ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf133o17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
2emb|CR753894.12| Mouse DNA sequence from clone RP23-222I6 on chr... 50 0.007
3dbj|AP006529.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
4gb|DQ244798.1| Zea mays clone 10838 mRNA sequence 48 0.027
5gb|BT019101.1| Zea mays clone Contig702.F mRNA sequence 48 0.027
6dbj|AK127934.1| Homo sapiens cDNA FLJ46043 fis, clone SPLEN2042051 46 0.11
7gb|AC104450.2| Homo sapiens chromosome 3 clone RP11-493K19, comp... 46 0.11
8gb|AC004693.1|AC004693 Homo sapiens cosmid clone LUCA20 from 3p2... 46 0.11
9gb|AC118201.8| Mus musculus chromosome 7, clone RP23-339M11, com... 44 0.42
10gb|AC130659.11| Mus musculus chromosome 1, clone RP23-326C19, co... 44 0.42
11gb|AC134577.4| Mus musculus BAC clone RP24-79G11 from chromosome... 44 0.42
12gb|AY604046.1| Homo sapiens fibroblast growth factor 10 (FGF10) ... 44 0.42
13gb|AC131081.7| Mus musculus chromosome 10, clone RP23-438J1, com... 44 0.42
14gb|AC122251.4| Mus musculus BAC clone RP23-167J15 from chromosom... 44 0.42
15gb|AC124733.4| Mus musculus BAC clone RP23-306C18 from 12, compl... 44 0.42
16gb|AC152503.5| Mus musculus BAC clone RP23-190G10 from chromosom... 44 0.42
17gb|AC111111.11| Mus musculus chromosome 3, clone RP23-201A9, com... 44 0.42
18gb|AY077728.2| Podospora anserina cytosolic thioredoxin I (trx1)... 44 0.42
19gb|AC162295.3| Mus musculus chromosome 1, clone RP24-232K22, com... 44 0.42
20gb|AF276759.4| Homo sapiens chromosome 8 clone RP11-420F14 map p... 44 0.42
21gb|AC069113.9| Homo sapiens chromosome 8, clone RP11-597M17, com... 44 0.42
22gb|AC124822.10| Mus musculus chromosome 3, clone RP24-217O18, co... 44 0.42
23emb|AL137003.12| Human DNA sequence from clone RP1-151F17 on chr... 44 0.42
24gb|AC154456.2| Mus musculus BAC clone RP23-186O10 from chromosom... 44 0.42
25gb|AC093537.2| Homo sapiens chromosome 5 clone RP11-8L21, comple... 44 0.42
26gb|AC154588.2| Mus musculus BAC clone RP23-363L9 from chromosome... 44 0.42
27ref|NM_001031150.1| Gallus gallus RAP1, GTP-GDP dissociation sti... 44 0.42
28dbj|AP002840.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 44 0.42
29emb|BX942826.8| Mouse DNA sequence from clone RP23-34P2 on chrom... 44 0.42
30emb|AL672063.36| Mouse DNA sequence from clone RP23-65A22 on chr... 44 0.42
31gb|AC139379.4| Mus musculus BAC clone RP23-233P1 from chromosome... 44 0.42
32gb|AC161053.5| Mus musculus BAC clone RP23-381G13 from chromosom... 44 0.42
33ref|XM_001232604.1| PREDICTED: Gallus gallus similar to AP-3 com... 42 1.7
34gb|AC053481.14| Homo sapiens chromosome 17, clone RP11-51L5, com... 42 1.7
35gb|AC027176.23| Homo sapiens chromosome 15, clone RP11-493E3, co... 42 1.7
36gb|AC153019.8| Mus musculus BAC clone RP23-110D19 from chromosom... 42 1.7
37ref|XM_792424.2| PREDICTED: Strongylocentrotus purpuratus hypoth... 42 1.7
38ref|XM_001198284.1| PREDICTED: Strongylocentrotus purpuratus hyp... 42 1.7
39ref|NM_001071363.1| Oryza sativa (japonica cultivar-group) Os10g... 42 1.7
40ref|NM_001053708.1| Oryza sativa (japonica cultivar-group) Os02g... 42 1.7
41ref|XM_001146976.1| PREDICTED: Pan troglodytes similar to subtil... 42 1.7
42ref|XM_001127810.1| PREDICTED: Homo sapiens hypothetical protein... 42 1.7
43gb|AC115640.8| Rattus norvegicus BAC CH230-210B21 () complete s... 42 1.7
44ref|XM_001079666.1| PREDICTED: Rattus norvegicus hypothetical pr... 42 1.7
45ref|XM_001066243.1| PREDICTED: Rattus norvegicus hypothetical pr... 42 1.7
46ref|XM_485681.4| PREDICTED: Mus musculus WD repeat domain 66 (Wd... 42 1.7
47gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, c... 42 1.7
48gb|AC103397.7| Mus musculus chromosome 8, clone RP24-439K22, com... 42 1.7
49gb|AC105976.13| Mus musculus chromosome 5, clone RP24-315H14, co... 42 1.7
50gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome... 42 1.7
51gb|AC163657.3| Mus musculus BAC clone RP24-302A24 from chromosom... 42 1.7
52gb|AC165274.2| Mus musculus BAC clone RP24-97D3 from chromosome ... 42 1.7
53gb|AC115830.6| Mus musculus chromosome 7, clone RP24-96A19, comp... 42 1.7
54gb|AC137120.22| Mus musculus chromosome 15, clone RP23-255G14, c... 42 1.7
55gb|AC163337.2| Mus musculus chromosome 5, clone RP23-297I15, com... 42 1.7
56gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, com... 42 1.7
57gb|AC165424.2| Mus musculus BAC clone RP24-68L23 from chromosome... 42 1.7
58gb|AC117682.11| Mus musculus chromosome 1, clone RP23-436K7, com... 42 1.7
59gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, com... 42 1.7
60gb|AC132901.11| Mus musculus chromosome 13, clone RP24-282A18, c... 42 1.7
61gb|AC162690.2| Mus musculus chromosome 5, clone RP24-170F2, comp... 42 1.7
62gb|AC109139.15| Mus musculus chromosome 8, clone RP23-47L13, com... 42 1.7
63gb|AC161048.2| Mus musculus BAC clone RP24-105N22 from chromosom... 42 1.7
64gb|AC162920.2| Mus musculus BAC clone RP23-357C16 from chromosom... 42 1.7
65gb|AC093474.7| Mus musculus chromosome 7, clone RP23-54H2, compl... 42 1.7
66gb|AC144736.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
67gb|AC144452.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
68gb|AC155074.12| Mus musculus chromosome 15, clone RP24-127H11, c... 42 1.7
69gb|AC161056.5| Mus musculus BAC clone RP23-241J7 from chromosome... 42 1.7
70gb|AC119230.16| Mus musculus chromosome 1, clone RP24-210L3, com... 42 1.7
71gb|AC113504.10| Mus musculus chromosome 5, clone RP23-370G17, co... 42 1.7
72gb|AC118545.20| Mus musculus strain C57BL/6J clone rp23-324o14 m... 42 1.7
73gb|AC132340.3| Mus musculus BAC clone RP24-166O10 from chromosom... 42 1.7
74gb|AC113011.9| Mus musculus chromosome 16, clone RP23-173D22, co... 42 1.7
75gb|AC121965.3| Mus musculus BAC clone RP24-262G23 from chromosom... 42 1.7
76gb|AC132256.3| Mus musculus BAC clone RP24-358I7 from chromosome... 42 1.7
77gb|AC127345.4| Mus musculus BAC clone RP23-217K23 from chromosom... 42 1.7
78gb|AC102573.10| Mus musculus chromosome 1, clone RP23-237L7, com... 42 1.7
79gb|AC129335.4| Mus musculus BAC clone RP23-109H7 from chromosome... 42 1.7
80gb|AC116404.12| Mus musculus chromosome 5, clone RP23-143M9, com... 42 1.7
81gb|AC121939.3| Mus musculus BAC clone RP24-208M2 from chromosome... 42 1.7
82gb|AC123551.5| Mus musculus BAC clone RP24-330P10 from chromosom... 42 1.7
83gb|AC124399.4| Mus musculus BAC clone RP24-351I17 from chromosom... 42 1.7
84gb|AC125162.4| Mus musculus BAC clone RP24-421D9 from chromosome... 42 1.7
85gb|AC124391.3| Mus musculus BAC clone RP24-439L13 from chromosom... 42 1.7
86gb|AC122396.4| Mus musculus BAC clone RP24-89O12 from chromosome... 42 1.7
87gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome... 42 1.7
88gb|AC127369.4| Mus musculus BAC clone RP23-26A15 from 8, complet... 42 1.7
89gb|AC115291.7| Mus musculus BAC clone RP23-65P2 from 15, complet... 42 1.7
90gb|AC098743.3| Mus musculus BAC clone RP23-122O4 from 1, complet... 42 1.7
91gb|AC108949.4| Mus musculus BAC clone RP23-451K2 from 6, complet... 42 1.7
92gb|AC121891.2| Mus musculus BAC clone RP24-155I9 from 8, complet... 42 1.7
93gb|AC024607.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 42 1.7
94gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, com... 42 1.7
95gb|AC101659.12| Mus musculus chromosome 7, clone RP23-202M11, co... 42 1.7
96gb|AC165347.4| Mus musculus BAC clone RP23-348B21 from chromosom... 42 1.7
97gb|AC010001.44| Mus musculus strain 129/Sv clone ct7-121i21 map ... 42 1.7
98gb|AC164616.4| Mus musculus BAC clone RP23-322A5 from chromosome... 42 1.7
99gb|AC102849.5| Mus musculus, clone RP24-423P7, complete sequence 42 1.7
100gb|AC134384.6| Mus musculus strain C57BL/6J clone rp23-393d21, c... 42 1.7
101gb|AC134383.11| Mus musculus strain C57BL/6J clone rp23-348k4, c... 42 1.7
102gb|AC112031.4| Rattus norvegicus BAC CH230-99K18 (Children's Ho... 42 1.7
103gb|AC109142.7| Mus musculus chromosome 8, clone RP23-168D5, comp... 42 1.7
104gb|AC122546.14| Mus musculus chromosome 5, clone RP23-408A1, com... 42 1.7
105gb|AC155255.3| Mus musculus BAC clone RP24-143P3 from chromosome... 42 1.7
106gb|AC091682.26| Mus musculus strain C57BL/6J chromosome 3 clone ... 42 1.7
107gb|AC117395.5| Homo sapiens 3 BAC RP11-651P23 (Roswell Park Canc... 42 1.7
108gb|AC016924.19| Homo sapiens 3 BAC RP11-205A6 (Roswell Park Canc... 42 1.7
109emb|BX942819.18| Zebrafish DNA sequence from clone CH211-197E10 ... 42 1.7
110gb|AC112777.7| Homo sapiens 12 BAC RP11-424C20 (Roswell Park Can... 42 1.7
111gb|AC117403.4| Homo sapiens 12 BAC RP11-239E14 (Roswell Park Can... 42 1.7
112ref|XM_813659.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 1.7
113gb|AC097501.3| Homo sapiens BAC clone RP11-340A13 from 4, comple... 42 1.7
114gb|AC093783.2| Homo sapiens BAC clone RP11-209D20 from 4, comple... 42 1.7
115dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
116dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
117dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
118dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
119dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
120emb|BX004827.18| Human DNA sequence from clone RP13-391G2 on chr... 42 1.7
121emb|AL732314.18| Human DNA sequence from clone RP13-465B17 on ch... 42 1.7
122emb|AL357932.15| Human DNA sequence from clone RP11-435N12 on ch... 42 1.7
123emb|AL356269.10| Human DNA sequence from clone RP11-420J12 on ch... 42 1.7
124emb|AL353092.6| Human DNA sequence from clone RP1-180I13 on chro... 42 1.7
125gb|AC160123.2| Mus musculus BAC clone RP23-354J5 from chromosome... 42 1.7
126emb|AL034405.16|HS537K23 Human DNA sequence from clone RP4-537K2... 42 1.7
127gb|AC158538.2| Mus musculus BAC clone RP23-2H11 from chromosome ... 42 1.7
128gb|AC133652.6| Mus musculus BAC clone RP24-283H8 from chromosome... 42 1.7
129gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genom... 42 1.7
130gb|AC025763.5| Homo sapiens chromosome 16 clone CTB-186A5, compl... 42 1.7
131emb|BX294027.1|NCB8G12 Neurospora crassa DNA linkage group V BAC... 42 1.7
132emb|AL663015.5|OSJN00213 Oryza sativa genomic DNA, chromosome 4,... 42 1.7
