgaagcaggcaactaaggagattgaaaaat 896 || ||||||||| || |||| ||||||||| ||||||| Sbjct: 421 ctgcaaactgaaacaagcaattaaggagatcgaaaaat 458 Score = 69.9 bits (35), Expect = 2e-08 Identities = 68/79 (86%) Strand = Plus / Plus Query: 928 taatctgaggtgcaatttcagtcgtatattgtgtaaagtaggcaagaaggtctacgatat 987 ||||||||| ||||| || |||| | || |||||||| ||||||||||||| || ||||| Sbjct: 490 taatctgagatgcaagtttagtcatgtagtgtgtaaaataggcaagaaggtgtatgatat 549 Query: 988 ctgtaaaattggagactga 1006 ||||||| ||| ||||||| Sbjct: 550 ctgtaaacttgcagactga 568
>dbj|AK062626.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-C03, full insert sequence Length = 659 Score = 448 bits (226), Expect = e-122 Identities = 400/458 (87%) Strand = Plus / Plus Query: 439 tatgagaagagtagcatcacttgtgccagatctctatgctgtagatgcggattacgcact 498 ||||||||||| || || ||||||| ||||||||||| | ||||| ||||| ||||| Sbjct: 1 tatgagaagagccgcgtcttttgtgccggatctctatgccatcgatgcagattatgcact 60 Query: 499 ttcggagttgtgcaaagatgagcaaaaacttgagaaagtgcttctcggcagggagttcca 558 ||| ||||||||||| ||||| ||||| ||||||||||||||||| |||||||||| || Sbjct: 61 ttccgagttgtgcaaggatgaacaaaagcttgagaaagtgcttctgagcagggagtttca 120 Query: 559 tgtaagcttaggaagaactgttggaattcaggtgcatcaaattgactccctcgtcgcaat 618 |||||| |||||||||||||||| ||||||||||||||||||||| ||||| |||||||| Sbjct: 121 tgtaagtttaggaagaactgttgcaattcaggtgcatcaaattgagtcccttgtcgcaat 180 Query: 619 gcttcgtcagaagtttcagtcacaacagcggtactggatggacttgaacaaatgggagca 678 |||||| || ||||| | ||||| || ||||| ||||||||||| |||||||||||||| Sbjct: 181 gcttcggcaaaagttccgctcacagcaacggtattggatggacttcaacaaatgggagca 240 Query: 679 ttttgtcaatgatgattctacacgatcatttctttcactagaggttacaagaactgggtt 738 ||||||||||||||||| |||||| ||||||||||| ||||| |||||||| |||||||| Sbjct: 241 ttttgtcaatgatgattgtacacggtcatttctttcgctagaagttacaagtactgggtt 300 Query: 739 accagagatcagtaaacaaatacatatggttgatgaagtatatcgattgcacggtcttcc 798 |||||||| |||||||| ||| ||||| ||||| ||||||||||| || || ||||| Sbjct: 301 gccagagattagtaaacagataacgatggtagatgatgtatatcgattacatgggcttcc 360 Query: 799 tgagttttacaagaatccccggccacacatatcattggcgtgggcattgggtgatgttag 858 ||| || || |||||||| |||||||| |||||| ||||||||||||||||||||||||| Sbjct: 361 tgaattctataagaatccacggccacatatatcactggcgtgggcattgggtgatgttag 420 Query: 859 ctccaaactgaagcaggcaactaaggagattgaaaaat 896 || ||||||||| || |||| ||||||||| ||||||| Sbjct: 421 ctgcaaactgaaacaagcaattaaggagatcgaaaaat 458 Score = 69.9 bits (35), Expect = 2e-08 Identities = 68/79 (86%) Strand = Plus / Plus Query: 928 taatctgaggtgcaatttcagtcgtatattgtgtaaagtaggcaagaaggtctacgatat 987 ||||||||| ||||| || |||| | || |||||||| ||||||||||||| || ||||| Sbjct: 490 taatctgagatgcaagtttagtcatgtagtgtgtaaaataggcaagaaggtgtatgatat 549 Query: 988 ctgtaaaattggagactga 1006 ||||||| ||| ||||||| Sbjct: 550 ctgtaaacttgcagactga 568
>gb|AY111259.1| Zea mays CL6910_1 mRNA sequence Length = 567 Score = 274 bits (138), Expect = 6e-70 Identities = 273/318 (85%) Strand = Plus / Minus Query: 560 gtaagcttaggaagaactgttggaattcaggtgcatcaaattgactccctcgtcgcaatg 619 |||||||| |||||| |||||| | ||||||||||||| |||||||| | | |||||| Sbjct: 561 gtaagcttgggaagacctgttgcagttcaggtgcatcagattgactcatttattgcaatg 502 Query: 620 cttcgtcagaagtttcagtcacaacagcggtactggatggacttgaacaaatgggagcat 679 ||||| |||||||| ||| ||||||| | |||||||||||| || || ||||||||||| Sbjct: 501 cttcgccagaagttccagccacaacaacagtactggatggagttcaataaatgggagcac 442 Query: 680 tttgtcaatgatgattctacacgatcatttctttcactagaggttacaagaactgggtta 739 |||||||||||||||| |||||| |||||| |||||||||| |||||||||||||| || Sbjct: 441 tttgtcaatgatgattgtacacggtcatttgtttcactagaagttacaagaactggtttg 382 Query: 740 ccagagatcagtaaacaaatacatatggttgatgaagtatatcgattgcacggtcttcct 799 |||||||| | | || |||| |||||| |||||||| ||||||||||| ||||||||| Sbjct: 381 ccagagataacgaggcagatacttatggtagatgaagtgtatcgattgcatggtcttcct 322 Query: 800 gagttttacaagaatccccggccacacatatcattggcgtgggcattgggtgatgttagc 859 || ||||||| |||||| |||||||| ||||| |||| |||||||||||||||||| ||| Sbjct: 321 gaattttacacgaatccacggccacatatatcgttggtgtgggcattgggtgatgtcagc 262 Query: 860 tccaaactgaagcaggca 877 |||||| ||||||||| Sbjct: 261 ggcaaactaaagcaggca 244 Score = 63.9 bits (32), Expect = 1e-06 Identities = 62/72 (86%) Strand = Plus / Minus Query: 938 tgcaatttcagtcgtatattgtgtaaagtaggcaagaaggtctacgatatctgtaaaatt 997 ||||| ||||||||| || | |||||||||||||||||||| | |||||||||||| || Sbjct: 183 tgcaagttcagtcgtgtagtttgtaaagtaggcaagaaggtgcatgatatctgtaaagtt 124 Query: 998 ggagactgaaac 1009 | ||| |||||| Sbjct: 123 gcagattgaaac 112
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2 Length = 35954743 Score = 202 bits (102), Expect = 2e-48 Identities = 189/218 (86%) Strand = Plus / Minus Query: 416 gcaaggaaacatctgaccctcgttatgagaagagtagcatcacttgtgccagatctctat 475 |||| |||||| ||| ||| ||||||||||||| || || ||||||| ||||||||| Sbjct: 26263515 gcaaagaaacacctggtccttgttatgagaagagccgcgtcttttgtgccggatctctat 26263456 Query: 476 gctgtagatgcggattacgcactttcggagttgtgcaaagatgagcaaaaacttgagaaa 535 || | ||||| ||||| |||||||| ||||||||||| ||||| ||||| ||||||||| Sbjct: 26263455 gccatcgatgcagattatgcactttccgagttgtgcaaggatgaacaaaagcttgagaaa 26263396 Query: 536 gtgcttctcggcagggagttccatgtaagcttaggaagaactgttggaattcaggtgcat 595 |||||||| |||||||||| |||||||| |||||||||||||||| ||||||||||||| Sbjct: 26263395 gtgcttctgagcagggagtttcatgtaagtttaggaagaactgttgcaattcaggtgcat 26263336 Query: 596 caaattgactccctcgtcgcaatgcttcgtcagaagtt 633 |||||||| ||||| |||||||||||||| || ||||| Sbjct: 26263335 caaattgagtcccttgtcgcaatgcttcggcaaaagtt 26263298 Score = 131 bits (66), Expect = 6e-27 Identities = 90/98 (91%) Strand = Plus / Minus Query: 648 ggtactggatggacttgaacaaatgggagcattttgtcaatgatgattctacacgatcat 707 |||| ||||||||||| ||||||||||||||||||||||||||||||| |||||| |||| Sbjct: 26263126 ggtattggatggacttcaacaaatgggagcattttgtcaatgatgattgtacacggtcat 26263067 Query: 708 ttctttcactagaggttacaagaactgggttaccagag 745 ||||||| ||||| |||||||| |||||||| |||||| Sbjct: 26263066 ttctttcgctagaagttacaagtactgggttgccagag 26263029 Score = 109 bits (55), Expect = 2e-20 Identities = 79/87 (90%) Strand = Plus / Minus Query: 810 agaatccccggccacacatatcattggcgtgggcattgggtgatgttagctccaaactga 869 ||||||| |||||||| |||||| ||||||||||||||||||||||||||| |||||||| Sbjct: 26262482 agaatccacggccacatatatcactggcgtgggcattgggtgatgttagctgcaaactga 26262423 Query: 870 agcaggcaactaaggagattgaaaaat 896 | || |||| ||||||||| ||||||| Sbjct: 26262422 aacaagcaattaaggagatcgaaaaat 26262396 Score = 91.7 bits (46), Expect = 5e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 313 agattactcgacaattccacaggggagtcgcatccggagtttcccccatgtggaaggcaa 372 ||||| ||||||||| | |||||||||||| ||||||| ||||| |||||||||||||| Sbjct: 26264227 agattgctcgacaatggcgcaggggagtcgcgtccggagcttcccacatgtggaaggcaa 26264168 Query: 373 ctacgcgctgcatgtctacatccctg 398 ||| ||||| ||||| |||||||||| Sbjct: 26264167 ctatgcgctacatgtttacatccctg 26264142 Score = 69.9 bits (35), Expect = 2e-08 Identities = 68/79 (86%) Strand = Plus / Minus Query: 928 taatctgaggtgcaatttcagtcgtatattgtgtaaagtaggcaagaaggtctacgatat 987 ||||||||| ||||| || |||| | || |||||||| ||||||||||||| || ||||| Sbjct: 26262364 taatctgagatgcaagtttagtcatgtagtgtgtaaaataggcaagaaggtgtatgatat 26262305 Query: 988 ctgtaaaattggagactga 1006 ||||||| ||| ||||||| Sbjct: 26262304 ctgtaaacttgcagactga 26262286 Score = 67.9 bits (34), Expect = 7e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 253 ggaagcttccgcgctgcttcctccccctcccctcgaccttctccagtccccgaacttcgt 312 |||| |||||||| |||| |||||||| ||||||||||| |||||| |||| |||||||| Sbjct: 26264377 ggaaccttccgcgttgctccctcccccgcccctcgacctcctccagcccccaaacttcgt 26264318 Query: 313 ag 314 || Sbjct: 26264317 ag 26264316 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 7490225 gatgacgacgacgacgatgag 7490205 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 20049399 tgacgatgacgacgacgacga 20049379 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 27815264 tgacgatgacgacgacgacga 27815284
