ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf134l21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC149642.2| Medicago truncatula chromosome 2 BAC clone mth2-6... 50 0.048
2ref|XM_682582.1| PREDICTED: Danio rerio similar to Phosphorylase... 48 0.19
3emb|BX088654.11| Zebrafish DNA sequence from clone CH211-195H6 i... 48 0.19
4gb|AC192328.2| Medicago truncatula chromosome 2 BAC clone mth2-5... 46 0.75
5dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.75
6emb|AL935071.4|CNS08CCN Oryza sativa chromosome 12, . BAC OSJNBb... 46 0.75
7emb|AL713910.2|CNS07YQB Oryza sativa chromosome 12, . BAC OSJNBa... 46 0.75
8emb|BX005286.6| Zebrafish DNA sequence from clone DKEY-237I9, co... 46 0.75
9emb|BX664709.2|CNS09SBZ Oryza sativa chromosome 12, . BAC B1270G... 46 0.75
10gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete ge... 44 2.9
11ref|NM_001077612.1| Danio rerio zgc:153009 (zgc:153009), mRNA >g... 44 2.9
12gb|AC189524.1| Brassica rapa subsp. pekinensis clone KBrB092B15,... 44 2.9
13gb|CP000384.1| Mycobacterium sp. MCS, complete genome 44 2.9
14ref|NM_118461.2| Arabidopsis thaliana kinase (AT4G23320) mRNA, c... 44 2.9
15ref|NM_123189.1| Arabidopsis thaliana PR5K; kinase/ transmembran... 44 2.9
16gb|AC164116.4| Mus musculus BAC clone RP24-242F4 from chromosome... 44 2.9
17ref|XM_532569.2| PREDICTED: Canis familiaris similar to cardiac-... 44 2.9
18ref|XM_384230.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 44 2.9
19gb|AC148335.4| Mus musculus BAC clone RP23-103H10 from chromosom... 44 2.9
20ref|XM_658500.1| Aspergillus nidulans FGSC A4 hypothetical prote... 44 2.9
21gb|AC023085.7| Homo sapiens chromosome 11, clone RP11-513I7, com... 44 2.9
22gb|AC133096.3| Mus musculus BAC clone RP23-271C13 from chromosom... 44 2.9
23gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 44 2.9
24dbj|AB005247.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 2.9
25emb|AL929088.23| Mouse DNA sequence from clone RP23-360J2 on chr... 44 2.9
26gb|AC159264.3| Mus musculus BAC clone RP24-67G10 from chromosome... 44 2.9
27gb|U48698.1|ATU48698 Arabidopsis thaliana putative receptor seri... 44 2.9
28emb|CT476825.1| S.lycopersicum DNA sequence from clone LE_HBa-19... 44 2.9

>gb|AC149642.2| Medicago truncatula chromosome 2 BAC clone mth2-62p11, complete
             sequence
          Length = 95165
 Score = 50.1 bits (25), Expect = 0.048
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 918   tggatgaaaatatgaatccaaaaat 942
             |||||||||||||||||||||||||
Sbjct: 61284 tggatgaaaatatgaatccaaaaat 61308



to top

>ref|XM_682582.1| PREDICTED: Danio rerio similar to Phosphorylase b kinase gamma
           catalytic chain, skeletal muscle isoform (Phosphorylase
           kinase gamma subunit 1) (LOC559261), partial mRNA
          Length = 1323

 Score = 48.1 bits (24), Expect = 0.19
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 878 aatattgttcacctggatcttaagccggagaacatactgatggatgaaaatatgaa 933
           |||||||| |||  |||||| |||||||||||||| ||  ||||||| ||||||||
Sbjct: 271 aatattgtacacagggatctgaagccggagaacatccttctggatgacaatatgaa 326



to top

>emb|BX088654.11| Zebrafish DNA sequence from clone CH211-195H6 in linkage group 15,
             complete sequence
          Length = 205794

 Score = 48.1 bits (24), Expect = 0.19
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 878   aatattgttcacctggatcttaagccggagaacatactgatggatgaaaatatgaa 933
             |||||||| |||  |||||| |||||||||||||| ||  ||||||| ||||||||
Sbjct: 64998 aatattgtacacagggatctgaagccggagaacatccttctggatgacaatatgaa 64943



to top

>gb|AC192328.2| Medicago truncatula chromosome 2 BAC clone mth2-55p8, complete sequence
          Length = 116090