133emb|AL662980.3|OSJN00185 Oryza sativa genomic DNA, chromosome 4,... 42 1.7
134emb|AL670009.1|NC123A4 Neurospora crassa DNA linkage group V cos... 42 1.7
135emb|AL662962.3|OSJN00165 Oryza sativa genomic DNA, chromosome 4,... 42 1.7
136gb|AC153375.3| Mus musculus 6 BAC RP23-353E9 (Roswell Park Cance... 42 1.7
137gb|AC153516.8| Mus musculus 10 BAC RP23-390D8 (Roswell Park Canc... 42 1.7
138gb|AC153887.6| Mus musculus 10 BAC RP23-473N3 (Roswell Park Canc... 42 1.7
139emb|AL645702.14| Mouse DNA sequence from clone RP23-163J17 on ch... 42 1.7
140emb|AL645971.12| Mouse DNA sequence from clone RP23-378J19 on ch... 42 1.7
141emb|AL645751.12| Mouse DNA sequence from clone RP23-396K15 on ch... 42 1.7
142emb|AL807395.8| Mouse DNA sequence from clone RP23-81P12 on chro... 42 1.7
143emb|AL603925.20| Mouse DNA sequence from clone RP23-175K24 on ch... 42 1.7
144gb|AC087528.15| Homo sapiens chromosome 15, clone RP11-497M17, c... 42 1.7
145gb|AC154535.2| Mus musculus BAC clone RP23-447M9 from chromosome... 42 1.7
146dbj|AP006068.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
147dbj|AP004865.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
148gb|AC149055.6| Mus musculus BAC clone RP23-358K1 from chromosome... 42 1.7
149gb|AC152823.3| Mus musculus BAC clone RP24-302N10 from chromosom... 42 1.7
150gb|AC010533.6|AC010533 Homo sapiens chromosome 16 clone RP11-229... 42 1.7
151gb|AC069145.5|AC069145 Oryza sativa chromosome 10 BAC OSJNBb0094... 42 1.7
152dbj|AP005917.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
153gb|AC087096.11| Oryza sativa chromosome 3 BAC OSJNBa0087O09 geno... 42 1.7
154dbj|AP003974.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
155dbj|AP005069.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
156gb|AC005857.1| Homo sapiens 14 PAC RP4-809F18 (Roswell Pack Canc... 42 1.7
157ref|XM_955965.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.7
158ref|XM_952310.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.7
159gb|AC087284.22| Homo sapiens chromosome 15, clone RP11-617F23, c... 42 1.7
160dbj|AK102754.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
161emb|AL845547.18| Mouse DNA sequence from clone RP23-296A4 on chr... 42 1.7
162dbj|AK067894.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
163dbj|AK064870.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
164gb|AC163763.3| Pan troglodytes BAC clone CH251-180G5 from chromo... 42 1.7
165gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, c... 42 1.7
166gb|AC156950.4| Mus musculus 10 BAC RP24-329N2 (Roswell Park Canc... 42 1.7
167gb|AC108826.9| Mus musculus chromosome 16, clone RP23-109P11, co... 42 1.7
168emb|AL670413.19| Mouse DNA sequence from clone RP23-298E4 on chr... 42 1.7
169gb|AC005227.2|AC005227 Homo sapiens PAC clone RP5-1003N18 from 1... 42 1.7
170gb|AC153897.4| Mus musculus 10 BAC RP23-119E2 (Roswell Park Canc... 42 1.7
171gb|AC174651.2| Mus musculus BAC clone CH25-241D1 from chromosome... 42 1.7
172gb|AC161802.7| Mus musculus chromosome 5, clone RP23-477G6, comp... 42 1.7
173gb|AC155158.15| Mus musculus chromosome 3, clone RP24-70L3, comp... 42 1.7
174gb|AC091484.8| Mus musculus strain C57BL/6J chromosome 17 clone ... 42 1.7
175gb|AC091777.26| Mus musculus strain C57BL/6J chromosome 17 clone... 42 1.7
176emb|AL683884.26| Mouse DNA sequence from clone RP23-117B19 on ch... 42 1.7
177emb|AL591411.14| Mouse DNA sequence from clone RP23-428M13 on ch... 42 1.7
178gb|AY082611.1| Ocimum basilicum p-coumaroyl shikimate 3'-hydroxy... 42 1.7
179emb|AL805897.13| Mouse DNA sequence from clone RP23-63D8 on chro... 42 1.7
180gb|AC127691.4| Mus musculus BAC clone RP24-216M10 from 9, comple... 42 1.7
181emb|CT033780.10| Mouse DNA sequence from clone RP24-329E14 on ch... 42 1.7
182gb|AC133499.3| Mus musculus BAC clone RP24-248F14 from 8, comple... 42 1.7
183gb|AC147230.3| Mus musculus BAC clone RP23-239N12 from 15, compl... 42 1.7
184gb|AC140213.2| Mus musculus BAC clone RP23-270L5 from 7, complet... 42 1.7
185gb|AC123878.4| Mus musculus BAC clone RP23-318I20 from 3, comple... 42 1.7
186gb|AC133195.4| Mus musculus BAC clone RP23-133F6 from 8, complet... 42 1.7
187gb|AC161488.7| Mus musculus chromosome 7, clone RP24-300N16, com... 42 1.7
188gb|AC083895.21| Mus musculus strain C57BL/6J chromosome 16 clone... 42 1.7
189emb|AL773567.16| Mouse DNA sequence from clone RP23-204P1 on chr... 42 1.7
190emb|AL662804.18| Mouse DNA sequence from clone RP23-341C5 on chr... 42 1.7
191emb|AL627186.13| Mouse DNA sequence from clone RP23-413I9 on chr... 42 1.7
192emb|AL844856.6| Mouse DNA sequence from clone RP23-377G1 on chro... 42 1.7
193emb|AL645723.11| Mouse DNA sequence from clone RP23-423N6 on chr... 42 1.7
194gb|AC109180.20| Mus musculus chromosome 10, clone RP23-13J14, co... 42 1.7
195emb|AL714017.11| Mouse DNA sequence from clone RP23-91C19 on chr... 42 1.7
196emb|AL606969.26| Mouse DNA sequence from clone RP23-331P21 on ch... 42 1.7
197emb|AL928593.4| Mouse DNA sequence from clone RP23-100E9 on chro... 42 1.7
198gb|AC171210.1| Mus musculus BAC clone RP23-36D15 from chromosome... 42 1.7
199gb|AC165340.3| Mus musculus BAC clone RP24-63G4 from chromosome ... 42 1.7
200gb|AC156836.6| Mus musculus BAC clone RP23-88L11 from chromosome... 42 1.7
201gb|AC121548.17| Mus musculus chromosome 5, clone RP24-86E4, comp... 42 1.7
202gb|AC153381.2| Mus musculus 6 BAC RP23-397L23 (Roswell Park Canc... 42 1.7
203ref|NM_023990.1| Rattus norvegicus sine oculis homeobox homolog ... 42 1.7
204dbj|AB057357.2| Mus musculus gene for Ankyrin 3, partial cds 42 1.7
205gb|AC010330.7| Homo sapiens chromosome 19 clone CTD-2657C13, com... 42 1.7
206gb|AC159536.21| Medicago truncatula chromosome 8 clone mth2-187n... 40 6.6
207emb|CT836019.1| Oryza sativa (indica cultivar-group) cDNA clone:... 40 6.6
208emb|CR855094.1| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 6.6
209dbj|AK243540.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 40 6.6
210ref|XM_001175972.1| PREDICTED: Strongylocentrotus purpuratus hyp... 40 6.6
211ref|XM_780348.2| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 6.6
212ref|NM_001065401.1| Oryza sativa (japonica cultivar-group) Os07g... 40 6.6
213ref|NM_001060057.1| Oryza sativa (japonica cultivar-group) Os04g... 40 6.6
214ref|NM_001059348.1| Oryza sativa (japonica cultivar-group) Os04g... 40 6.6
215ref|NM_001052951.1| Oryza sativa (japonica cultivar-group) Os02g... 40 6.6
216ref|NM_001048493.1| Oryza sativa (japonica cultivar-group) Os01g... 40 6.6
217ref|XM_001172069.1| PREDICTED: Pan troglodytes hypothetical LOC4... 40 6.6
218ref|XM_518424.2| PREDICTED: Pan troglodytes hypothetical LOC4626... 40 6.6
219ref|NM_008489.2| Mus musculus lipopolysaccharide binding protein... 40 6.6
220ref|XR_019365.1| PREDICTED: Homo sapiens similar to Beta-glucuro... 40 6.6
221ref|XR_018069.1| PREDICTED: Homo sapiens similar to Beta-glucuro... 40 6.6
222gb|AC188298.1| Macaca mulatta chromosome UNK clone CH250-45H12, ... 40 6.6
223gb|AC188122.1| Trichinella spiralis chromosome UNK clone TS195-4... 40 6.6
224ref|XM_001078690.1| PREDICTED: Rattus norvegicus SUMO/sentrin sp... 40 6.6
225ref|XM_220607.4| PREDICTED: Rattus norvegicus SUMO/sentrin speci... 40 6.6
226ref|XM_001068024.1| PREDICTED: Rattus norvegicus hypothetical pr... 40 6.6
227ref|XM_001109938.1| PREDICTED: Macaca mulatta similar to SUMO1/s... 40 6.6
228ref|XM_001109977.1| PREDICTED: Macaca mulatta similar to SUMO1/s... 40 6.6
229ref|XM_001110023.1| PREDICTED: Macaca mulatta similar to SUMO1/s... 40 6.6
230ref|XM_001102669.1| PREDICTED: Macaca mulatta nuclear receptor c... 40 6.6
231ref|XM_001102940.1| PREDICTED: Macaca mulatta nuclear receptor c... 40 6.6
232ref|XM_001102847.1| PREDICTED: Macaca mulatta nuclear receptor c... 40 6.6
233ref|XM_001102754.1| PREDICTED: Macaca mulatta nuclear receptor c... 40 6.6
234ref|XM_001116660.1| PREDICTED: Macaca mulatta similar to differe... 40 6.6
235ref|XM_001116665.1| PREDICTED: Macaca mulatta similar to differe... 40 6.6
236gb|AC165317.9| Mus musculus chromosome 5, clone RP23-265O20, com... 40 6.6
237ref|XM_899453.2| PREDICTED: Mus musculus hypothetical LOC626609 ... 40 6.6
238ref|XM_369632.1| Magnaporthe grisea 70-15 chromosome III predict... 40 6.6
239gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete se... 40 6.6
240gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete se... 40 6.6
241gb|AC115905.8| Mus musculus chromosome 1, clone RP24-472N17, com... 40 6.6
242gb|AC121143.12| Mus musculus chromosome 1, clone RP24-177B16, co... 40 6.6
243gb|AC102159.10| Mus musculus chromosome 19, clone RP23-398L11, c... 40 6.6
244gb|AC166830.3| Mus musculus BAC clone RP23-246O1 from chromosome... 40 6.6
245gb|AY248424.1| HIV-1 isolate 02SP00055143 gag-pol polyprotein ge... 40 6.6
246gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, co... 40 6.6
247gb|AC137853.21| Mus musculus chromosome 19, clone RP24-276L14, c... 40 6.6
248gb|AC135562.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.6
249gb|AC165970.3| Mus musculus BAC clone RP23-129J20 from chromosom... 40 6.6
250gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, com... 40 6.6
251gb|AC117585.8| Mus musculus chromosome 5, clone RP23-155F13, com... 40 6.6
252gb|AC124624.13| Mus musculus chromosome 5, clone RP23-417K9, com... 40 6.6
253gb|AC116697.7| Mus musculus chromosome 3, clone RP24-444C12, com... 40 6.6
254gb|AC146915.2| Oryza sativa chromosome 3 B1166C06 genomic seque... 40 6.6
255gb|AC104930.9| Mus musculus chromosome 7, clone RP24-224C21, com... 40 6.6
256gb|AC130828.4| Mus musculus BAC clone RP23-406H14 from chromosom... 40 6.6
257gb|AC131743.3| Mus musculus BAC clone RP23-68K21 from chromosome... 40 6.6
258gb|AC122283.3| Mus musculus BAC clone RP23-242G6 from chromosome... 40 6.6
259gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Can... 40 6.6
260gb|AC164304.2| Mus musculus BAC clone RP23-261B24 from chromosom... 40 6.6
261gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, compl... 40 6.6
262gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, comp... 40 6.6
263gb|AC137746.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.6