>dbj|AP007203.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0012J10 Length = 132375 Score = 202 bits (102), Expect = 2e-48 Identities = 189/218 (86%) Strand = Plus / Minus Query: 416 gcaaggaaacatctgaccctcgttatgagaagagtagcatcacttgtgccagatctctat 475 |||| |||||| ||| ||| ||||||||||||| || || ||||||| ||||||||| Sbjct: 86356 gcaaagaaacacctggtccttgttatgagaagagccgcgtcttttgtgccggatctctat 86297 Query: 476 gctgtagatgcggattacgcactttcggagttgtgcaaagatgagcaaaaacttgagaaa 535 || | ||||| ||||| |||||||| ||||||||||| ||||| ||||| ||||||||| Sbjct: 86296 gccatcgatgcagattatgcactttccgagttgtgcaaggatgaacaaaagcttgagaaa 86237 Query: 536 gtgcttctcggcagggagttccatgtaagcttaggaagaactgttggaattcaggtgcat 595 |||||||| |||||||||| |||||||| |||||||||||||||| ||||||||||||| Sbjct: 86236 gtgcttctgagcagggagtttcatgtaagtttaggaagaactgttgcaattcaggtgcat 86177 Query: 596 caaattgactccctcgtcgcaatgcttcgtcagaagtt 633 |||||||| ||||| |||||||||||||| || ||||| Sbjct: 86176 caaattgagtcccttgtcgcaatgcttcggcaaaagtt 86139 Score = 131 bits (66), Expect = 6e-27 Identities = 90/98 (91%) Strand = Plus / Minus Query: 648 ggtactggatggacttgaacaaatgggagcattttgtcaatgatgattctacacgatcat 707 |||| ||||||||||| ||||||||||||||||||||||||||||||| |||||| |||| Sbjct: 85967 ggtattggatggacttcaacaaatgggagcattttgtcaatgatgattgtacacggtcat 85908 Query: 708 ttctttcactagaggttacaagaactgggttaccagag 745 ||||||| ||||| |||||||| |||||||| |||||| Sbjct: 85907 ttctttcgctagaagttacaagtactgggttgccagag 85870 Score = 109 bits (55), Expect = 2e-20 Identities = 79/87 (90%) Strand = Plus / Minus Query: 810 agaatccccggccacacatatcattggcgtgggcattgggtgatgttagctccaaactga 869 ||||||| |||||||| |||||| ||||||||||||||||||||||||||| |||||||| Sbjct: 85323 agaatccacggccacatatatcactggcgtgggcattgggtgatgttagctgcaaactga 85264 Query: 870 agcaggcaactaaggagattgaaaaat 896 | || |||| ||||||||| ||||||| Sbjct: 85263 aacaagcaattaaggagatcgaaaaat 85237 Score = 91.7 bits (46), Expect = 5e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 313 agattactcgacaattccacaggggagtcgcatccggagtttcccccatgtggaaggcaa 372 ||||| ||||||||| | |||||||||||| ||||||| ||||| |||||||||||||| Sbjct: 87068 agattgctcgacaatggcgcaggggagtcgcgtccggagcttcccacatgtggaaggcaa 87009 Query: 373 ctacgcgctgcatgtctacatccctg 398 ||| ||||| ||||| |||||||||| Sbjct: 87008 ctatgcgctacatgtttacatccctg 86983 Score = 69.9 bits (35), Expect = 2e-08 Identities = 68/79 (86%) Strand = Plus / Minus Query: 928 taatctgaggtgcaatttcagtcgtatattgtgtaaagtaggcaagaaggtctacgatat 987 ||||||||| ||||| || |||| | || |||||||| ||||||||||||| || ||||| Sbjct: 85205 taatctgagatgcaagtttagtcatgtagtgtgtaaaataggcaagaaggtgtatgatat 85146 Query: 988 ctgtaaaattggagactga 1006 ||||||| ||| ||||||| Sbjct: 85145 ctgtaaacttgcagactga 85127 Score = 67.9 bits (34), Expect = 7e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 253 ggaagcttccgcgctgcttcctccccctcccctcgaccttctccagtccccgaacttcgt 312 |||| |||||||| |||| |||||||| ||||||||||| |||||| |||| |||||||| Sbjct: 87218 ggaaccttccgcgttgctccctcccccgcccctcgacctcctccagcccccaaacttcgt 87159 Query: 313 ag 314 || Sbjct: 87158 ag 87157
>gb|AC167919.2| Mycosphaerella graminicola clone JGIBBWB-5H21, complete sequence Length = 35458 Score = 48.1 bits (24), Expect = 0.068 Identities = 27/28 (96%) Strand = Plus / Plus Query: 183 ccggctctgacgatgacgacgacgacga 210 ||||||| |||||||||||||||||||| Sbjct: 15511 ccggctcagacgatgacgacgacgacga 15538
>gb|DQ641486.1| Macropus eugenii microsatellite MeY28 sequence Length = 330 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 202 tgacgatgacgacgacgacgatga 225
>dbj|AK235961.1| Sus scrofa mRNA, clone:OVRM10129E06, expressed in ovary Length = 1606 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 187 ctctgacgatgacgacgacgacga 210 |||||||||||||||||||||||| Sbjct: 182 ctctgacgatgacgacgacgacga 205
>ref|XM_001122881.1| PREDICTED: Apis mellifera hypothetical protein LOC727170 (LOC727170), partial mRNA Length = 763 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 210 tgacgatgacgacgacgacgatga 233
>gb|CP000384.1| Mycobacterium sp. MCS, complete genome Length = 5705448 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 4950093 tgacgatgacgacgacgacgatga 4950070 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 4950132 tgacgatgacgacgacgacga 4950112
>ref|XM_638458.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0167213) mRNA, complete cds Length = 4269 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 2256 tgacgatgacgacgacgacgatga 2233
>gb|AF441502.1| Pinus taeda clone 57n9f microsatellite PtTX3007 sequence Length = 489 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 6 tgacgatgacgacgacgacgatga 29
>gb|AC145580.3| Mus musculus BAC clone RP24-380D12 from chromosome 16, complete sequence Length = 130390 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 57818 tgacgatgacgacgacgacgatga 57841
>gb|AC146460.3| Pan troglodytes BAC clone CH251-182B16 from X, complete sequence Length = 172064 Score = 48.1 bits (24), Expect = 0.068 Identities = 27/28 (96%) Strand = Plus / Minus Query: 269 cttcctccccctcccctcgaccttctcc 296 ||||||||||||||||||| |||||||| Sbjct: 120352 cttcctccccctcccctcgcccttctcc 120325
>ref|XM_503296.1| Yarrowia lipolytica CLIB122, YALI0D25938g predicted mRNA Length = 3192 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 726 tgacgatgacgacgacgacgatga 749
>ref|XM_503234.1| Yarrowia lipolytica CLIB122, YALI0D24497g predicted mRNA Length = 2781 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 192 tgacgatgacgacgacgacgatga 215
>ref|XM_500206.1| Yarrowia lipolytica CLIB122, YALI0A18524g predicted mRNA Length = 897 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 516 tgacgatgacgacgacgacgatga 539
>gb|AC118603.9| Mus musculus chromosome 16, clone RP24-79L6, complete sequence Length = 190432 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 58175 tgacgatgacgacgacgacgatga 58152
>gb|AC120734.5| Rattus norvegicus BAC CH230-220D1 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 232990 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 24605 tgacgatgacgacgacgacgatga 24582
>gb|AC027740.11| Mus musculus, clone RP23-57M1, complete sequence Length = 261093 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 184100 tgacgatgacgacgacgacgatga 184077
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6 Length = 30731886 Score = 48.1 bits (24), Expect = 0.068 Identities = 27/28 (96%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatgagccgg 218 ||||| |||||||||||||||||||||| Sbjct: 21771464 gacgacgacgacgacgacgatgagccgg 21771437 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgagccgg 218 ||||||||||||||||||| ||||| Sbjct: 5720833 gatgacgacgacgacgatgggccgg 5720857 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 23643980 tgacgatgacgacgacgacga 23644000
>gb|AY189724.1| Penaeus monodon clone t13646 microsatellite sequence Length = 794 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 549 tgacgatgacgacgacgacgatga 526
>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I, complete sequence Length = 691920 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 594328 tgacgatgacgacgacgacgatga 594351
>emb|BX883043.1| Rattus norvegicus chromosome 20, major histocompatibility complex, assembled from 40 BACs, strain Brown Norway (BN/ssNHsd), RT1n haplotype; segment 2/11 Length = 347664 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 142414 tgacgatgacgacgacgacgatga 142437
>gb|AC087795.5|AC087795 Genomic Sequence for Mus musculus, clone RP23-181H5, complete sequence Length = 220811 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 183574 tgacgatgacgacgacgacgatga 183551
>gb|AC115598.2| Dictyostelium discoideum chromosome 2 map 581427-735498 strain AX4, complete sequence Length = 154071 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 34805 tgacgatgacgacgacgacgatga 34782
>dbj|AP005460.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0610D01 Length = 146418 Score = 48.1 bits (24), Expect = 0.068 Identities = 27/28 (96%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatgagccgg 218 ||||| |||||||||||||||||||||| Sbjct: 29545 gacgacgacgacgacgacgatgagccgg 29518
>ref|NM_208035.1| Eremothecium gossypii AAR140Wp (AAR140W), mRNA Length = 1947 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 1803 tgacgatgacgacgacgacgatga 1826
>gb|DQ331728.1| Synthetic construct Saccharomyces cerevisiae clone FLH202861.01X VID30 gene, complete sequence Length = 2877 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 534 tgacgatgacgacgacgacgatga 557
>emb|Z72749.1|SCYGL227W S.cerevisiae chromosome VII reading frame ORF YGL227w Length = 4007 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 873 tgacgatgacgacgacgacgatga 896
>emb|AM181674.1| Drosophila tristis intron sequence (y gene) Length = 3921 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 3594 tgacgatgacgacgacgacgatga 3617