 Score = 46.1 bits (23), Expect = 0.75
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 920   gatgaaaatatgaatccaaaaataaccgactttgg 954
             |||||||| ||||||||||||||| | ||||||||
Sbjct: 79391 gatgaaaacatgaatccaaaaatatctgactttgg 79425



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score = 46.1 bits (23), Expect = 0.75
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 1795     ttgaagttggtcttgttcggtatttat 1821
                |||||||||||||||||| ||||||||
Sbjct: 13739249 ttgaagttggtcttgttcagtatttat 13739275



to top

>emb|AL935071.4|CNS08CCN Oryza sativa chromosome 12, . BAC OSJNBb0016C24 of library OSJNBb
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 87778

 Score = 46.1 bits (23), Expect = 0.75
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1795 ttgaagttggtcttgttcggtatttat 1821
            |||||||||||||||||| ||||||||
Sbjct: 2558 ttgaagttggtcttgttcagtatttat 2584



to top

>emb|AL713910.2|CNS07YQB Oryza sativa chromosome 12, . BAC OSJNBa0042B03 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 145118

 Score = 46.1 bits (23), Expect = 0.75
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1795  ttgaagttggtcttgttcggtatttat 1821
             |||||||||||||||||| ||||||||
Sbjct: 72850 ttgaagttggtcttgttcagtatttat 72876



to top

>emb|BX005286.6| Zebrafish DNA sequence from clone DKEY-237I9, complete sequence
          Length = 178225

 Score = 46.1 bits (23), Expect = 0.75
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1838  ttgtttttgatttgatgatgtgtgttt 1864
             ||||||||||||||||||||| |||||
Sbjct: 43990 ttgtttttgatttgatgatgtttgttt 44016



to top

>emb|BX664709.2|CNS09SBZ Oryza sativa chromosome 12, . BAC B1270G11 of chromosome 12 of cultivar
             Nipponbare of ssp. japonica of Oryza sativa (rice),
             complete sequence
          Length = 155451

 Score = 46.1 bits (23), Expect = 0.75
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1795  ttgaagttggtcttgttcggtatttat 1821
             |||||||||||||||||| ||||||||
Sbjct: 54908 ttgaagttggtcttgttcagtatttat 54934



to top

>gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete genome
          Length = 6988209

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 2181    tccaagcactggcggttcaccc 2202
               ||||||||||||||||||||||
Sbjct: 1965554 tccaagcactggcggttcaccc 1965575



to top

>ref|NM_001077612.1| Danio rerio zgc:153009 (zgc:153009), mRNA
 gb|BC125847.1| Danio rerio zgc:153009, mRNA (cDNA clone MGC:153009 IMAGE:7086317),
           complete cds
          Length = 2775

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 892 ggatcttaagccggagaacatactgatggatgaaaatatgaa 933
           |||||| |||||||||||||| ||  ||||||| ||||||||
Sbjct: 613 ggatctgaagccggagaacatccttctggatgacaatatgaa 654



to top

>gb|AC189524.1| Brassica rapa subsp. pekinensis clone KBrB092B15, complete sequence
          Length = 119944

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 918   tggatgaaaatatgaatccaaaaata 943
             |||||||||| |||||||||||||||
Sbjct: 87370 tggatgaaaagatgaatccaaaaata 87345



to top

>gb|CP000384.1| Mycobacterium sp. MCS, complete genome
          Length = 5705448

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 2181    tccaagcactggcggttcaccc 2202
               ||||||||||||||||||||||
Sbjct: 1473603 tccaagcactggcggttcaccc 1473624



to top

>ref|NM_118461.2| Arabidopsis thaliana kinase (AT4G23320) mRNA, complete cds
          Length = 1251

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1003 agtagttggaacaatgggatacatgccacc 1032
            ||||||||||||||| || |||||||||||
Sbjct: 939  agtagttggaacaatcggttacatgccacc 968



to top

>ref|NM_123189.1| Arabidopsis thaliana PR5K; kinase/ transmembrane receptor protein
            serine/threonine kinase (PR5K) mRNA, complete cds
          Length = 2316