264gb|AC164091.3| Mus musculus BAC clone RP23-97M20 from chromosome... 40 6.6
265gb|AC159002.2| Mus musculus BAC clone RP23-203D7 from chromosome... 40 6.6
266ref|XM_854906.1| PREDICTED: Canis familiaris similar to WD repea... 40 6.6
267ref|XM_534664.2| PREDICTED: Canis familiaris similar to WD repea... 40 6.6
268gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESR... 40 6.6
269gb|BC007702.2| Homo sapiens differentially expressed in FDCP 6 h... 40 6.6
270gb|AC134323.3| Mus musculus BAC clone RP24-512P7 from chromosome... 40 6.6
271gb|AC124416.4| Mus musculus BAC clone RP24-308I2 from chromosome... 40 6.6
272gb|AC132454.3| Mus musculus BAC clone RP23-127P22 from chromosom... 40 6.6
273gb|AC107770.10| Mus musculus chromosome 5, clone RP23-114M24, co... 40 6.6
274gb|AC124413.2| Mus musculus BAC clone RP24-280K5 from chromosome... 40 6.6
275gb|AC127371.3| Mus musculus BAC clone RP23-35D4 from 15, complet... 40 6.6
276gb|AC124775.4| Mus musculus BAC clone RP23-60N3 from 7, complete... 40 6.6
277gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complet... 40 6.6
278gb|AC126121.2| Homo sapiens chromosome 3 clone RP11-719N22, comp... 40 6.6
279gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, compl... 40 6.6
280gb|AC131234.3| Homo sapiens 12 BAC RP11-308F13 (Roswell Park Can... 40 6.6
281gb|AC146478.2| Pan troglodytes BAC clone CH251-409D17 from Y, co... 40 6.6
282gb|AC099654.5| Homo sapiens BAC clone RP11-1217F2 from 7, comple... 40 6.6
283gb|BC017504.1| Homo sapiens cDNA clone MGC:23250 IMAGE:4864393, ... 40 6.6
284gb|BC004795.1| Mus musculus lipopolysaccharide binding protein, ... 40 6.6
285gb|AC115752.8| Mus musculus chromosome 19, clone RP23-18M16, com... 40 6.6
286gb|AC101205.7| Mus musculus chromosome 14, clone RP23-178N17, co... 40 6.6
287gb|AC103627.6| Mus musculus chromosome 1, clone RP24-241N3, comp... 40 6.6
288gb|AC142291.1| Pan troglodytes BAC clone RP43-184P18 from 7, com... 40 6.6
289dbj|AK093613.1| Homo sapiens cDNA FLJ36294 fis, clone THYMU20041... 40 6.6
290gb|AC074335.11| Mus Musculus Strain C57BL6/J Chromosome 18 BAC, ... 40 6.6
291dbj|AK158105.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 40 6.6
292gb|AC104976.3| Homo sapiens chromosome 8, clone RP11-191D14, com... 40 6.6
293dbj|AK143562.1| Mus musculus 6 days neonate spleen cDNA, RIKEN f... 40 6.6
294gb|AC010857.8| Homo sapiens chromosome 8, clone RP11-301G7, comp... 40 6.6
295gb|AC012229.8| Homo sapiens chromosome 15, clone RP11-182L7, com... 40 6.6
296gb|AC020906.6| Homo sapiens chromosome 19 clone CTB-83J15, compl... 40 6.6
297gb|AC008891.7| Homo sapiens chromosome 19 clone CTD-2226J19, com... 40 6.6
298dbj|AK084554.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 40 6.6
299emb|CR956405.10| Pig DNA sequence from clone CH242-240K6 on chro... 40 6.6
300dbj|AK034187.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 6.6
301emb|AL606632.5| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 6.6
302dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
303dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
304dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
305gb|AC090193.7| Homo sapiens chromosome 8, clone RP11-174I12, com... 40 6.6
306emb|CR391930.9| Zebrafish DNA sequence from clone CH211-154B16 i... 40 6.6
307emb|Z97832.11|HS329A5 Human DNA sequence from clone RP3-329A5 on... 40 6.6
308emb|AL603752.6| Human DNA sequence from clone RP11-296A1 on chro... 40 6.6
309emb|AL357136.22| Human DNA sequence from clone RP11-814L17 on ch... 40 6.6
310gb|AC026427.4| Homo sapiens chromosome 5 clone CTD-2193P3, compl... 40 6.6
311emb|AL035088.1|HS3D11 Human DNA sequence from clone RP1-3D11 on ... 40 6.6
312gb|AC116380.14| Mus musculus chromosome 1, clone RP23-6F21, comp... 40 6.6
313gb|AC155930.3| Mus musculus BAC clone RP23-412K9 from chromosome... 40 6.6
314gb|AC159129.4| Mus musculus BAC clone RP23-472N21 from chromosom... 40 6.6
315gb|AC159812.2| Mus musculus BAC clone RP24-86O15 from chromosome... 40 6.6
316gb|AC154217.2| Mus musculus BAC clone RP24-357L19 from chromosom... 40 6.6
317gb|AC125145.3| Mus musculus BAC clone RP24-347B7 from chromosome... 40 6.6
318gb|AC154198.3| Mus musculus BAC clone RP24-393P24 from chromosom... 40 6.6
319emb|X99347.1|MMLPS M.musculus mRNA for LPS-binding protein 40 6.6
320ref|NM_022047.2| Homo sapiens differentially expressed in FDCP 6... 40 6.6
321gb|AC020901.8|AC020901 Homo sapiens chromosome 5 clone CTC-527N1... 40 6.6
322emb|AL603707.5| Mouse DNA sequence from clone RP23-422L16 on chr... 40 6.6
323emb|AL606647.3|OSJN00096 Oryza sativa genomic DNA, chromosome 4,... 40 6.6
324gb|AC136735.7| Mus musculus chromosome 3, clone RP23-175G2, comp... 40 6.6
325emb|AJ276095.1|HSA276095 Homo sapiens mRNA for putative recombin... 40 6.6
326emb|AL663039.18| Mouse DNA sequence from clone RP23-50H23 on chr... 40 6.6
327emb|AL663050.11| Mouse DNA sequence from clone RP23-48B14 on chr... 40 6.6
328emb|AL731818.6| Mouse DNA sequence from clone RP23-401L13 on chr... 40 6.6
329emb|AL596264.13| Mouse DNA sequence from clone RP23-232G8 on chr... 40 6.6
330gb|AC124758.6| Mus musculus BAC clone RP23-123I10 from chromosom... 40 6.6
331gb|AC155725.3| Mus musculus 6 BAC RP24-231N5 (Roswell Park Cance... 40 6.6
332gb|AC009967.8| Homo sapiens BAC clone RP11-401O19 from 2, comple... 40 6.6
333dbj|BS000632.2| Pan troglodytes chromosome Y clone: PTB-399O20, ... 40 6.6
334dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 6.6
335gb|AC004617.2|AC004617 Homo sapiens chromosome Y, clone 264,M,20... 40 6.6
336emb|CR624997.1| full-length cDNA clone CS0DB002YN20 of Neuroblas... 40 6.6
337dbj|AP003250.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
338gb|AC091755.3| Sus scrofa clone RP44-123F10, complete sequence 40 6.6
339dbj|AP003756.5| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
340dbj|AP005004.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
341dbj|BS000103.1| Pan troglodytes chromosome 22 clone:PTB-031J04, ... 40 6.6
342dbj|AP005795.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
343gb|AC137633.2| Homo sapiens 12 BAC RP11-113I1 (Roswell Park Canc... 40 6.6
344dbj|AP004010.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.6
345dbj|AK119236.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.6
346ref|XM_956978.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.6
347emb|AL773515.7| Mouse DNA sequence from clone RP23-391M19 on chr... 40 6.6
348emb|BX663513.13| Zebrafish DNA sequence from clone DKEY-234F12 i... 40 6.6
349gb|AC124989.7| Mus musculus chromosome 1, clone RP24-404O8, comp... 40 6.6
350gb|AF254981.4| Homo sapiens chromosome 8 clone RP11-429D14 map 8... 40 6.6
351dbj|AK099191.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.6
352dbj|AK072990.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.6
353dbj|AK069852.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.6
354dbj|AK067438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.6
355gb|AC115976.13| Mus musculus chromosome 1, clone RP24-82A12, com... 40 6.6
356gb|AC102224.21| Mus musculus chromosome 3, clone RP24-372D1, com... 40 6.6
357emb|BX544874.5| Mouse DNA sequence from clone RP23-127D5 on chro... 40 6.6
358gb|AC154173.3| Mus musculus BAC clone RP23-3C4 from 3, complete ... 40 6.6
359dbj|AP003402.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.6
360dbj|AP001693.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 6.6
361emb|AJ324209.1|HSA324209 Homo sapiens genomic sequence surroundi... 40 6.6
362dbj|AP002810.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.6
363dbj|AP003094.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.6
364emb|AL590328.2|CNS07EG5 Human chromosome 14 DNA sequence BAC R-8... 40 6.6
365gb|AC154846.2| Mus musculus BAC clone RP23-45E1 from 14, complet... 40 6.6
366gb|AC153814.4| Mus musculus chromosome 17, clone RP23-323F20, co... 40 6.6
367gb|AC103935.10| Mus musculus chromosome 8, clone RP23-431O7, com... 40 6.6
368gb|AC007057.3|AC007057 Homo sapiens chromosome 14 clone containi... 40 6.6
369emb|AL121839.3|CNS01DSQ Human chromosome 14 DNA sequence BAC R-7... 40 6.6
370gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 6.6
371emb|AL929138.15| Mouse DNA sequence from clone RP23-395O2 on chr... 40 6.6
372emb|BX294125.5| Mouse DNA sequence from clone RP24-129F5 on chro... 40 6.6
373gb|AC147371.4| Mus musculus BAC clone RP24-247D2 from 6, complet... 40 6.6
374gb|AC129214.5| Mus musculus BAC clone RP24-426N11 from 16, compl... 40 6.6
375emb|CT033773.8| Mouse DNA sequence from clone RP23-176M23 on chr... 40 6.6
376gb|AC140264.2| Mus musculus BAC clone RP23-316F10 from 10, compl... 40 6.6
377gb|AC132383.5| Mus musculus BAC clone RP23-434M19 from 10, compl... 40 6.6
378emb|AL355432.7|HS56F10 Homo sapiens chromosome 9 BAC RP11-56F10,... 40 6.6
379emb|CT030657.5| Mouse DNA sequence from clone RP23-142A12 on chr... 40 6.6
380gb|AC162912.5| Mus musculus BAC clone RP24-381G1 from chromosome... 40 6.6
381emb|AL663117.14| Mouse DNA sequence from clone RP23-217A20 on ch... 40 6.6
382emb|AL591964.38| Mouse DNA sequence from clone RP23-85M21 on chr... 40 6.6
383emb|AL672101.22| Mouse DNA sequence from clone RP23-170E12 on ch... 40 6.6
384emb|AL844169.6| Mouse DNA sequence from clone RP23-322K15 on chr... 40 6.6
385emb|AL645600.11| Mouse DNA sequence from clone RP23-396N4 on chr... 40 6.6
386emb|AL663063.14| Mouse DNA sequence from clone RP23-407H16 on ch... 40 6.6
387emb|AL806518.6| Mouse DNA sequence from clone RP23-25B10 on chro... 40 6.6
388emb|AL732506.10| Mouse DNA sequence from clone RP23-195K8 on chr... 40 6.6
389emb|AL732473.12| Mouse DNA sequence from clone RP23-130J8 on chr... 40 6.6
390emb|AL732403.9| Mouse DNA sequence from clone RP23-119L20 on chr... 40 6.6
391gb|AC127544.4| Homo sapiens chromosome 8, clone CTD-3108G6, comp... 40 6.6
392gb|AF267170.4| Homo sapiens chromosome 8 clone RP11-174I12 map 8... 40 6.6
393dbj|AP001340.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 6.6
394dbj|AP004247.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 6.6
395emb|AL844224.3| Mouse DNA sequence from clone RP24-362D22 on chr... 40 6.6