>emb|AL445236.22| Human DNA sequence from clone RP13-77O11 on chromosome Xp11.21-11.3 Contains the 5' end of a novel gene (FLJ33130, FLJ35046, FLJ34279, FLJ38843, DKFZp667C0711), the PLAC6 gene for placenta-specific 6, a eukaryotic translation initiation factor 4A (EIF4A2) pseudogene, a GAGE family pseudogene, a novel protein similar to the GAGE family, a pseudogene similar to part of G antigen protein, a novel gene, a SSX family pseudogene, a S100 family pseudogene, the 3' end of a novel protein similar to the SSX family and two CpG islands, complete sequence Length = 149749 Score = 48.1 bits (24), Expect = 0.068 Identities = 27/28 (96%) Strand = Plus / Minus Query: 269 cttcctccccctcccctcgaccttctcc 296 ||||||||||||||||||| |||||||| Sbjct: 135220 cttcctccccctcccctcgcccttctcc 135193
>emb|AL450023.21| Human DNA sequence from clone RP11-552J9 on chromosome X Contains a GAGE family member pseudogene, a novel SSX family protein, two SSX family pseudogenes, the SSX7 gene for X breakpoint 7 synovial sarcoma, the SSX2 gene for X breakpoint 2 synovial sarcoma, the SSX8 gene for X breakpoint 8 synovial sarcoma, three pseudogenes similar to part of ornithine aminotransferase (gyrate atrophy) (OAT), three ornithine aminotransferase (gyrate atrophy) (OAT) pseudogenes, a S100 calcium binding protein A11 (calgizzarin) (S100A11) pseudogene and the 5' end of the gene for a novel protein similar to the SSX family, complete sequence Length = 185532 Score = 48.1 bits (24), Expect = 0.068 Identities = 27/28 (96%) Strand = Plus / Minus Query: 269 cttcctccccctcccctcgaccttctcc 296 ||||||||||||||||||| |||||||| Sbjct: 115394 cttcctccccctcccctcgcccttctcc 115367
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 3258419 tgacgatgacgacgacgacgatga 3258396 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 3448032 tgacgatgacgacgacgacgatga 3448055 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 783142 tgacgatgacgacgacgacga 783122
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica Length = 2303261 Score = 48.1 bits (24), Expect = 0.068 Identities = 24/24 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatga 213 |||||||||||||||||||||||| Sbjct: 1986981 tgacgatgacgacgacgacgatga 1986958
>ref|XM_417918.2| PREDICTED: Gallus gallus similar to hypothetical protein FLJ21827 (LOC419780), mRNA Length = 1408 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 253 gacgatgacgacgacgacgatga 275
>emb|CT835425.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA012E09, full insert sequence Length = 474 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 12 gacgatgacgacgacgacgatga 34
>dbj|AB235207.1| Drosophila melanogaster CG32611 mRNA for CG32611, complete cds Length = 3270 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 1356 tgacgatgacgacgacgacgatg 1378
>gb|AE014298.4| Drosophila melanogaster chromosome X, complete sequence Length = 22422827 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 4848359 gacgatgacgacgacgacgatga 4848381 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 13778242 tgacgatgacgacgacgacgatg 13778220 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgat 211 ||||||||||||||||||||| Sbjct: 11246472 gacgatgacgacgacgacgat 11246492 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 15978928 tgacgatgacgacgacgacga 15978948
>gb|CP000377.1| Silicibacter sp. TM1040, complete genome Length = 3200938 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 2246950 gacgatgacgacgacgacgatga 2246928
>ref|XM_988485.1| PREDICTED: Mus musculus hypothetical protein LOC671681 (LOC671681), mRNA Length = 432 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 319 gacgatgacgacgacgacgatga 341
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 4828277 gacgatgacgacgacgacgatga 4828299
>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete sequence Length = 1438950 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 525995 tgacgatgacgacgacgacgatg 526017
>gb|AY207493.1| Chlamydomonas reinhardtii CR019 protein gene, complete cds Length = 5216 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 3238 gacgatgacgacgacgacgatga 3260
>gb|BC041283.1| Xenopus laevis similar to calsequestrin 2 (cardiac muscle), mRNA (cDNA clone IMAGE:4681496), partial cds Length = 1663 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 1210 gacgatgacgacgacgacgatga 1232
>gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, complete sequence Length = 204795 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 117766 tgacgatgacgacgacgacgatg 117744
>ref|NM_167387.1| Drosophila melanogaster CG32611-RB (CG32611), mRNA Length = 3313 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 1221 tgacgatgacgacgacgacgatg 1243
>ref|NM_080337.2| Drosophila melanogaster Protein tyrosine phosphatase 4E CG6899-RA, transcript variant A (Ptp4E), mRNA Length = 6073 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 5320 gacgatgacgacgacgacgatga 5342
>gb|AC090434.43| Chlamydomonas reinhardtii clone cr-1j6, complete sequence Length = 127686 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 94345 gacgatgacgacgacgacgatga 94367
>gb|AC090436.37| Chlamydomonas reinhardtii clone cr-3h1, complete sequence Length = 102653 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 9717 gacgatgacgacgacgacgatga 9739
>ref|NM_001037875.1| Takifugu rubripes c-myc protein (c-myc), mRNA dbj|AB236413.1| Takifugu rubripes mRNA for c-myc, complete cds Length = 1307 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 657 gacgatgacgacgacgacgatga 679
>ref|NM_059988.2| Caenorhabditis elegans F36A2.13 (F36A2.13) mRNA, complete cds Length = 9262 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 5162 gacgatgacgacgacgacgatga 5184
>gb|AC023686.4| Drosophila melanogaster X BAC RP98-30C1 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170626 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 18332 gacgatgacgacgacgacgatga 18354
>emb|CR687975.2|CNS0FTSJ Tetraodon nigroviridis full-length cDNA Length = 696 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 454 gacgatgacgacgacgacgatga 476
>emb|AJ973145.1| Cryptosporidium parvum partial gp15/45/60 gene for sporozites glycoprotein antigen, isolate Jeddah 129 Length = 799 Score = 46.1 bits (23), Expect = 0.27 Identities = 26/27 (96%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatgagcc 216 |||||||||||| |||||||||||||| Sbjct: 59 tgacgatgacgatgacgacgatgagcc 33
>emb|AJ973144.1| Cryptosporidium parvum partial gp15/45/60 gene for sporozites glycoprotein antigen, isolate Jeddah 1 Length = 799 Score = 46.1 bits (23), Expect = 0.27 Identities = 26/27 (96%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatgagcc 216 |||||||||||| |||||||||||||| Sbjct: 59 tgacgatgacgatgacgacgatgagcc 33
>gb|AF231799.1|AF231799 Pinus taeda clone G18a16 microsatellite sequence Length = 467 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 232 gacgatgacgacgacgacgatga 254
>gb|AF231791.1|AF231791 Pinus taeda clone LC6p11 microsatellite sequence Length = 306 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 14 gacgatgacgacgacgacgatga 36
>gb|BT022126.1| Drosophila melanogaster IP08939 full insert cDNA Length = 3001 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 1710 tgacgatgacgacgacgacgatg 1732
>ref|XM_624431.1| PREDICTED: Apis mellifera similar to Noa36 CG10009-PA (LOC552052), mRNA Length = 957 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 832 gacgatgacgacgacgacgatga 854
>gb|AC010705.15|AC010705 Drosophila melanogaster, chromosome X, region 12D-12E, BAC clone BACR28F21, complete sequence Length = 163958 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 57094 tgacgatgacgacgacgacgatg 57072
>gb|AC023701.4| Drosophila melanogaster X BAC RP98-29B16 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 198245 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 107676 gacgatgacgacgacgacgatga 107654
>ref|XM_571517.1| Cryptococcus neoformans var. neoformans JEC21 5'-3' exoribonuclease (CNF01810) partial mRNA Length = 3625 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatg 212 ||||||||||||||||||||||| Sbjct: 1974 tgacgatgacgacgacgacgatg 1996
>gb|AF143964.1|AF143964 Pinus taeda microsatellite PtTX2164 sequence Length = 467 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 236 gacgatgacgacgacgacgatga 214
>gb|CP000033.1| Lactobacillus acidophilus NCFM, complete genome Length = 1993564 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 760 acatatggttgatgaagtatatc 782 ||||||||||||||||||||||| Sbjct: 793960 acatatggttgatgaagtatatc 793982
>ref|XM_312076.2| Anopheles gambiae str. PEST ENSANGP00000016797 (ENSANGG00000014308), partial mRNA Length = 6772 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 5483 gacgatgacgacgacgacgatga 5505