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 899  aagccggagaacatactgatggatgaaaat 928
            |||||| |||||||||||||||| ||||||
Sbjct: 1483 aagccgcagaacatactgatggacgaaaat 1512



to top

>gb|AC164116.4| Mus musculus BAC clone RP24-242F4 from chromosome 13, complete sequence
          Length = 155449

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 922    tgaaaatatgaatccaaaaata 943
              ||||||||||||||||||||||
Sbjct: 120905 tgaaaatatgaatccaaaaata 120884



to top

>ref|XM_532569.2| PREDICTED: Canis familiaris similar to cardiac-MyBP-C associated
            Ca/CaM kinase (LOC475345), mRNA
          Length = 3114

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 887  cacctggatcttaagccggagaacatactg 916
            |||||||| || ||||||||||||||||||
Sbjct: 2491 cacctggacctcaagccggagaacatactg 2520



to top

>ref|XM_384230.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG04054.1)
           partial mRNA
          Length = 1500

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 887 cacctggatcttaagccggagaacat 912
           |||| |||||||||||||||||||||
Sbjct: 550 caccgggatcttaagccggagaacat 575



to top

>gb|AC148335.4| Mus musculus BAC clone RP23-103H10 from chromosome 10, complete sequence
          Length = 210685

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1821   ttccctgttttaacattttgtttttgattt 1850
              ||||||||||| |||||||||| |||||||
Sbjct: 161526 ttccctgttttgacattttgttgttgattt 161555



to top

>ref|XM_658500.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5988.2) partial
            mRNA
          Length = 3429

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 1495 tttcatcggcaaactctcgaagcttt 1520
            ||||||||||||| ||||||||||||
Sbjct: 2179 tttcatcggcaaagtctcgaagcttt 2154



to top

>gb|AC023085.7| Homo sapiens chromosome 11, clone RP11-513I7, complete sequence
          Length = 175063

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1827   gttttaacattttgtttttgat 1848
              ||||||||||||||||||||||
Sbjct: 109978 gttttaacattttgtttttgat 109999



to top

>gb|AC133096.3| Mus musculus BAC clone RP23-271C13 from chromosome 1, complete sequence
          Length = 195512

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 464    gatgaaatcacatgtggtttct 485
              ||||||||||||||||||||||
Sbjct: 116240 gatgaaatcacatgtggtttct 116261



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 203     cgccgtggccgggctgcgcggc 224
               ||||||||||||||||||||||
Sbjct: 1742225 cgccgtggccgggctgcgcggc 1742204



to top

>dbj|AB005247.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXA21
          Length = 87841

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 899   aagccggagaacatactgatggatgaaaat 928
             |||||| |||||||||||||||| ||||||
Sbjct: 81551 aagccgcagaacatactgatggacgaaaat 81522



to top

>emb|AL929088.23| Mouse DNA sequence from clone RP23-360J2 on chromosome 2, complete
             sequence
          Length = 77156

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 1057  cacacgcacacatgacatatatagtc 1082
             ||||| ||||||||||||||||||||
Sbjct: 12632 cacacacacacatgacatatatagtc 12657



to top

>gb|AC159264.3| Mus musculus BAC clone RP24-67G10 from chromosome 13, complete sequence
          Length = 164748

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 922    tgaaaatatgaatccaaaaata 943
              ||||||||||||||||||||||
Sbjct: 155205 tgaaaatatgaatccaaaaata 155226



to top

>gb|U48698.1|ATU48698 Arabidopsis thaliana putative receptor serine/threonine kinase PR5K
            (PR5K) mRNA, complete cds
          Length = 2316

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 899  aagccggagaacatactgatggatgaaaat 928
            |||||| |||||||||||||||| ||||||
Sbjct: 1483 aagccgcagaacatactgatggacgaaaat 1512



to top

>emb|CT476825.1| S.lycopersicum DNA sequence from clone LE_HBa-198L24 on chromosome 4,
             complete sequence
          Length = 160432

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 2736  atatagtatatgttaagagcat 2757
             ||||||||||||||||||||||
Sbjct: 87537 atatagtatatgttaagagcat 87516


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 549,208,306
Number of extensions: 29273520
Number of successful extensions: 157578
Number of sequences better than 10.0: 28
Number of HSP's gapped: 157578
Number of HSP's successfully gapped: 28
Length of query: 3033
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 3010
Effective length of database: 18,503,978,556
Effective search space: 55696975453560
Effective search space used: 55696975453560
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)
to top