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043
 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 49       aggaggggaaggaggaggaggctgc 73
                |||||||||||||||||||||||||
Sbjct: 11967299 aggaggggaaggaggaggaggctgc 11967275



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 38      agcatcagacaaggaggggaaggaggaggagg 69
               |||||| |||||||||| | ||||||||||||
Sbjct: 2184055 agcatccgacaaggaggaggaggaggaggagg 2184024



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 49      aggaggggaaggaggaggag 68
               ||||||||||||||||||||
Sbjct: 9114324 aggaggggaaggaggaggag 9114305



to top

>emb|CR753894.12| Mouse DNA sequence from clone RP23-222I6 on chromosome 2, complete
             sequence
          Length = 110921

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 44    agacaaggaggggaaggaggaggag 68
             |||||||||||||||||||||||||
Sbjct: 71657 agacaaggaggggaaggaggaggag 71681



to top

>dbj|AP006529.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1114D08
          Length = 148354

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 49    aggaggggaaggaggaggaggctgc 73
             |||||||||||||||||||||||||
Sbjct: 98340 aggaggggaaggaggaggaggctgc 98316



to top

>gb|DQ244798.1| Zea mays clone 10838 mRNA sequence
          Length = 907

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 172 tcaacctcaagaggtaatctggtg 195
           ||||||||||||||||||||||||
Sbjct: 680 tcaacctcaagaggtaatctggtg 703



to top

>gb|BT019101.1| Zea mays clone Contig702.F mRNA sequence
          Length = 428

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 172 tcaacctcaagaggtaatctggtg 195
           ||||||||||||||||||||||||
Sbjct: 52  tcaacctcaagaggtaatctggtg 75



to top

>dbj|AK127934.1| Homo sapiens cDNA FLJ46043 fis, clone SPLEN2042051
          Length = 2374

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 54   gggaaggaggaggaggctgcccc 76
            |||||||||||||||||||||||
Sbjct: 1351 gggaaggaggaggaggctgcccc 1329



to top

>gb|AC104450.2| Homo sapiens chromosome 3 clone RP11-493K19, complete sequence
          Length = 217337

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 54    gggaaggaggaggaggctgcccc 76
             |||||||||||||||||||||||
Sbjct: 24366 gggaaggaggaggaggctgcccc 24344



to top

>gb|AC004693.1|AC004693 Homo sapiens cosmid clone LUCA20 from 3p21.3, complete sequence
          Length = 27700

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 54   gggaaggaggaggaggctgcccc 76
            |||||||||||||||||||||||
Sbjct: 5634 gggaaggaggaggaggctgcccc 5612



to top

>gb|AC118201.8| Mus musculus chromosome 7, clone RP23-339M11, complete sequence
          Length = 194241

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 94028 aaggaggggaaggaggaggagg 94049



to top

>gb|AC130659.11| Mus musculus chromosome 1, clone RP23-326C19, complete sequence
          Length = 172121

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 22701 aaggaggggaaggaggaggagg 22680



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 45    gacaaggaggggaaggaggaggagg 69
             |||||||||| ||||||||||||||
Sbjct: 22663 gacaaggaggagaaggaggaggagg 22639



to top

>gb|AC134577.4| Mus musculus BAC clone RP24-79G11 from chromosome 14, complete sequence
          Length = 189085

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 49     aggaggggaaggaggaggaggc 70
              ||||||||||||||||||||||
Sbjct: 161469 aggaggggaaggaggaggaggc 161490



to top

>gb|AY604046.1| Homo sapiens fibroblast growth factor 10 (FGF10) gene, complete cds
          Length = 87633

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 57820 aaggaggggaaggaggaggagg 57799



to top

>gb|AC131081.7| Mus musculus chromosome 10, clone RP23-438J1, complete sequence
          Length = 214060

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 48     aaggaggggaaggaggaggagg 69
              ||||||||||||||||||||||
Sbjct: 172599 aaggaggggaaggaggaggagg 172578



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     aaggaggggaaggaggagga 67
              ||||||||||||||||||||
Sbjct: 172536 aaggaggggaaggaggagga 172517



to top

>gb|AC122251.4| Mus musculus BAC clone RP23-167J15 from chromosome 14, complete
             sequence
          Length = 204588

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 49    aggaggggaaggaggaggaggc 70
             ||||||||||||||||||||||
Sbjct: 42582 aggaggggaaggaggaggaggc 42603



to top

>gb|AC124733.4| Mus musculus BAC clone RP23-306C18 from 12, complete sequence
          Length = 206837

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 256   ctggataaatccctttctgtct 277
             ||||||||||||||||||||||
Sbjct: 54597 ctggataaatccctttctgtct 54618



to top

>gb|AC152503.5| Mus musculus BAC clone RP23-190G10 from chromosome 16, complete
             sequence
          Length = 204940

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 82599 aaggaggggaaggaggaggagg 82578



to top

>gb|AC111111.11| Mus musculus chromosome 3, clone RP23-201A9, complete sequence
          Length = 233326

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 48     aaggaggggaaggaggaggagg 69
              ||||||||||||||||||||||
Sbjct: 159467 aaggaggggaaggaggaggagg 159488



to top

>gb|AY077728.2| Podospora anserina cytosolic thioredoxin I (trx1) gene, complete cds
          Length = 1944

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 49   aggaggggaaggaggaggaggctgcc 74
            |||||| |||||||||||||||||||
Sbjct: 1195 aggaggagaaggaggaggaggctgcc 1220



to top

>gb|AC162295.3| Mus musculus chromosome 1, clone RP24-232K22, complete sequence
          Length = 180957

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 71354 aaggaggggaaggaggaggagg 71375



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 45    gacaaggaggggaaggaggaggagg 69
             |||||||||| ||||||||||||||
Sbjct: 71392 gacaaggaggagaaggaggaggagg 71416



to top

>gb|AF276759.4| Homo sapiens chromosome 8 clone RP11-420F14 map p21-p11, complete
             sequence
          Length = 213611

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 49489 aaggaggggaaggaggaggagg 49510



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 49621 aggaggggaaggaggaggag 49640



to top

>gb|AC069113.9| Homo sapiens chromosome 8, clone RP11-597M17, complete sequence
          Length = 197616

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 48     aaggaggggaaggaggaggagg 69
              ||||||||||||||||||||||
Sbjct: 100198 aaggaggggaaggaggaggagg 100219



to top

>gb|AC124822.10| Mus musculus chromosome 3, clone RP24-217O18, complete sequence
          Length = 168065

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 48     aaggaggggaaggaggaggagg 69
              ||||||||||||||||||||||
Sbjct: 124042 aaggaggggaaggaggaggagg 124063



to top

>emb|AL137003.12| Human DNA sequence from clone RP1-151F17 on chromosome 6 Contains the
             3' end of the SCA1 gene for spinocerebellar ataxia
             1n(olivopontocerebellar ataxia 1, autosomal dominant,
             ataxin 1), complete sequence
          Length = 113802

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 49    aggaggggaaggaggaggaggc 70
             ||||||||||||||||||||||
Sbjct: 85448 aggaggggaaggaggaggaggc 85427



to top

>gb|AC154456.2| Mus musculus BAC clone RP23-186O10 from chromosome 16, complete
             sequence
          Length = 193598

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 50    ggaggggaaggaggaggaggct 71
             ||||||||||||||||||||||
Sbjct: 45370 ggaggggaaggaggaggaggct 45391



to top

>gb|AC093537.2| Homo sapiens chromosome 5 clone RP11-8L21, complete sequence
          Length = 169812

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 48     aaggaggggaaggaggaggagg 69
              ||||||||||||||||||||||
Sbjct: 135524 aaggaggggaaggaggaggagg 135545



to top

>gb|AC154588.2| Mus musculus BAC clone RP23-363L9 from chromosome 16, complete sequence
          Length = 200787

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 50    ggaggggaaggaggaggaggct 71
             ||||||||||||||||||||||
Sbjct: 76217 ggaggggaaggaggaggaggct 76196



to top

>ref|NM_001031150.1| Gallus gallus RAP1, GTP-GDP dissociation stimulator 1 (RAP1GDS1),
           mRNA
 emb|AJ719848.1| Gallus gallus mRNA for hypothetical protein, clone 7d16
          Length = 2598

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 49  aggaggggaaggaggaggaggc 70
           ||||||||||||||||||||||
Sbjct: 188 aggaggggaaggaggaggaggc 209



to top

>dbj|AP002840.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-159N11, complete
              sequence
          Length = 177031

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 47     caaggaggggaaggaggaggag 68
              ||||||||||||||||||||||
Sbjct: 161649 caaggaggggaaggaggaggag 161670



to top

>emb|BX942826.8| Mouse DNA sequence from clone RP23-34P2 on chromosome X, complete
             sequence
          Length = 40849

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 22454 aaggaggggaaggaggaggagg 22475



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    aaggaggggaaggaggagga 67
             ||||||||||||||||||||
Sbjct: 22525 aaggaggggaaggaggagga 22544



to top

>emb|AL672063.36| Mouse DNA sequence from clone RP23-65A22 on chromosome X, complete
             sequence
          Length = 229278

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 13987 aaggaggggaaggaggaggagg 13966



to top

>gb|AC139379.4| Mus musculus BAC clone RP23-233P1 from chromosome 3, complete sequence
          Length = 168532

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 26107 aaggaggggaaggaggaggagg 26086



to top

>gb|AC161053.5| Mus musculus BAC clone RP23-381G13 from chromosome 3, complete sequence
          Length = 205395

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 48    aaggaggggaaggaggaggagg 69
             ||||||||||||||||||||||
Sbjct: 72044 aaggaggggaaggaggaggagg 72065



to top

>ref|XM_001232604.1| PREDICTED: Gallus gallus similar to AP-3 complex beta3B subunit
            (LOC769343), mRNA
          Length = 3561

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 45   gacaaggaggggaaggaggaggagg 69
            |||||||||||| ||||||||||||
Sbjct: 2278 gacaaggagggggaggaggaggagg 2302



to top

>gb|AC053481.14| Homo sapiens chromosome 17, clone RP11-51L5, complete sequence
          Length = 122502

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 30648 aggaggggaaggaggaggagg 30668



to top

>gb|AC027176.23| Homo sapiens chromosome 15, clone RP11-493E3, complete sequence
          Length = 150688

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 128469 aggaggggaaggaggaggagg 128489



to top

>gb|AC153019.8| Mus musculus BAC clone RP23-110D19 from chromosome 1, complete sequence
          Length = 213842

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 88396 aggaggggaaggaggaggagg 88376



to top

>ref|XM_792424.2| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC592927
           (LOC592927), partial mRNA
          Length = 3303