>emb|AL358832.3|CNS05TED Human chromosome 14 DNA sequence BAC R-767H2 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 177945 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 1056 ttgtaacaagtaactaaaaatgt 1078 ||||||||||||||||||||||| Sbjct: 143046 ttgtaacaagtaactaaaaatgt 143024
>emb|Z81077.1|CEF36A2 Caenorhabditis elegans Cosmid F36A2, complete sequence Length = 33428 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 31721 gacgatgacgacgacgacgatga 31699
>gb|U82814.1|HMU82814 Hirudo medicinalis neuron-specific protein mRNA, complete cds Length = 685 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 188 tctgacgatgacgacgacgacga 210 ||||||||||||||||||||||| Sbjct: 55 tctgacgatgacgacgacgacga 33
>emb|AL607109.21| Mouse DNA sequence from clone RP23-352D7 on chromosome 4, complete sequence Length = 187252 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 108207 gacgatgacgacgacgacgatga 108185
>gb|L20894.1|DRORPTP4E Drosophila melanogaster receptor protein tyrosine phosphatase (PTP4E) mRNA, complete cds Length = 6177 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 5424 gacgatgacgacgacgacgatga 5446
>dbj|AB025783.1| Octopus vulgaris OvGas mRNA for G protein a subunit s class, complete cds Length = 1616 Score = 46.1 bits (23), Expect = 0.27 Identities = 23/23 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatga 213 ||||||||||||||||||||||| Sbjct: 1321 gacgatgacgacgacgacgatga 1343
>gb|CP000460.1| Burkholderia cenocepacia HI2424 chromosome 3, complete genome Length = 1055417 Score = 44.1 bits (22), Expect = 1.1 Identities = 25/26 (96%) Strand = Plus / Minus Query: 214 gccggcgacggtcgcggacggcgcct 239 |||||||||| ||||||||||||||| Sbjct: 704894 gccggcgacgttcgcggacggcgcct 704869
>ref|XM_001227626.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_09700) mRNA, complete cds Length = 1974 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 256 gacgatgacgacgacgacgatg 277
>ref|NM_001047218.1| Caenorhabditis elegans T10B11.7b (T10B11.7) mRNA, complete cds Length = 1578 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgat 211 |||||||||||||||||||||| Sbjct: 1533 tgacgatgacgacgacgacgat 1554
>ref|NM_001047217.1| Caenorhabditis elegans T10B11.7a (T10B11.7) mRNA, complete cds Length = 1809 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgat 211 |||||||||||||||||||||| Sbjct: 1644 tgacgatgacgacgacgacgat 1665
>ref|NM_001061881.1| Oryza sativa (japonica cultivar-group) Os05g0369500 (Os05g0369500) mRNA, complete cds Length = 2039 Score = 44.1 bits (22), Expect = 1.1 Identities = 31/34 (91%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatgagccggcgacgg 224 ||||| ||||||||||||||||| ||| |||||| Sbjct: 126 gacgacgacgacgacgacgatgacccgacgacgg 93
>emb|AM236080.1| Rhizobium leguminosarum bv. viciae chromosome complete genome, strain 3841 Length = 5057142 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 192 acgatgacgacgacgacgatga 213 |||||||||||||||||||||| Sbjct: 1834366 acgatgacgacgacgacgatga 1834345
>gb|CP000378.1| Burkholderia cenocepacia AU 1054 chromosome 1, complete sequence Length = 3294563 Score = 44.1 bits (22), Expect = 1.1 Identities = 25/26 (96%) Strand = Plus / Plus Query: 214 gccggcgacggtcgcggacggcgcct 239 |||||||||| ||||||||||||||| Sbjct: 1479099 gccggcgacgttcgcggacggcgcct 1479124
>ref|XM_367371.1| Magnaporthe grisea 70-15 hypothetical protein (MG07296.4) partial mRNA Length = 1797 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 1027 gacgatgacgacgacgacgatg 1048
>ref|NM_128057.1| Arabidopsis thaliana unknown protein (AT2G24990) mRNA, complete cds Length = 1614 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgat 211 |||||||||||||||||||||| Sbjct: 72 tgacgatgacgacgacgacgat 93
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 105 aggacgacgggcgcgacagcga 126 |||||||||||||||||||||| Sbjct: 1172955 aggacgacgggcgcgacagcga 1172934
>gb|AY432380.1| Aedes aegypti ASAP ID: 36075 unknown mRNA sequence Length = 521 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 201 gacgatgacgacgacgacgatg 222
>gb|AC114677.13| Mus musculus chromosome 18, clone RP24-213K19, complete sequence Length = 182311 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 114773 gacgatgacgacgacgacgatg 114752
>ref|XM_454198.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E05544g predicted mRNA Length = 1110 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatga 213 |||||||||||||||||||||| Sbjct: 1034 acgatgacgacgacgacgatga 1055
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 44.1 bits (22), Expect = 1.1 Identities = 31/34 (91%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatgagccggcgacgg 224 ||||| ||||||||||||||||| ||| |||||| Sbjct: 144424 gacgacgacgacgacgacgatgacccgacgacgg 144457
>gb|AC127417.3| Mus musculus BAC clone RP23-459M2 from chromosome 10, complete sequence Length = 192814 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 192 acgatgacgacgacgacgatga 213 |||||||||||||||||||||| Sbjct: 107016 acgatgacgacgacgacgatga 106995
>gb|AY858788.1| Metrioptera roeseli microsatellite locus MR3-34 genomic sequence Length = 243 Score = 44.1 bits (22), Expect = 1.1 Identities = 25/26 (96%) Strand = Plus / Minus Query: 188 tctgacgatgacgacgacgacgatga 213 |||||||| ||||||||||||||||| Sbjct: 162 tctgacgacgacgacgacgacgatga 137
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 Length = 1824958 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgat 211 |||||||||||||||||||||| Sbjct: 152887 tgacgatgacgacgacgacgat 152908
>ref|XM_755467.1| Ustilago maydis 521 hypothetical protein (UM04413.1) partial mRNA Length = 4116 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacga 210 |||||||||||||||||||||| Sbjct: 1760 ctgacgatgacgacgacgacga 1781
>ref|XM_754966.1| Ustilago maydis 521 hypothetical protein (UM03912.1) partial mRNA Length = 2946 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 103 gacgatgacgacgacgacgatg 124
>gb|AF286622.1| Pinus taeda clone PtTX4017 microsatellite sequence Length = 279 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 180 gacgatgacgacgacgacgatg 201
>ref|XM_804271.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506511.70) partial mRNA Length = 1053 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 34 gacgatgacgacgacgacgatg 55
>gb|AC006585.8| Arabidopsis thaliana chromosome 2 clone F27C12 map mi238, complete sequence Length = 103495 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgat 211 |||||||||||||||||||||| Sbjct: 41636 tgacgatgacgacgacgacgat 41615
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7 Length = 29644043 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 193 cgatgacgacgacgacgatgag 214 |||||||||||||||||||||| Sbjct: 27196643 cgatgacgacgacgacgatgag 27196622 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 27524506 tgacgatgacgacgacgacga 27524526
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5 Length = 29737217 Score = 44.1 bits (22), Expect = 1.1 Identities = 31/34 (91%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatgagccggcgacgg 224 ||||| ||||||||||||||||| ||| |||||| Sbjct: 17614619 gacgacgacgacgacgacgatgacccgacgacgg 17614652 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 2186706 tgacgatgacgacgacgacga 2186726 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatgagc 215 ||||| ||||||||||||||||||| Sbjct: 23503237 gacgacgacgacgacgacgatgagc 23503261 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatg 212 ||||||||||||||||||||| Sbjct: 25117882 acgatgacgacgacgacgatg 25117902
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3 Length = 36192742 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 31958228 gacgatgacgacgacgacgatg 31958207
>gb|AF309871.1|AF309871 Pichia pastoris Gsa11p (GSA11) gene, complete cds Length = 5950 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatga 213 |||||||||||||||||||||| Sbjct: 5327 acgatgacgacgacgacgatga 5348
>gb|AF098993.1| Caenorhabditis elegans cosmid T10B11, complete sequence Length = 32314 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgat 211 |||||||||||||||||||||| Sbjct: 21641 tgacgatgacgacgacgacgat 21620
>gb|AF344661.2|AF344661 Plasmodium berghei dihydropterin pyrophosphokinase-dihydropteroate synthase gene, partial cds Length = 2546 Score = 44.1 bits (22), Expect = 1.1 Identities = 25/26 (96%) Strand = Plus / Plus Query: 879 ctaaggagattgaaaaatttgaaaac 904 |||||||| ||||||||||||||||| Sbjct: 917 ctaaggaggttgaaaaatttgaaaac 942
>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2234072 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatga 213 |||||||||||||||||||||| Sbjct: 501555 acgatgacgacgacgacgatga 501576