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 49  aggaggggaaggaggaggagg 69
           |||||||||||||||||||||
Sbjct: 143 aggaggggaaggaggaggagg 163



to top

>ref|XM_001198284.1| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC592927
           (LOC592927), partial mRNA
          Length = 3303

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 49  aggaggggaaggaggaggagg 69
           |||||||||||||||||||||
Sbjct: 143 aggaggggaaggaggaggagg 163



to top

>ref|NM_001071363.1| Oryza sativa (japonica cultivar-group) Os10g0471400 (Os10g0471400)
           mRNA, complete cds
          Length = 4029

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 50  ggaggggaaggaggaggaggctgcc 74
           ||||||| |||||||||||||||||
Sbjct: 210 ggagggggaggaggaggaggctgcc 186



to top

>ref|NM_001053708.1| Oryza sativa (japonica cultivar-group) Os02g0566700 (Os02g0566700)
           mRNA, complete cds
          Length = 3005

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 51  gaggggaaggaggaggaggctgccc 75
           ||||||| |||||||||||||||||
Sbjct: 351 gaggggagggaggaggaggctgccc 375



to top

>ref|XM_001146976.1| PREDICTED: Pan troglodytes similar to subtilisin-like proprotein
          convertase (EC 3.4.21.-) PACE4 precursor, splice form A
          - human (LOC743234), mRNA
          Length = 4605

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 54 gggaaggaggaggaggctgcc 74
          |||||||||||||||||||||
Sbjct: 34 gggaaggaggaggaggctgcc 54



to top

>ref|XM_001127810.1| PREDICTED: Homo sapiens hypothetical protein LOC728571 (LOC728571),
           mRNA
          Length = 1710

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 49  aggaggggaaggaggaggagg 69
           |||||||||||||||||||||
Sbjct: 423 aggaggggaaggaggaggagg 403



to top

>gb|AC115640.8| Rattus norvegicus  BAC CH230-210B21 () complete sequence
          Length = 224129

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 125332 aggaggggaaggaggaggagg 125352



to top

>ref|XM_001079666.1| PREDICTED: Rattus norvegicus hypothetical protein LOC691796
          (LOC691796), mRNA
          Length = 333

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 49 aggaggggaaggaggaggagg 69
          |||||||||||||||||||||
Sbjct: 32 aggaggggaaggaggaggagg 52



to top

>ref|XM_001066243.1| PREDICTED: Rattus norvegicus hypothetical protein LOC683507
          (LOC683507), mRNA
          Length = 396

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 49 aggaggggaaggaggaggagg 69
          |||||||||||||||||||||
Sbjct: 56 aggaggggaaggaggaggagg 76



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 49 aggaggggaaggaggaggagg 69
          |||||||||||||||||||||
Sbjct: 71 aggaggggaaggaggaggagg 91



to top

>ref|XM_485681.4| PREDICTED: Mus musculus WD repeat domain 66 (Wdr66), mRNA
          Length = 3869

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 49  aggaggggaaggaggaggagg 69
           |||||||||||||||||||||
Sbjct: 314 aggaggggaaggaggaggagg 334



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 49  aggaggggaaggaggaggag 68
           ||||||||||||||||||||
Sbjct: 122 aggaggggaaggaggaggag 141



to top

>gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, complete sequence
          Length = 193998

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 138895 aggaggggaaggaggaggagg 138875



to top

>gb|AC103397.7| Mus musculus chromosome 8, clone RP24-439K22, complete sequence
          Length = 138810

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 69573 aggaggggaaggaggaggagg 69593



to top

>gb|AC105976.13| Mus musculus chromosome 5, clone RP24-315H14, complete sequence
          Length = 188130

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 105362 aggaggggaaggaggaggagg 105382



to top

>gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome 9, complete sequence
          Length = 182190

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 65011 aggaggggaaggaggaggagg 65031



to top

>gb|AC163657.3| Mus musculus BAC clone RP24-302A24 from chromosome 1, complete sequence
          Length = 197913

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 157879 aggaggggaaggaggaggagg 157859



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 49     aggaggggaaggaggaggag 68
              ||||||||||||||||||||
Sbjct: 157923 aggaggggaaggaggaggag 157904



to top

>gb|AC165274.2| Mus musculus BAC clone RP24-97D3 from chromosome 16, complete sequence
          Length = 175488

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 75118 aggaggggaaggaggaggagg 75138



to top

>gb|AC115830.6| Mus musculus chromosome 7, clone RP24-96A19, complete sequence
          Length = 153718

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 95992 aggaggggaaggaggaggagg 96012



to top

>gb|AC137120.22| Mus musculus chromosome 15, clone RP23-255G14, complete sequence
          Length = 203811

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 44370 aggaggggaaggaggaggagg 44390



to top

>gb|AC163337.2| Mus musculus chromosome 5, clone RP23-297I15, complete sequence
          Length = 154578

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 68965 aggaggggaaggaggaggagg 68945



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 69157 aggaggggaaggaggaggag 69138



to top

>gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, complete sequence
          Length = 155647

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 25895 aggaggggaaggaggaggagg 25915



to top

>gb|AC165424.2| Mus musculus BAC clone RP24-68L23 from chromosome 17, complete sequence
          Length = 178781

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 40223 aggaggggaaggaggaggagg 40203



to top

>gb|AC117682.11| Mus musculus chromosome 1, clone RP23-436K7, complete sequence
          Length = 212395

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 55362 aggaggggaaggaggaggagg 55342



to top

>gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, complete sequence
          Length = 215131

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 139419 aggaggggaaggaggaggagg 139399



to top

>gb|AC132901.11| Mus musculus chromosome 13, clone RP24-282A18, complete sequence
          Length = 187090

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 30953 aggaggggaaggaggaggagg 30933



to top

>gb|AC162690.2| Mus musculus chromosome 5, clone RP24-170F2, complete sequence
          Length = 180370

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 113311 aggaggggaaggaggaggagg 113291



to top

>gb|AC109139.15| Mus musculus chromosome 8, clone RP23-47L13, complete sequence
          Length = 268904

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 45     gacaaggaggggaaggaggaggagg 69
              |||||||||| ||||||||||||||
Sbjct: 124031 gacaaggaggagaaggaggaggagg 124055



to top

>gb|AC161048.2| Mus musculus BAC clone RP24-105N22 from chromosome 12, complete
             sequence
          Length = 149575

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 12439 aggaggggaaggaggaggagg 12459



to top

>gb|AC162920.2| Mus musculus BAC clone RP23-357C16 from chromosome 9, complete sequence
          Length = 203466

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 164071 aggaggggaaggaggaggagg 164091



to top

>gb|AC093474.7| Mus musculus chromosome 7, clone RP23-54H2, complete sequence
          Length = 202444

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 176847 aggaggggaaggaggaggagg 176827



to top

>gb|AC144736.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OSJNBa0008E07, complete sequence
          Length = 146679

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 49    aggaggggaaggaggaggaggctgc 73
             |||||| ||||||||||||||||||
Sbjct: 24241 aggaggagaaggaggaggaggctgc 24265



to top

>gb|AC144452.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
              OSJNBa0025G07, complete sequence
          Length = 167136

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 49     aggaggggaaggaggaggaggctgc 73
              |||||| ||||||||||||||||||
Sbjct: 133875 aggaggagaaggaggaggaggctgc 133899



to top

>gb|AC155074.12| Mus musculus chromosome 15, clone RP24-127H11, complete sequence
          Length = 184795

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 85086 aggaggggaaggaggaggagg 85066



to top

>gb|AC161056.5| Mus musculus BAC clone RP23-241J7 from chromosome 3, complete sequence
          Length = 226878

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 100045 aggaggggaaggaggaggagg 100025



to top

>gb|AC119230.16| Mus musculus chromosome 1, clone RP24-210L3, complete sequence
          Length = 160913

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 13722 aggaggggaaggaggaggagg 13742



to top

>gb|AC113504.10| Mus musculus chromosome 5, clone RP23-370G17, complete sequence
          Length = 219617

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 8803 aggaggggaaggaggaggagg 8823



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 49   aggaggggaaggaggaggag 68
            ||||||||||||||||||||
Sbjct: 8611 aggaggggaaggaggaggag 8630



to top

>gb|AC118545.20| Mus musculus strain C57BL/6J clone rp23-324o14 map 17, complete sequence
          Length = 236365

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 107118 aggaggggaaggaggaggagg 107098



to top

>gb|AC132340.3| Mus musculus BAC clone RP24-166O10 from chromosome 1, complete sequence
          Length = 146111

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 49     aggaggggaaggaggaggaggctgc 73
              |||||||||||||||||||| ||||
Sbjct: 126998 aggaggggaaggaggaggagactgc 127022



to top

>gb|AC113011.9| Mus musculus chromosome 16, clone RP23-173D22, complete sequence
          Length = 210962

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 48     aaggaggggaaggaggaggag 68
              |||||||||||||||||||||
Sbjct: 101004 aaggaggggaaggaggaggag 101024



to top

>gb|AC121965.3| Mus musculus BAC clone RP24-262G23 from chromosome 12, complete
             sequence
          Length = 170835

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 55693 aggaggggaaggaggaggagg 55673



to top

>gb|AC132256.3| Mus musculus BAC clone RP24-358I7 from chromosome 8, complete sequence
          Length = 163897

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 142146 aggaggggaaggaggaggagg 142166



to top

>gb|AC127345.4| Mus musculus BAC clone RP23-217K23 from chromosome 5, complete sequence
          Length = 210748

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 105497 aggaggggaaggaggaggagg 105517



to top

>gb|AC102573.10| Mus musculus chromosome 1, clone RP23-237L7, complete sequence
          Length = 185146

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 15478 aggaggggaaggaggaggagg 15458



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 15522 aggaggggaaggaggaggag 15503



to top

>gb|AC129335.4| Mus musculus BAC clone RP23-109H7 from chromosome 1, complete sequence
          Length = 201274

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 41619 aggaggggaaggaggaggagg 41599



to top

>gb|AC116404.12| Mus musculus chromosome 5, clone RP23-143M9, complete sequence
          Length = 211381

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 194964 aggaggggaaggaggaggagg 194984



to top

>gb|AC121939.3| Mus musculus BAC clone RP24-208M2 from chromosome 2, complete sequence
          Length = 153093

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 59181 aggaggggaaggaggaggagg 59201



to top

>gb|AC123551.5| Mus musculus BAC clone RP24-330P10 from chromosome 1, complete sequence
          Length = 167597

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 117821 aggaggggaaggaggaggagg 117801



to top

>gb|AC124399.4| Mus musculus BAC clone RP24-351I17 from chromosome 10, complete
             sequence
          Length = 179668

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 65385 aggaggggaaggaggaggagg 65365



to top

>gb|AC125162.4| Mus musculus BAC clone RP24-421D9 from chromosome 8, complete sequence
          Length = 206643

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 87635 aggaggggaaggaggaggagg 87615



to top

>gb|AC124391.3| Mus musculus BAC clone RP24-439L13 from chromosome 18, complete sequence
          Length = 153492

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 103126 aggaggggaaggaggaggagg 103106



to top

>gb|AC122396.4| Mus musculus BAC clone RP24-89O12 from chromosome 5, complete sequence
          Length = 205737

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 13414 aggaggggaaggaggaggagg 13394



to top

>gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome 15, complete sequence
          Length = 148390

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 17548 aggaggggaaggaggaggagg 17528



to top

>gb|AC127369.4| Mus musculus BAC clone RP23-26A15 from 8, complete sequence
          Length = 211411

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 202697 aggaggggaaggaggaggagg 202677



to top

>gb|AC115291.7| Mus musculus BAC clone RP23-65P2 from 15, complete sequence
          Length = 237119

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 102314 aggaggggaaggaggaggagg 102294



to top

>gb|AC098743.3| Mus musculus BAC clone RP23-122O4 from 1, complete sequence
          Length = 225868

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 31251 aggaggggaaggaggaggagg 31231



to top

>gb|AC108949.4| Mus musculus BAC clone RP23-451K2 from 6, complete sequence
          Length = 181571