>gb|AC153887.6| Mus musculus 10 BAC RP23-473N3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 165306 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgat 211 |||||||||||||||||||||| Sbjct: 100836 tgacgatgacgacgacgacgat 100815
>dbj|AP006459.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0084D17 Length = 143931 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 193 cgatgacgacgacgacgatgag 214 |||||||||||||||||||||| Sbjct: 61862 cgatgacgacgacgacgatgag 61841
>dbj|AK110067.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-160-E04, full insert sequence Length = 3077 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 1711 gacgatgacgacgacgacgatg 1732
>dbj|AK070770.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069I18, full insert sequence Length = 2041 Score = 44.1 bits (22), Expect = 1.1 Identities = 31/34 (91%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatgagccggcgacgg 224 ||||| ||||||||||||||||| ||| |||||| Sbjct: 128 gacgacgacgacgacgacgatgacccgacgacgg 95
>gb|AC102618.19| Mus musculus chromosome 18, clone RP23-426G16, complete sequence Length = 242449 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 228348 gacgatgacgacgacgacgatg 228369
>ref|XM_838297.1| Leishmania major strain Friedlin hypothetical protein (LMJ_1214) partial mRNA Length = 1668 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 105 aggacgacgggcgcgacagcga 126 |||||||||||||||||||||| Sbjct: 1286 aggacgacgggcgcgacagcga 1307
>ref|XM_670234.1| Plasmodium berghei strain ANKA dihydropteroate synthetase, (PB000230.00.0) partial mRNA Length = 1494 Score = 44.1 bits (22), Expect = 1.1 Identities = 25/26 (96%) Strand = Plus / Plus Query: 879 ctaaggagattgaaaaatttgaaaac 904 |||||||| ||||||||||||||||| Sbjct: 599 ctaaggaggttgaaaaatttgaaaac 624
>ref|XM_725003.1| Plasmodium yoelii yoelii str. 17XNL dihydropteroate synthase (PY02226) partial mRNA Length = 2067 Score = 44.1 bits (22), Expect = 1.1 Identities = 25/26 (96%) Strand = Plus / Plus Query: 879 ctaaggagattgaaaaatttgaaaac 904 |||||||| ||||||||||||||||| Sbjct: 572 ctaaggaggttgaaaaatttgaaaac 597
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 44.1 bits (22), Expect = 1.1 Identities = 25/26 (96%) Strand = Plus / Minus Query: 188 tctgacgatgacgacgacgacgatga 213 ||||||||||| |||||||||||||| Sbjct: 185410 tctgacgatgaggacgacgacgatga 185385 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 2494583 tgacgatgacgacgacgacga 2494563
>gb|AC091494.9| Oryza sativa chromosome 3 BAC OSJNBa0070N04 genomic sequence, complete sequence Length = 150663 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgatg 212 |||||||||||||||||||||| Sbjct: 68965 gacgatgacgacgacgacgatg 68944
>gb|M34844.1|YSKERD2A K.lactis ER lumen protein retaining receptor (ERD2) gene, complete cds Length = 1248 Score = 44.1 bits (22), Expect = 1.1 Identities = 22/22 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatga 213 |||||||||||||||||||||| Sbjct: 56 acgatgacgacgacgacgatga 77
>gb|AC132368.4| Mus musculus BAC clone RP23-468F12 from chromosome 18, complete sequence Length = 170961 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 46023 tgacgatgacgacgacgacga 46003
>emb|CT836086.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA333Z07, full insert sequence Length = 922 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 324 tgacgatgacgacgacgacga 344
>ref|XM_001227679.1| Chaetomium globosum CBS 148.51 predicted protein (CHGG_09753) mRNA, complete cds Length = 510 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatgag 214 ||||||||| ||||||||||||||| Sbjct: 204 tgacgatgatgacgacgacgatgag 228
>ref|XM_001223102.1| Chaetomium globosum CBS 148.51 predicted protein (CHGG_03889) mRNA, complete cds Length = 3855 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 1653 tgacgatgacgacgacgacga 1673
>ref|XM_001178707.1| PREDICTED: Strongylocentrotus purpuratus similar to capacitative calcium entry channel 1 (LOC584852), mRNA Length = 3360 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 3075 tgacgatgacgacgacgacga 3095
>ref|XM_784697.2| PREDICTED: Strongylocentrotus purpuratus similar to capacitative calcium entry channel 1 (LOC584852), mRNA Length = 3360 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 3075 tgacgatgacgacgacgacga 3095
>ref|NM_001067034.1| Oryza sativa (japonica cultivar-group) Os07g0655800 (Os07g0655800) mRNA, complete cds Length = 1324 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 724 tgacgatgacgacgacgacga 744
>ref|NM_001061128.1| Oryza sativa (japonica cultivar-group) Os05g0139100 (Os05g0139100) mRNA, complete cds Length = 1518 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 207 tgacgatgacgacgacgacga 227
>ref|NM_001053594.1| Oryza sativa (japonica cultivar-group) Os02g0539900 (Os02g0539900) mRNA, complete cds Length = 2019 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 57 tgacgatgacgacgacgacga 77
>ref|NM_001051580.1| Oryza sativa (japonica cultivar-group) Os01g0889200 (Os01g0889200) mRNA, partial cds Length = 3405 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 2683 gatgacgacgacgacgatgag 2703
>ref|NM_001050841.1| Oryza sativa (japonica cultivar-group) Os01g0758900 (Os01g0758900) mRNA, complete cds Length = 2635 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 679 gatgacgacgacgacgatgag 699
>ref|XM_001216706.1| Aspergillus terreus NIH2624 DNA repair helicase RAD25 (ATEG_08085) mRNA, complete cds Length = 2520 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 cgatgacgacgacgacgatga 213 ||||||||||||||||||||| Sbjct: 849 cgatgacgacgacgacgatga 869
>gb|AE014297.2| Drosophila melanogaster chromosome 3R, complete sequence Length = 27905053 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatg 212 ||||||||||||||||||||| Sbjct: 21927952 acgatgacgacgacgacgatg 21927972
>ref|XM_394212.3| PREDICTED: Apis mellifera similar to F36G9.12 (LOC410736), mRNA Length = 4341 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 cgatgacgacgacgacgatga 213 ||||||||||||||||||||| Sbjct: 276 cgatgacgacgacgacgatga 296
>ref|XM_001070389.1| PREDICTED: Rattus norvegicus transportin 1 (Tnpo1), mRNA Length = 5593 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 1804 gatgacgacgacgacgatgag 1824
>ref|XM_219500.4| PREDICTED: Rattus norvegicus transportin 1 (Tnpo1), mRNA Length = 4995 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 1206 gatgacgacgacgacgatgag 1226
>gb|DQ417753.1| Zea mays B73 serine/threonine kinase protein, expressed protein, and RNA-dependent RNA polymerase (mop1) genes, complete cds Length = 144706 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacgatga 213 ||||||||||||| ||||||||||| Sbjct: 120313 ctgacgatgacgatgacgacgatga 120337
>gb|DQ417752.1| Zea mays B73 pathogenesis-related protein 2 and GASA-like protein genes, complete cds Length = 156772 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacgatga 213 ||||||||||||| ||||||||||| Sbjct: 15989 ctgacgatgacgatgacgacgatga 16013
>emb|CT010436.19| Mouse DNA sequence from clone RP23-212H16 on chromosome 12, complete sequence Length = 21898 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 11145 tgacgatgacgacgacgacga 11165
>ref|XM_964380.1| PREDICTED: Tribolium castaneum similar to CG3662-PA, isoform A (LOC657961), mRNA Length = 1226 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 cgatgacgacgacgacgatga 213 ||||||||||||||||||||| Sbjct: 440 cgatgacgacgacgacgatga 460
>ref|XM_369347.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein (MG06117.4) partial mRNA Length = 3219 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 3090 tgacgatgacgacgacgacga 3110
>ref|NM_105675.2| Arabidopsis thaliana PDE317; ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (PDE317) mRNA, complete cds Length = 3564 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 cgatgacgacgacgacgatga 213 ||||||||||||||||||||| Sbjct: 336 cgatgacgacgacgacgatga 356
>ref|XM_632541.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0187106) mRNA, complete cds Length = 2991 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 828 tgacgatgacgacgacgacga 808
>ref|XM_633930.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0185572) mRNA, complete cds Length = 6045 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 4044 tgacgatgacgacgacgacga 4064
>gb|AF528565.1| Zea mays cultivar BSSS53 chromosome 4 clone BAC 072, complete sequence Length = 106246 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacgatga 213 ||||||||||||||||||| ||||| Sbjct: 65942 ctgacgatgacgacgacgatgatga 65966