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 48    aaggaggggaaggaggaggag 68
             |||||||||||||||||||||
Sbjct: 51231 aaggaggggaaggaggaggag 51211



to top

>gb|AC121891.2| Mus musculus BAC clone RP24-155I9 from 8, complete sequence
          Length = 165890

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 88620 aggaggggaaggaggaggagg 88640



to top

>gb|AC024607.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-240H6, complete
              sequence
          Length = 197273

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 182177 aggaggggaaggaggaggagg 182157



to top

>gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, complete sequence
          Length = 165614

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 135637 aggaggggaaggaggaggagg 135617



to top

>gb|AC101659.12| Mus musculus chromosome 7, clone RP23-202M11, complete sequence
          Length = 244819

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 42362 aggaggggaaggaggaggagg 42342



to top

>gb|AC165347.4| Mus musculus BAC clone RP23-348B21 from chromosome 13, complete
            sequence
          Length = 205783

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 4372 aggaggggaaggaggaggagg 4392



to top

>gb|AC010001.44| Mus musculus strain 129/Sv clone ct7-121i21 map 16, complete sequence
          Length = 109472

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 41445 aggaggggaaggaggaggagg 41465



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 41407 aggaggggaaggaggaggag 41426



to top

>gb|AC164616.4| Mus musculus BAC clone RP23-322A5 from chromosome 12, complete sequence
          Length = 204974

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 60449 aggaggggaaggaggaggagg 60429



to top

>gb|AC102849.5| Mus musculus, clone RP24-423P7, complete sequence
          Length = 162547

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 49912 aggaggggaaggaggaggagg 49932



to top

>gb|AC134384.6| Mus musculus strain C57BL/6J clone rp23-393d21, complete sequence
          Length = 227620

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 97035 aggaggggaaggaggaggagg 97015



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 97073 aggaggggaaggaggaggag 97054



to top

>gb|AC134383.11| Mus musculus strain C57BL/6J clone rp23-348k4, complete sequence
          Length = 227587

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 97003 aggaggggaaggaggaggagg 96983



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 97041 aggaggggaaggaggaggag 97022



to top

>gb|AC112031.4| Rattus norvegicus  BAC CH230-99K18 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 242158

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 200300 aggaggggaaggaggaggagg 200280



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 200330 aggaggggaaggaggaggagg 200310



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 200351 aggaggggaaggaggaggagg 200331



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 200381 aggaggggaaggaggaggagg 200361



to top

>gb|AC109142.7| Mus musculus chromosome 8, clone RP23-168D5, complete sequence
          Length = 207544

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 28924 aggaggggaaggaggaggagg 28904



to top

>gb|AC122546.14| Mus musculus chromosome 5, clone RP23-408A1, complete sequence
          Length = 191640

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 168357 aggaggggaaggaggaggagg 168337



to top

>gb|AC155255.3| Mus musculus BAC clone RP24-143P3 from chromosome 12, complete sequence
          Length = 201217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 139685 aggaggggaaggaggaggagg 139705



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 49     aggaggggaaggaggaggag 68
              ||||||||||||||||||||
Sbjct: 158434 aggaggggaaggaggaggag 158415



to top

>gb|AC091682.26| Mus musculus strain C57BL/6J chromosome 3 clone rp23-135c10, complete
             sequence
          Length = 206957

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 56903 aggaggggaaggaggaggagg 56883



to top

>gb|AC117395.5| Homo sapiens 3 BAC RP11-651P23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 172715

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 342   gaatctggagagtttggggct 362
             |||||||||||||||||||||
Sbjct: 36569 gaatctggagagtttggggct 36589



to top

>gb|AC016924.19| Homo sapiens 3 BAC RP11-205A6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 51001

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 21154 aggaggggaaggaggaggagg 21174



to top

>emb|BX942819.18| Zebrafish DNA sequence from clone CH211-197E10 in linkage group 23,
             complete sequence
          Length = 141473

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 48    aaggaggggaaggaggaggag 68
             |||||||||||||||||||||
Sbjct: 94625 aaggaggggaaggaggaggag 94645



to top

>gb|AC112777.7| Homo sapiens 12 BAC RP11-424C20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 160380

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 115238 aggaggggaaggaggaggagg 115218



to top

>gb|AC117403.4| Homo sapiens 12 BAC RP11-239E14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 121632

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 27348 aggaggggaaggaggaggagg 27368



to top

>ref|XM_813659.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506755.120) partial mRNA
          Length = 2133

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 1466 aggaggggaaggaggaggagg 1486



to top

>gb|AC097501.3| Homo sapiens BAC clone RP11-340A13 from 4, complete sequence
          Length = 173099

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 103964 aggaggggaaggaggaggagg 103944



to top

>gb|AC093783.2| Homo sapiens BAC clone RP11-209D20 from 4, complete sequence
          Length = 121709

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 52205 aggaggggaaggaggaggagg 52185



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10
          Length = 22685906

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 50       ggaggggaaggaggaggaggctgcc 74
                ||||||| |||||||||||||||||
Sbjct: 16975631 ggagggggaggaggaggaggctgcc 16975655



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 49       aggaggggaaggaggaggaggctgc 73
                |||||| ||||||||||||||||||
Sbjct: 12256763 aggaggagaaggaggaggaggctgc 12256787



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 49       aggaggggaaggaggaggaggctg 72
                |||||| |||||||||||||||||
Sbjct: 12612407 aggaggagaaggaggaggaggctg 12612430



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 49      aggaggggaaggaggaggaggctgc 73
               |||||| ||||||||||||||||||
Sbjct: 3818457 aggaggtgaaggaggaggaggctgc 3818481



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 49       aggaggggaaggaggaggaggctgc 73
                |||||| ||||||||||||||||||
Sbjct: 12861455 aggaggagaaggaggaggaggctgc 12861431



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 50       ggaggggaaggaggaggagg 69
                ||||||||||||||||||||
Sbjct: 21318844 ggaggggaaggaggaggagg 21318825



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 50       ggaggggaaggaggaggagg 69
                ||||||||||||||||||||
Sbjct: 27803293 ggaggggaaggaggaggagg 27803312



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 49      aggaggggaaggaggaggaggctgc 73
               |||||| ||||||||||||||||||
Sbjct: 5984714 aggaggagaaggaggaggaggctgc 5984690



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 49       aggaggggaaggaggaggaggctgc 73
                |||||| ||||||||||||||||||
Sbjct: 17765407 aggaggagaaggaggaggaggctgc 17765431



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 51       gaggggaaggaggaggaggctgccc 75
                ||||||| |||||||||||||||||
Sbjct: 21563353 gaggggagggaggaggaggctgccc 21563377



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 50      ggaggggaaggaggaggagg 69
               ||||||||||||||||||||
Sbjct: 8164026 ggaggggaaggaggaggagg 8164045



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 50       ggaggggaaggaggaggaggc 70
                |||||||||||||||||||||
Sbjct: 30381163 ggaggggaaggaggaggaggc 30381143



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 50       ggaggggaaggaggaggaggc 70
                |||||||||||||||||||||
Sbjct: 32629244 ggaggggaaggaggaggaggc 32629264



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 49       aggaggggaaggaggaggaggctg 72
                |||||| |||||||||||||||||
Sbjct: 15183127 aggaggagaaggaggaggaggctg 15183104



to top

>emb|BX004827.18| Human DNA sequence from clone RP13-391G2 on chromosome X Contains the
             SHOX gene for short stature homeobox and seven CpG
             islands, complete sequence
          Length = 119555

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 36793 aggaggggaaggaggaggagg 36813



to top

>emb|AL732314.18| Human DNA sequence from clone RP13-465B17 on chromosome X Contains the 5'
              end of the gene for protein phosphatase 2A 48 kDa
              regulatory subunit (PR48), a fatty acid binding protein 5
              (psoriasis-associated) (FABP5) pseudogene, a pseudogene
              similar to part of keratin 18 (KRT18) and nine CpG islands,
              complete sequence
          Length = 218723

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 202318 aggaggggaaggaggaggagg 202338



to top

>emb|AL357932.15| Human DNA sequence from clone RP11-435N12 on chromosome 1, complete
              sequence
          Length = 179782

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 44     agacaaggaggggaaggaggaggag 68
              ||||||||||| |||||||||||||
Sbjct: 100960 agacaaggaggagaaggaggaggag 100936



to top

>emb|AL356269.10| Human DNA sequence from clone RP11-420J12 on chromosome 13, complete
             sequence
          Length = 141895

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 11518 aggaggggaaggaggaggagg 11538



to top

>emb|AL353092.6| Human DNA sequence from clone RP1-180I13 on chromosome 20 Contains 5'
             end of the HCK gene for hemopoietic cell kinase (protein
             tyrosine kinase), contains ESTs, STSs, GSSs and a CpG
             island, complete sequence
          Length = 25010

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 20399 aggaggggaaggaggaggagg 20419



to top

>gb|AC160123.2| Mus musculus BAC clone RP23-354J5 from chromosome 9, complete sequence
          Length = 199457

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 66722 aggaggggaaggaggaggagg 66702



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    ggaggggaaggaggaggagg 69
             ||||||||||||||||||||
Sbjct: 66739 ggaggggaaggaggaggagg 66720



to top

>emb|AL034405.16|HS537K23 Human DNA sequence from clone RP4-537K23 on chromosome Xq25-26.1 Contains
              the 3' end of the ZDHHC9 gene for zinc finger, DHHC domain
              containing 9 (CGI-89, ZNF379), a novel gene, a sal-like
              family pseudogene, the SDCCAG16 gene for serologically
              defined colon cancer antigen 16 (NY-CO-16), the 5' UTR of a
              novel gene (FLHJ11362) and seven CpG islands, complete
              sequence
          Length = 156589

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 150246 aggaggggaaggaggaggagg 150226



to top

>gb|AC158538.2| Mus musculus BAC clone RP23-2H11 from chromosome 13, complete sequence
          Length = 237313

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 137826 aggaggggaaggaggaggagg 137806



to top

>gb|AC133652.6| Mus musculus BAC clone RP24-283H8 from chromosome 16, complete sequence
          Length = 177172

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 52621 aggaggggaaggaggaggagg 52601



to top

>gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genomic sequence, complete
             sequence
          Length = 130359

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 50    ggaggggaaggaggaggaggc 70
             |||||||||||||||||||||
Sbjct: 81421 ggaggggaaggaggaggaggc 81401



to top

>gb|AC025763.5| Homo sapiens chromosome 16 clone CTB-186A5, complete sequence
          Length = 194690

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 2822 aggaggggaaggaggaggagg 2802



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 2837 aggaggggaaggaggaggagg 2817



to top

>emb|BX294027.1|NCB8G12 Neurospora crassa DNA linkage group V BAC contig B8G12
          Length = 154038

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 139656 aggaggggaaggaggaggagg 139636



to top

>emb|AL663015.5|OSJN00213 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0068N06,
            complete sequence
          Length = 172895

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 49   aggaggggaaggaggaggaggctgc 73
            |||||| ||||||||||||||||||
Sbjct: 9716 aggaggagaaggaggaggaggctgc 9692



to top

>emb|AL662980.3|OSJN00185 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0080E14,
             complete sequence
          Length = 148064

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 49    aggaggggaaggaggaggaggctgc 73
             |||||| ||||||||||||||||||
Sbjct: 45438 aggaggtgaaggaggaggaggctgc 45462



to top

>emb|AL670009.1|NC123A4 Neurospora crassa DNA linkage group V cosmid contig 123A4
          Length = 153794

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 52     aggggaaggaggaggaggctg 72
              |||||||||||||||||||||
Sbjct: 107421 aggggaaggaggaggaggctg 107441



to top

>emb|AL662962.3|OSJN00165 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029L02,
              complete sequence
          Length = 165786

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 49     aggaggggaaggaggaggaggctgc 73
              |||||| ||||||||||||||||||
Sbjct: 155674 aggaggagaaggaggaggaggctgc 155650



to top

>gb|AC153375.3| Mus musculus 6 BAC RP23-353E9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 198876

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 48     aaggaggggaaggaggaggag 68
              |||||||||||||||||||||
Sbjct: 152785 aaggaggggaaggaggaggag 152765



to top

>gb|AC153516.8| Mus musculus 10 BAC RP23-390D8 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 197506

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 132006 aggaggggaaggaggaggagg 132026



to top

>gb|AC153887.6| Mus musculus 10 BAC RP23-473N3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 165306

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 85307 aggaggggaaggaggaggagg 85327



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    ggaggggaaggaggaggagg 69
             ||||||||||||||||||||
Sbjct: 85338 ggaggggaaggaggaggagg 85357



to top

>emb|AL645702.14| Mouse DNA sequence from clone RP23-163J17 on chromosome 1 Contains a
             ribosomal protein S2 (Rps2) pseudogene, a tigger
             transposable element derived 1 (TIGD1) pseudogene and a
             ribosomal protein L17 (Rpl17) pseudogene, complete
             sequence
          Length = 205103

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 79014 aggaggggaaggaggaggagg 78994



to top

>emb|AL645971.12| Mouse DNA sequence from clone RP23-378J19 on chromosome 11 Vontains the
             5' end of the gene for novel protein similar to human RAP1
             GTPase activating protein 1 RAP1GA1,,a novel gene and
             three CpG islands, complete sequence
          Length = 102898

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 97559 aggaggggaaggaggaggagg 97539



to top

>emb|AL645751.12| Mouse DNA sequence from clone RP23-396K15 on chromosome 11 Contains the
              5' end of the Gabrg2 gene for gamma-aminobutyric acid
              (GABA-A) receptor, subunit gamma 2, the 3' end of the
              Gabra1 gene for gamma-aminobutyric acid (GABA-A) receptor,
              subunit alpha 1 and the 3' end of a novel gene, complete
              sequence
          Length = 186884

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 176649 aggaggggaaggaggaggagg 176669



to top

>emb|AL807395.8| Mouse DNA sequence from clone RP23-81P12 on chromosome 11 Contains the 5'
              end of the Tcn2 gene for transcobalamin 2, two novel genes,
              a glyceraldehyde-3-phosphate dehydrogenase (Gapd)
              pseudogene, the Pes1 gene for BRCT domain containing
              pescadillo homolog 1 (zebrafish), the Gcst gene for
              galactosylceramide sulfotransferase, a
              ubiquitin-conjugating enzyme E2L 3 (Ube2l3) pseuogene, the
              Sec14l4 and Sec14l2 genes for SEC14-like 4 (S. cerevisiae)
              and 2, the ortholog of human and rat SEC14-like 3 (S.
              cerevisiae) SEC14L3, a ribosomal protein L29 (Rpl29)
              pseudogene, a transformer 2 alpha homolog (Drosophila)
              (Tra2a) pseudogene and a CpG island, complete sequence
          Length = 201238

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 129051 aggaggggaaggaggaggagg 129071



to top

>emb|AL603925.20| Mouse DNA sequence from clone RP23-175K24 on chromosome 11 Contains the
              gene for nuclear DNA binding protein C1d and a aldo-keto
              reductase family 1 member B3 (aldose reductase) (Akr1b3)
              pseudogene, complete sequence
          Length = 232869

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 158482 aggaggggaaggaggaggagg 158462



to top

>gb|AC087528.15| Homo sapiens chromosome 15, clone RP11-497M17, complete sequence
          Length = 142965

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 54    gggaaggaggaggaggctgcc 74
             |||||||||||||||||||||
Sbjct: 45413 gggaaggaggaggaggctgcc 45433



to top

>gb|AC154535.2| Mus musculus BAC clone RP23-447M9 from chromosome 13, complete sequence
          Length = 179176

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 118136 aggaggggaaggaggaggagg 118156



to top

>dbj|AP006068.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0020D05
          Length = 158760

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 51    gaggggaaggaggaggaggctgccc 75
             ||||||| |||||||||||||||||
Sbjct: 52303 gaggggagggaggaggaggctgccc 52327



to top

>dbj|AP004865.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0020C11
          Length = 163328

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 51     gaggggaaggaggaggaggctgccc 75
              ||||||| |||||||||||||||||
Sbjct: 158280 gaggggagggaggaggaggctgccc 158304



to top

>gb|AC149055.6| Mus musculus BAC clone RP23-358K1 from chromosome 7, complete sequence
          Length = 215193

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 179581 aggaggggaaggaggaggagg 179561



to top

>gb|AC152823.3| Mus musculus BAC clone RP24-302N10 from chromosome 15, complete sequence
          Length = 211214

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 146770 aggaggggaaggaggaggagg 146750



to top

>gb|AC010533.6|AC010533 Homo sapiens chromosome 16 clone RP11-229O3, complete sequence
          Length = 153588

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 50168 aggaggggaaggaggaggagg 50148



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 50183 aggaggggaaggaggaggagg 50163



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 50354 aggaggggaaggaggaggagg 50334



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 50339 aggaggggaaggaggaggag 50320



to top

>gb|AC069145.5|AC069145 Oryza sativa chromosome 10 BAC OSJNBb0094K03 genomic sequence, complete
             sequence
          Length = 135216

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 50    ggaggggaaggaggaggaggctgcc 74
             ||||||| |||||||||||||||||
Sbjct: 16123 ggagggggaggaggaggaggctgcc 16147



to top

>dbj|AP005917.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0235A04
          Length = 23787

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 49    aggaggggaaggaggaggaggctgc 73
             |||||| ||||||||||||||||||
Sbjct: 15096 aggaggagaaggaggaggaggctgc 15072



to top

>gb|AC087096.11| Oryza sativa chromosome 3 BAC OSJNBa0087O09 genomic sequence, complete
             sequence
          Length = 119134

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 50    ggaggggaaggaggaggaggc 70
             |||||||||||||||||||||
Sbjct: 72183 ggaggggaaggaggaggaggc 72203



to top

>dbj|AP003974.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1003_F05
          Length = 147472

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 49   aggaggggaaggaggaggaggctgc 73
            |||||| ||||||||||||||||||
Sbjct: 5553 aggaggagaaggaggaggaggctgc 5529



to top

>dbj|AP005069.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0654A08
          Length = 154812

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 49   aggaggggaaggaggaggaggctgc 73
            |||||| ||||||||||||||||||
Sbjct: 4938 aggaggagaaggaggaggaggctgc 4962



to top

>gb|AC005857.1| Homo sapiens 14 PAC RP4-809F18 (Roswell Pack Cancer Institute Human PAC
             Library) complete sequence
          Length = 102460

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 56043 aggaggggaaggaggaggagg 56023



to top

>ref|XM_955965.1| Neurospora crassa OR74A hypothetical protein (NCU01151.1) partial
            mRNA
          Length = 3639

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 52   aggggaaggaggaggaggctg 72
            |||||||||||||||||||||
Sbjct: 2592 aggggaaggaggaggaggctg 2572



to top

>ref|XM_952310.1| Neurospora crassa OR74A hypothetical protein (NCU07178.1) partial
           mRNA
          Length = 597

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 49  aggaggggaaggaggaggagg 69
           |||||||||||||||||||||
Sbjct: 547 aggaggggaaggaggaggagg 567



to top

>gb|AC087284.22| Homo sapiens chromosome 15, clone RP11-617F23, complete sequence
          Length = 183773

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 118623 aggaggggaaggaggaggagg 118603



to top

>dbj|AK102754.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106P12, full
           insert sequence
          Length = 3009

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 51  gaggggaaggaggaggaggctgccc 75
           ||||||| |||||||||||||||||
Sbjct: 352 gaggggagggaggaggaggctgccc 376



to top

>emb|AL845547.18| Mouse DNA sequence from clone RP23-296A4 on chromosome 2, complete
              sequence
          Length = 187738

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 120877 aggaggggaaggaggaggagg 120897



to top

>dbj|AK067894.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013123D09, full
           insert sequence
          Length = 4032

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 50  ggaggggaaggaggaggaggctgcc 74
           ||||||| |||||||||||||||||
Sbjct: 211 ggagggggaggaggaggaggctgcc 187



to top

>dbj|AK064870.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000J02, full
           insert sequence
          Length = 2709

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 50  ggaggggaaggaggaggaggctgcc 74
           ||||||| |||||||||||||||||
Sbjct: 198 ggagggggaggaggaggaggctgcc 174



to top

>gb|AC163763.3| Pan troglodytes BAC clone CH251-180G5 from chromosome unknown,
            complete sequence
          Length = 157645

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 7153 aggaggggaaggaggaggagg 7173



to top

>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence
          Length = 201535

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 49544 aggaggggaaggaggaggagg 49564



to top

>gb|AC156950.4| Mus musculus 10 BAC RP24-329N2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 166942

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 38923 aggaggggaaggaggaggagg 38943



to top

>gb|AC108826.9| Mus musculus chromosome 16, clone RP23-109P11, complete sequence
          Length = 191894

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 56263 aggaggggaaggaggaggagg 56283



to top

>emb|AL670413.19| Mouse DNA sequence from clone RP23-298E4 on chromosome 4, complete
             sequence
          Length = 243792

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 48    aaggaggggaaggaggaggag 68
             |||||||||||||||||||||
Sbjct: 40996 aaggaggggaaggaggaggag 41016



to top

>gb|AC005227.2|AC005227 Homo sapiens PAC clone RP5-1003N18 from 14q24.3, complete sequence
          Length = 100050

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 16463 aggaggggaaggaggaggagg 16443



to top

>gb|AC153897.4| Mus musculus 10 BAC RP23-119E2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 209755

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 19124 aggaggggaaggaggaggagg 19104



to top

>gb|AC174651.2| Mus musculus BAC clone CH25-241D1 from chromosome 6, complete sequence
          Length = 120448

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 45    gacaaggaggggaaggaggaggagg 69
             |||||||||| ||||||||||||||
Sbjct: 15904 gacaaggaggagaaggaggaggagg 15928



to top

>gb|AC161802.7| Mus musculus chromosome 5, clone RP23-477G6, complete sequence
          Length = 176484

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 27844 aggaggggaaggaggaggagg 27824



to top

>gb|AC155158.15| Mus musculus chromosome 3, clone RP24-70L3, complete sequence
          Length = 240767

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 86708 aggaggggaaggaggaggagg 86688



to top

>gb|AC091484.8| Mus musculus strain C57BL/6J chromosome 17 clone rp23-386a1, complete
            sequence
          Length = 205343

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 1126 aggaggggaaggaggaggagg 1106



to top

>gb|AC091777.26| Mus musculus strain C57BL/6J chromosome 17 clone rp23-355b17, complete
              sequence
          Length = 216109

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 208491 aggaggggaaggaggaggagg 208471



to top

>emb|AL683884.26| Mouse DNA sequence from clone RP23-117B19 on chromosome 4, complete
             sequence
          Length = 227816

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 24031 aggaggggaaggaggaggagg 24011



to top

>emb|AL591411.14| Mouse DNA sequence from clone RP23-428M13 on chromosome 2, complete
              sequence
          Length = 155889

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 45     gacaaggaggggaaggaggag 65
              |||||||||||||||||||||
Sbjct: 137514 gacaaggaggggaaggaggag 137494



to top

>gb|AY082611.1| Ocimum basilicum p-coumaroyl shikimate 3'-hydroxylase isoform 1
          mRNA, complete cds
          Length = 1554

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 49 aggaggggaaggaggaggagg 69
          |||||||||||||||||||||
Sbjct: 47 aggaggggaaggaggaggagg 27



to top

>emb|AL805897.13| Mouse DNA sequence from clone RP23-63D8 on chromosome 4, complete
              sequence
          Length = 231989

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 165196 aggaggggaaggaggaggagg 165176



to top

>gb|AC127691.4| Mus musculus BAC clone RP24-216M10 from 9, complete sequence
          Length = 153242

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 45315 aggaggggaaggaggaggagg 45295



to top

>emb|CT033780.10| Mouse DNA sequence from clone RP24-329E14 on chromosome 12, complete
             sequence
          Length = 205515