>gb|AF441541.1| Pinus taeda PtTX4032 microsatellite sequence Length = 211 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 gacgatgacgacgacgacgat 211 ||||||||||||||||||||| Sbjct: 115 gacgatgacgacgacgacgat 95
>gb|AY023466.1| Oryza sativa microsatellite MRG5791 containing (TCG)X9, genomic sequence Length = 227 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 100 tgacgatgacgacgacgacga 80
>gb|AY023325.1| Oryza sativa microsatellite MRG5650 containing (GTC)X11, genomic sequence Length = 233 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 140 tgacgatgacgacgacgacga 120
>gb|AY023323.1| Oryza sativa microsatellite MRG5648 containing (GTC)X8, closest to marker RG690, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 4.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 182 tccggctctgacgatgacgacgacgacga 210 |||||||| ||||| |||||||||||||| Sbjct: 133 tccggctccgacgacgacgacgacgacga 105
>gb|AC122893.6| Mus musculus BAC clone RP23-67C3 from chromosome 17, complete sequence Length = 206456 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatgag 214 ||||||||||||||||||| ||||| Sbjct: 136078 tgacgatgacgacgacgacaatgag 136102
>gb|AC102714.16| Mus musculus chromosome 5, clone RP24-298D13, complete sequence Length = 165774 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 265 gctgcttcctccccctcccct 285 ||||||||||||||||||||| Sbjct: 90063 gctgcttcctccccctcccct 90083
>gb|AC137621.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0111O13, complete sequence Length = 126332 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 19137 tgacgatgacgacgacgacga 19157
>gb|AY644643.1| Oryza sativa (indica cultivar-group) hypothetical protein (RP2) mRNA, complete cds Length = 1343 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 724 tgacgatgacgacgacgacga 744
>gb|AC127189.4| Rattus norvegicus 1 BAC CH230-266M16 (Children's Hospital Oakland Research Institute) complete sequence Length = 222423 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 213207 tgacgatgacgacgacgacga 213187
>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence Length = 179931 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 40794 tgacgatgacgacgacgacga 40814
>gb|AC137616.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0069I13, complete sequence Length = 94252 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 55935 tgacgatgacgacgacgacga 55955
>ref|XM_718411.1| Candida albicans SC5314 hypothetical protein (CaO19_4818), mRNA Length = 591 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 304 gatgacgacgacgacgatgag 324
>ref|XM_718221.1| Candida albicans SC5314 hypothetical protein (CaO19_12281), mRNA Length = 591 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 304 gatgacgacgacgacgatgag 324
>ref|XM_455812.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F16258g predicted mRNA Length = 1950 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 1836 tgacgatgacgacgacgacga 1856
>ref|XM_502472.1| Yarrowia lipolytica CLIB122, YALI0D06149g predicted mRNA Length = 936 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 246 tgacgatgacgacgacgacga 226
>ref|XM_504984.1| Yarrowia lipolytica CLIB122, YALI0F04213g predicted mRNA Length = 1386 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatgagc 215 |||||||||||||||||||| |||| Sbjct: 889 gacgatgacgacgacgacgacgagc 913
>ref|XM_501080.1| Yarrowia lipolytica CLIB122, YALI0B18964g predicted mRNA Length = 2805 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 2706 tgacgatgacgacgacgacga 2726
>gb|AC108873.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1005_B11, complete sequence Length = 162772 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatg 212 ||||||||||||||||||||| Sbjct: 60537 acgatgacgacgacgacgatg 60557
>ref|NM_199044.2| Homo sapiens NOL1/NOP2/Sun domain family, member 4 (NSUN4), mRNA Length = 4465 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1060 aacaagtaactaaaaatgtta 1080 ||||||||||||||||||||| Sbjct: 1792 aacaagtaactaaaaatgtta 1812
>gb|AC135797.13| Medicago truncatula clone mth2-11f7, complete sequence Length = 118242 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 185 ggctctgacgatgacgacgacgacg 209 ||||||||||||||||| ||||||| Sbjct: 58606 ggctctgacgatgacgaagacgacg 58582
>gb|AC123678.19| Mus musculus chromosome 3, clone RP23-276A22, complete sequence Length = 198615 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 649 gtactggatggacttgaacaa 669 ||||||||||||||||||||| Sbjct: 83746 gtactggatggacttgaacaa 83766
>gb|AC126029.3| Mus musculus BAC clone RP23-389K5 from chromosome 19, complete sequence Length = 212472 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 8413 tgacgatgacgacgacgacga 8433
>gb|AC121578.2| Mus musculus BAC clone RP23-253I14 from 5, complete sequence Length = 125303 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 39483 tgacgatgacgacgacgacga 39463
>ref|NM_132877.1| Drosophila melanogaster CG8958-RA (CG8958), mRNA Length = 2014 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 1260 tgacgatgacgacgacgacga 1280
>ref|NM_132483.2| Drosophila melanogaster CG1737-RA (CG1737), mRNA Length = 4252 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgat 211 ||||||||||||||||||||| Sbjct: 1393 gacgatgacgacgacgacgat 1413
>gb|AC104323.27| Mus musculus strain C57BL/6J chromosome 17 clone rp23-114o8 map 17, complete sequence Length = 202430 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacgatgag 214 ||||||||||||||||||| ||||| Sbjct: 68643 tgacgatgacgacgacgacaatgag 68667
>gb|AY243327.1| Ips typographus clone ITGAA4C3 microsatellite sequence Length = 105 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 74 tgacgatgacgacgacgacga 54
>gb|AC149472.23| Medicago truncatula clone mth2-77f21, complete sequence Length = 120151 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 49131 tgacgatgacgacgacgacga 49111
>ref|XM_387472.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07296.1) partial mRNA Length = 1644 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 174 tgacgatgacgacgacgacga 194
>gb|BT023790.1| Drosophila melanogaster GH11852 full insert cDNA Length = 4273 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgat 211 ||||||||||||||||||||| Sbjct: 1393 gacgatgacgacgacgacgat 1413
>gb|AC090208.4| Homo sapiens chromosome 18, clone RP11-660C14, complete sequence Length = 200979 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 885 agattgaaaaatttgaaaaca 905 ||||||||||||||||||||| Sbjct: 149611 agattgaaaaatttgaaaaca 149631
>ref|XM_755663.1| Ustilago maydis 521 hypothetical protein (UM04609.1) partial mRNA Length = 3279 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 1347 tgacgatgacgacgacgacga 1367
>gb|AC104626.3| Drosophila melanogaster X BAC RP98-28L7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 184454 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgat 211 ||||||||||||||||||||| Sbjct: 143078 gacgatgacgacgacgacgat 143098
>gb|AY129964.1| Mus musculus strain C3H GPI-gamma 4 gene, complete cds Length = 65351 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 1921 tgacgatgacgacgacgacga 1901
>ref|XM_754187.1| Ustilago maydis 521 hypothetical protein (UM03133.1) partial mRNA Length = 4890 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 525 tgacgatgacgacgacgacga 545
>ref|XM_754149.1| Ustilago maydis 521 hypothetical protein (UM03095.1) partial mRNA Length = 2346 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacgatga 213 |||||||||||||||||||| |||| Sbjct: 275 ctgacgatgacgacgacgacaatga 299
>gb|AF455073.1| Pinus taeda clone PtTX3003 microsatellite sequence Length = 598 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 177 tgacgatgacgacgacgacga 197
>gb|AC087542.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone nbxb0073D04, complete sequence Length = 155372 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 186 gctctgacgatgacgacgacgacga 210 |||||||||| |||||||||||||| Sbjct: 91308 gctctgacgacgacgacgacgacga 91284
>emb|AJ296727.1|PAB296727 Picea abies ATC microsatellite DNA, clone EATC2G04 Length = 175 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 55 tgacgatgacgacgacgacga 35
>gb|AF286642.1| Pinus taeda clone PtTX4021 microsatellite sequence Length = 148 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 126 tgacgatgacgacgacgacga 106
>gb|AY113265.1| Drosophila melanogaster AT15673 full insert cDNA Length = 1403 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 639 tgacgatgacgacgacgacga 659
>ref|XM_960987.1| Plasmodium falciparum 3D7 hypothetical protein (PFF0445w) partial mRNA Length = 18234 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 16953 tgacgatgacgacgacgacga 16973
>tpg|BK002834.1| TPA_inf: Drosophila melanogaster HDC15712 (HDC15712) gene, complete cds Length = 577 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatg 212 ||||||||||||||||||||| Sbjct: 191 acgatgacgacgacgacgatg 211
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12 Length = 27566993 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 4109980 tgacgatgacgacgacgacga 4109960
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10 Length = 22685906 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 186 gctctgacgatgacgacgacgacga 210 |||||||||| |||||||||||||| Sbjct: 14766159 gctctgacgacgacgacgacgacga 14766135
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8 Length = 28434780 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 3110346 gatgacgacgacgacgatgag 3110326
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4 Length = 35498469 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 2735033 tgacgatgacgacgacgacga 2735013
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 12725066 tgacgatgacgacgacgacga 12725046 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacg 209 ||||||||||||||||||||| Sbjct: 25946418 ctgacgatgacgacgacgacg 25946438 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 29173189 tgacgatgacgacgacgacga 29173169 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 31913430 gatgacgacgacgacgatgag 31913450 Score = 42.1 bits (21), Expect = 4.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 182 tccggctctgacgatgacgacgacgacga 210 |||||||| ||||| |||||||||||||| Sbjct: 32331697 tccggctccgacgacgacgacgacgacga 32331669 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 38653530 gatgacgacgacgacgatgag 38653510
>gb|AF231800.1|AF231800 Pinus taeda clone G18b18 microsatellite sequence Length = 485 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 464 tgacgatgacgacgacgacga 484
>gb|AF231796.1|AF231796 Pinus taeda clone LC15d17 microsatellite sequence Length = 329 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 170 tgacgatgacgacgacgacga 190
>gb|AF231777.1|AF231777 Pinus taeda clone LC7m10 microsatellite sequence Length = 408 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 55 tgacgatgacgacgacgacga 75
>gb|AF231776.1|AF231776 Pinus taeda clone LC7f6 microsatellite sequence Length = 463 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 113 tgacgatgacgacgacgacga 133
>emb|AL354807.6| Human DNA sequence from clone RP11-522F22 on chromosome 13 Contains a DnaJ (Hsp40) homolog, subfamily A, member 1 (DNAJA1) pseudogene, complete sequence Length = 157135 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1061 acaagtaactaaaaatgttat 1081 ||||||||||||||||||||| Sbjct: 105450 acaagtaactaaaaatgttat 105470
>emb|AL139038.18| Human DNA sequence from clone RP11-456B18 on chromosome 13, complete sequence Length = 140756 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 891 aaaaatttgaaaacagcatca 911 ||||||||||||||||||||| Sbjct: 99280 aaaaatttgaaaacagcatca 99260
>emb|AL136452.7| Human DNA sequence from clone RP1-186E20 on chromosome 10 Contains an ORM1-like (S. cerevisiae) pseudogene and a novel gene, complete sequence Length = 147105 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 746 atcagtaaacaaatacatatg 766 ||||||||||||||||||||| Sbjct: 49202 atcagtaaacaaatacatatg 49182
>emb|AL122001.32|HSJ603I14 Human DNA sequence from clone RP4-603I14 on chromosome 1p31.3-33 Contains the 5' end of the gene for MUF1 protein (MUF1), the UQCRH gene for ubiquinol-cytochrome c reductase hinge protein, gene MGC22960 (FLJ40205, FLJ32858, FLJ46186), the FAAH gene for fatty acid amide hydrolase and a CpG island, complete sequence Length = 126613 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1060 aacaagtaactaaaaatgtta 1080 ||||||||||||||||||||| Sbjct: 61575 aacaagtaactaaaaatgtta 61555
>emb|AL022161.1|HS380C13 Human DNA sequence from clone RP3-380C13 on chromosome Xq22.1-22.3 Contains a calmodulin 2 (phosphorylase kinase, delta) (CALM2) pseudogene, complete sequence Length = 139444 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 352 tttcccccatgtggaaggcaa 372 ||||||||||||||||||||| Sbjct: 282 tttcccccatgtggaaggcaa 262
>emb|AL008631.1|HS292F10 Human DNA sequence from clone RP1-292F10 on chromosome 6q25.1-26 Contains part of the PARK2 gene for Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP), complete sequence Length = 115984 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 32566 tgacgatgacgacgacgacga 32546
>gb|AF416770.1|AF416770 Drosophila melanogaster ELL mRNA, complete cds Length = 3183 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 3112 gatgacgacgacgacgatgag 3132
>gb|AC154473.2| Mus musculus BAC clone RP24-120O11 from chromosome 16, complete sequence Length = 190965 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1064 agtaactaaaaatgttatgtg 1084 ||||||||||||||||||||| Sbjct: 79637 agtaactaaaaatgttatgtg 79617
>emb|BX032083.1|CNS08WX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 91 tgacgatgacgacgacgacga 71
>emb|BX032082.1|CNS08WX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 807 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 651 tgacgatgacgacgacgacga 671
>gb|AF325155.1|AF325155 Spodoptera litura nucleopolyhedrovirus strain G2, complete genome Length = 139342 Score = 42.1 bits (21), Expect = 4.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 182 tccggctctgacgatgacgacgacgacga 210 |||||||| ||||| |||||||||||||| Sbjct: 108676 tccggctccgacgacgacgacgacgacga 108648
>dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1131G08 Length = 158241 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 99508 gatgacgacgacgacgatgag 99528
>dbj|AP002910.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0707D10 Length = 172003 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacg 209 ||||||||||||||||||||| Sbjct: 42485 ctgacgatgacgacgacgacg 42505
>emb|CR382399.1| Plasmodium falciparum chromosome 6, complete sequence; segment 2/5 Length = 348174 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 37841 tgacgatgacgacgacgacga 37861
>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2602197 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 1506306 tgacgatgacgacgacgacga 1506286
>gb|AC158782.5| Mus musculus chromosome 5, clone RP23-134H19, complete sequence Length = 228458 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 265 gctgcttcctccccctcccct 285 ||||||||||||||||||||| Sbjct: 189202 gctgcttcctccccctcccct 189222
>gb|AF387007.1|AF387007 Arabidopsis thaliana Similar to Synechocystis antiviral protein (F20P5.20) mRNA, partial cds Length = 2757 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 cgatgacgacgacgacgatga 213 ||||||||||||||||||||| Sbjct: 297 cgatgacgacgacgacgatga 317
>emb|AL731613.5|OSJN00257 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0065H10, complete sequence Length = 133967 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 116363 tgacgatgacgacgacgacga 116343
>gb|AC020741.4|AC020741 Homo sapiens BAC clone RP11-798L4 from 4, complete sequence Length = 191804 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1067 aactaaaaatgttatgtgttt 1087 ||||||||||||||||||||| Sbjct: 13635 aactaaaaatgttatgtgttt 13615
>dbj|AP003245.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0421H07 Length = 158126 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 133555 tgacgatgacgacgacgacga 133535
>dbj|AP003023.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0684B02 Length = 132470 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 18976 tgacgatgacgacgacgacga 18956
>dbj|AP003431.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1099D03 Length = 191022 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 111503 gatgacgacgacgacgatgag 111483
>gb|AC134563.5| Mus musculus BAC clone RP24-179M18 from chromosome 19, complete sequence Length = 163878 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 145578 tgacgatgacgacgacgacga 145598
>gb|AC008210.4|AC008210 Drosophila melanogaster, chromosome 3R, region 97A-97A, BAC clone BACR08G22, complete sequence Length = 153648 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatg 212 ||||||||||||||||||||| Sbjct: 47221 acgatgacgacgacgacgatg 47241
>gb|AC007825.6|AC007825 Drosophila melanogaster, chromosome 3R, region 96F-96F, BAC clone BACR13F13, complete sequence Length = 179171 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 acgatgacgacgacgacgatg 212 ||||||||||||||||||||| Sbjct: 155385 acgatgacgacgacgacgatg 155405
>dbj|AP005182.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0018C07 Length = 141707 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 88477 tgacgatgacgacgacgacga 88497
>gb|AC107863.9| Mus musculus chromosome 3, clone RP23-383E14, complete sequence Length = 194268 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 649 gtactggatggacttgaacaa 669 ||||||||||||||||||||| Sbjct: 8010 gtactggatggacttgaacaa 8030
>gb|AY008144.1| Spodoptera litura nucleopolyhedrovirus alkaline exonuclease (alk-exo) gene, complete cds; and unknown genes Length = 5227 Score = 42.1 bits (21), Expect = 4.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 182 tccggctctgacgatgacgacgacgacga 210 |||||||| ||||| |||||||||||||| Sbjct: 1113 tccggctccgacgacgacgacgacgacga 1141
>emb|CR625030.1| full-length cDNA clone CS0DL009YD01 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1844 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1060 aacaagtaactaaaaatgtta 1080 ||||||||||||||||||||| Sbjct: 1723 aacaagtaactaaaaatgtta 1743
>dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1143G03 Length = 137770 Score = 42.1 bits (21), Expect = 4.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 182 tccggctctgacgatgacgacgacgacga 210 |||||||| ||||| |||||||||||||| Sbjct: 11194 tccggctccgacgacgacgacgacgacga 11166
>dbj|AP003143.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0489E06 Length = 140229 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 5465 tgacgatgacgacgacgacga 5445
>dbj|AP003377.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0053G03 Length = 101901 Score = 42.1 bits (21), Expect = 4.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 182 tccggctctgacgatgacgacgacgacga 210 |||||||| ||||| |||||||||||||| Sbjct: 63982 tccggctccgacgacgacgacgacgacga 63954
>dbj|AP002869.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0554D10 Length = 158723 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 92095 tgacgatgacgacgacgacga 92075
>dbj|AP003458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0701E03 Length = 183245 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgagccgg 218 ||||||||||||||||||| ||||| Sbjct: 36362 gatgacgacgacgacgatgggccgg 36386
>dbj|AP004687.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0021C04 Length = 162115 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgagccgg 218 ||||||||||||||||||| ||||| Sbjct: 112980 gatgacgacgacgacgatgggccgg 113004
>dbj|AP003629.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0481H08 Length = 146841 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 124944 tgacgatgacgacgacgacga 124964
>dbj|AP005823.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0663F07 Length = 159046 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 100597 tgacgatgacgacgacgacga 100617
>dbj|AP005609.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0014M17 Length = 156778 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 153520 tgacgatgacgacgacgacga 153500
>dbj|AP004070.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1705_E12 Length = 191416 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 83931 gatgacgacgacgacgatgag 83911
>dbj|AP005467.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1349_D05 Length = 174478 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 161069 gatgacgacgacgacgatgag 161049
>dbj|AP003940.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1066_B03 Length = 115339 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 69830 gatgacgacgacgacgatgag 69810
>dbj|AB118638.1| Macrobdella decora HbIIA mRNA for hemoglobin, chain IIA, complete cds Length = 967 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 785 tgacgatgacgacgacgacga 765
>dbj|AK067793.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013114H14, full insert sequence Length = 2638 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 680 gatgacgacgacgacgatgag 700
>dbj|AK066619.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013073N16, full insert sequence Length = 3405 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 2683 gatgacgacgacgacgatgag 2703
>gb|AC125368.7| Medicago truncatula clone mth2-13h15, complete sequence Length = 124271 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 185 ggctctgacgatgacgacgacgacg 209 ||||||||||||||||| ||||||| Sbjct: 64634 ggctctgacgatgacgaagacgacg 64610
>emb|BX648592.1|HSM808743 Homo sapiens mRNA; cDNA DKFZp686F22205 (from clone DKFZp686F22205) Length = 3354 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1060 aacaagtaactaaaaatgtta 1080 ||||||||||||||||||||| Sbjct: 1567 aacaagtaactaaaaatgtta 1587
>ref|XM_311288.1| Anopheles gambiae str. PEST ENSANGP00000023868 (ENSANGG00000020262), partial mRNA Length = 420 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 310 gatgacgacgacgacgatgag 330
>ref|XM_308400.2| Anopheles gambiae str. PEST ENSANGP00000019080 (ENSANGG00000016591), partial mRNA Length = 747 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 678 tgacgatgacgacgacgacga 698
>gb|BC090323.1| Rattus norvegicus transportin 1, mRNA (cDNA clone IMAGE:7109997), partial cds Length = 3015 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 764 gatgacgacgacgacgatgag 784
>emb|Z69781.1|YLTSR1 Y.lipolytica TSR1 gene Length = 2717 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatgagc 215 |||||||||||||||||||| |||| Sbjct: 1920 gacgatgacgacgacgacgacgagc 1944
>emb|CR925799.3| Wallaby DNA sequence from clone GRWB-66O5, complete sequence Length = 165490 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 277 ccctcccctcgaccttctccagtcc 301 ||||| ||||||||||||||||||| Sbjct: 52693 ccctctcctcgaccttctccagtcc 52669
>emb|AL928748.4|CNS08CBL Oryza sativa chromosome 12, . BAC OSJNBb0092O07 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 123469 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 52376 tgacgatgacgacgacgacga 52356
>gb|AC003971.1|AC003971 Human BAC 367D17 from chromosome 18, complete sequence Length = 87978 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 885 agattgaaaaatttgaaaaca 905 ||||||||||||||||||||| Sbjct: 77280 agattgaaaaatttgaaaaca 77260
>emb|CT025734.8| Mouse DNA sequence from clone RP24-375J21 on chromosome 14, complete sequence Length = 187933 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 190 tgacgatgacgacgacgacga 210 ||||||||||||||||||||| Sbjct: 145888 tgacgatgacgacgacgacga 145908
>gb|AC002062.1|F20P5 Sequence of BAC F20P5 from Arabidopsis thaliana chromosome 1, complete sequence Length = 114505 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 cgatgacgacgacgacgatga 213 ||||||||||||||||||||| Sbjct: 68827 cgatgacgacgacgacgatga 68847
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatgagc 215 |||||||||||||||||||| |||| Sbjct: 647439 gacgatgacgacgacgacgacgagc 647463
>gb|L18882.1|USMREC2A Ustilago maydis REC2 protein (REC2) gene, complete cds Length = 3206 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 189 ctgacgatgacgacgacgacgatga 213 |||||||||||||||||||| |||| Sbjct: 451 ctgacgatgacgacgacgacaatga 475
>gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0095J22, complete sequence Length = 151730 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 191 gacgatgacgacgacgacgatgagc 215 ||||| ||||||||||||||||||| Sbjct: 38961 gacgacgacgacgacgacgatgagc 38985
>dbj|AP003256.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0460E08 Length = 170021 Score = 42.1 bits (21), Expect = 4.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 194 gatgacgacgacgacgatgag 214 ||||||||||||||||||||| Sbjct: 10157 gatgacgacgacgacgatgag 10177
>emb|AL627345.11| Mouse DNA sequence from clone RP23-169E7 on chromosome 4, complete sequence Length = 73565 Score = 42.1 bits (21), Expect = 4.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 190 tgacgatgacgacgacgacgatgag 214 |||||||||||||||||| |||||| Sbjct: 51512 tgacgatgacgacgacgaggatgag 51488 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 184,747,476 Number of extensions: 10028814 Number of successful extensions: 257111 Number of sequences better than 10.0: 250 Number of HSP's gapped: 257066 Number of HSP's successfully gapped: 284 Length of query: 1108 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 1085 Effective length of database: 18,503,978,556 Effective search space: 20076816733260 Effective search space used: 20076816733260 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)