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 19834 aggaggggaaggaggaggagg 19854



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 38583 aggaggggaaggaggaggag 38564



to top

>gb|AC133499.3| Mus musculus BAC clone RP24-248F14 from 8, complete sequence
          Length = 181064

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 32821 aggaggggaaggaggaggagg 32841



to top

>gb|AC147230.3| Mus musculus BAC clone RP23-239N12 from 15, complete sequence
          Length = 255976

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 170617 aggaggggaaggaggaggagg 170637



to top

>gb|AC140213.2| Mus musculus BAC clone RP23-270L5 from 7, complete sequence
          Length = 195922

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 94948 aggaggggaaggaggaggagg 94928



to top

>gb|AC123878.4| Mus musculus BAC clone RP23-318I20 from 3, complete sequence
          Length = 215121

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 107015 aggaggggaaggaggaggagg 107035



to top

>gb|AC133195.4| Mus musculus BAC clone RP23-133F6 from 8, complete sequence
          Length = 214318

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 194404 aggaggggaaggaggaggagg 194424



to top

>gb|AC161488.7| Mus musculus chromosome 7, clone RP24-300N16, complete sequence
          Length = 183220

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 109082 aggaggggaaggaggaggagg 109102



to top

>gb|AC083895.21| Mus musculus strain C57BL/6J chromosome 16 clone rp23-294d8, complete
             sequence
          Length = 187658

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 97027 aggaggggaaggaggaggagg 97007



 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 97065 aggaggggaaggaggaggag 97046



to top

>emb|AL773567.16| Mouse DNA sequence from clone RP23-204P1 on chromosome 4, complete
              sequence
          Length = 189970

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 128050 aggaggggaaggaggaggagg 128030



to top

>emb|AL662804.18| Mouse DNA sequence from clone RP23-341C5 on chromosome 11, complete
             sequence
          Length = 223438

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 14324 aggaggggaaggaggaggagg 14344



to top

>emb|AL627186.13| Mouse DNA sequence from clone RP23-413I9 on chromosome 4, complete
             sequence
          Length = 180246

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 48    aaggaggggaaggaggaggag 68
             |||||||||||||||||||||
Sbjct: 42662 aaggaggggaaggaggaggag 42642



to top

>emb|AL844856.6| Mouse DNA sequence from clone RP23-377G1 on chromosome 4, complete
             sequence
          Length = 183318

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 69127 aggaggggaaggaggaggagg 69147



to top

>emb|AL645723.11| Mouse DNA sequence from clone RP23-423N6 on chromosome 4, complete
             sequence
          Length = 220638

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 52689 aggaggggaaggaggaggagg 52709



to top

>gb|AC109180.20| Mus musculus chromosome 10, clone RP23-13J14, complete sequence
          Length = 212628

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 11203 aggaggggaaggaggaggagg 11223



to top

>emb|AL714017.11| Mouse DNA sequence from clone RP23-91C19 on chromosome X, complete
             sequence
          Length = 240597

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 35327 aggaggggaaggaggaggagg 35347



to top

>emb|AL606969.26| Mouse DNA sequence from clone RP23-331P21 on chromosome 4, complete
              sequence
          Length = 224344

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 185361 aggaggggaaggaggaggagg 185381



to top

>emb|AL928593.4| Mouse DNA sequence from clone RP23-100E9 on chromosome 2, complete
             sequence
          Length = 195840

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 67097 aggaggggaaggaggaggagg 67077



to top

>gb|AC171210.1| Mus musculus BAC clone RP23-36D15 from chromosome 7, complete sequence
          Length = 221010

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 138384 aggaggggaaggaggaggagg 138404



to top

>gb|AC165340.3| Mus musculus BAC clone RP24-63G4 from chromosome 7, complete sequence
          Length = 241077

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 49     aggaggggaaggaggaggagg 69
              |||||||||||||||||||||
Sbjct: 211731 aggaggggaaggaggaggagg 211751



to top

>gb|AC156836.6| Mus musculus BAC clone RP23-88L11 from chromosome 10, complete sequence
          Length = 255961

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 95127 aggaggggaaggaggaggagg 95107



to top

>gb|AC121548.17| Mus musculus chromosome 5, clone RP24-86E4, complete sequence
          Length = 154340

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 16016 aggaggggaaggaggaggagg 16036



to top

>gb|AC153381.2| Mus musculus 6 BAC RP23-397L23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196902

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 45     gacaaggaggggaaggaggaggagg 69
              |||||||||| ||||||||||||||
Sbjct: 187348 gacaaggaggagaaggaggaggagg 187324



to top

>ref|NM_023990.1| Rattus norvegicus sine oculis homeobox homolog 3 (Drosophila) (Six3),
            mRNA
 dbj|AB030833.1| Rattus norvegicus mRNA for homeobox protein Six3, complete cds
          Length = 1598

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 49   aggaggggaaggaggaggagg 69
            |||||||||||||||||||||
Sbjct: 1414 aggaggggaaggaggaggagg 1394



to top

>dbj|AB057357.2| Mus musculus gene for Ankyrin 3, partial cds
          Length = 24885

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 14149 aggaggggaaggaggaggagg 14169



to top

>gb|AC010330.7| Homo sapiens chromosome 19 clone CTD-2657C13, complete sequence
          Length = 80240

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    aggaggggaaggaggaggagg 69
             |||||||||||||||||||||
Sbjct: 48011 aggaggggaaggaggaggagg 48031



to top

>gb|AC159536.21| Medicago truncatula chromosome 8 clone mth2-187n4, complete sequence
          Length = 120612

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 406   taataatatgtgaagactac 425
             ||||||||||||||||||||
Sbjct: 12955 taataatatgtgaagactac 12974



to top

>emb|CT836019.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN040B05,
          full insert sequence
          Length = 1105

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 50 ggaggggaaggaggaggagg 69
          ||||||||||||||||||||
Sbjct: 28 ggaggggaaggaggaggagg 9



to top

>emb|CR855094.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0222C05, complete
            sequence
          Length = 37743

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   ggaggggaaggaggaggagg 69
            ||||||||||||||||||||
Sbjct: 3676 ggaggggaaggaggaggagg 3657



to top

>dbj|AK243540.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J100078H15,
          full insert sequence
          Length = 1127

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 50 ggaggggaaggaggaggagg 69
          ||||||||||||||||||||
Sbjct: 48 ggaggggaaggaggaggagg 29



to top

>ref|XM_001175972.1| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC580278
            (LOC580278), mRNA
          Length = 4704

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   aggaggaggaggctgccccc 77
            ||||||||||||||||||||
Sbjct: 1267 aggaggaggaggctgccccc 1286



to top

>ref|XM_780348.2| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC580278
            (LOC580278), mRNA
          Length = 4704

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   aggaggaggaggctgccccc 77
            ||||||||||||||||||||
Sbjct: 1267 aggaggaggaggctgccccc 1286



to top

>ref|NM_001065401.1| Oryza sativa (japonica cultivar-group) Os07g0141700 (Os07g0141700)
            mRNA, complete cds
          Length = 3378

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 38   agcatcagacaaggaggggaaggaggaggagg 69
            |||||| |||||||||| | ||||||||||||
Sbjct: 1050 agcatccgacaaggaggaggaggaggaggagg 1081



to top

>ref|NM_001060057.1| Oryza sativa (japonica cultivar-group) Os04g0556000 (Os04g0556000)
           mRNA, complete cds
          Length = 3188

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 50  ggaggggaaggaggaggagg 69
           ||||||||||||||||||||
Sbjct: 175 ggaggggaaggaggaggagg 194



to top

>ref|NM_001059348.1| Oryza sativa (japonica cultivar-group) Os04g0429800
          (Os04g0429800) mRNA, complete cds
          Length = 2215

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 50 ggaggggaaggaggaggagg 69
          ||||||||||||||||||||
Sbjct: 59 ggaggggaaggaggaggagg 40



to top

>ref|NM_001052951.1| Oryza sativa (japonica cultivar-group) Os02g0244600 (Os02g0244600)
           mRNA, complete cds
          Length = 1658

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 50  ggaggggaaggaggaggagg 69
           ||||||||||||||||||||
Sbjct: 267 ggaggggaaggaggaggagg 286



to top

>ref|NM_001048493.1| Oryza sativa (japonica cultivar-group) Os01g0136500 (Os01g0136500)
           mRNA, complete cds
          Length = 744

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  ggaaggaggaggaggctgcc 74
           ||||||||||||||||||||
Sbjct: 84  ggaaggaggaggaggctgcc 103



to top

>ref|XM_001172069.1| PREDICTED: Pan troglodytes hypothetical LOC462636, transcript variant
            1 (LOC462636), mRNA
          Length = 2220

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   gaaggaggaggaggctgccc 75
            ||||||||||||||||||||
Sbjct: 1212 gaaggaggaggaggctgccc 1231



to top

>ref|XM_518424.2| PREDICTED: Pan troglodytes hypothetical LOC462636, transcript variant
            2 (LOC462636), mRNA
          Length = 2295

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   gaaggaggaggaggctgccc 75
            ||||||||||||||||||||
Sbjct: 1287 gaaggaggaggaggctgccc 1306



to top

>ref|NM_008489.2| Mus musculus lipopolysaccharide binding protein (Lbp), mRNA
          Length = 2528

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 79  cggccaaggaagggctggtggctc 102
           |||||||||| |||||||||||||
Sbjct: 302 cggccaaggaggggctggtggctc 325



to top

>ref|XR_019365.1| PREDICTED: Homo sapiens similar to Beta-glucuronidase precursor
          (Beta-G1) (LOC650457), mRNA
          Length = 811

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 48 aaggaggggaaggaggagga 67
          ||||||||||||||||||||
Sbjct: 10 aaggaggggaaggaggagga 29



to top

>ref|XR_018069.1| PREDICTED: Homo sapiens similar to Beta-glucuronidase precursor
          (Beta-G1) (LOC642006), mRNA
          Length = 832

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 48 aaggaggggaaggaggagga 67
          ||||||||||||||||||||
Sbjct: 67 aaggaggggaaggaggagga 86



to top

>gb|AC188298.1| Macaca mulatta chromosome UNK clone CH250-45H12, complete sequence
          Length = 176579

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 49     aggaggggaaggaggaggag 68
              ||||||||||||||||||||
Sbjct: 163207 aggaggggaaggaggaggag 163226



to top

>gb|AC188122.1| Trichinella spiralis chromosome UNK clone TS195-48H12, complete
             sequence
          Length = 140734

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    ggaggggaaggaggaggagg 69
             ||||||||||||||||||||
Sbjct: 65663 ggaggggaaggaggaggagg 65682



to top

>ref|XM_001078690.1| PREDICTED: Rattus norvegicus SUMO/sentrin specific peptidase 3,
          transcript variant 2 (Senp3), mRNA
          Length = 2846

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 50 ggaggggaaggaggaggagg 69
          ||||||||||||||||||||
Sbjct: 53 ggaggggaaggaggaggagg 72



to top

>ref|XM_220607.4| PREDICTED: Rattus norvegicus SUMO/sentrin specific peptidase 3,
          transcript variant 2 (Senp3), mRNA
          Length = 2846

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 50 ggaggggaaggaggaggagg 69
          ||||||||||||||||||||
Sbjct: 53 ggaggggaaggaggaggagg 72



to top

>ref|XM_001068024.1| PREDICTED: Rattus norvegicus hypothetical protein LOC688713
           (LOC688713), mRNA
          Length = 213

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 49  aggaggggaaggaggaggag 68
           ||||||||||||||||||||
Sbjct: 143 aggaggggaaggaggaggag 162



to top

>ref|XM_001109938.1| PREDICTED: Macaca mulatta similar to SUMO1/sentrin/SMT3 specific
           protease 3, transcript variant 1 (LOC715884), mRNA
          Length = 2428

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 50  ggaggggaaggaggaggagg 69
           ||||||||||||||||||||
Sbjct: 94  ggaggggaaggaggaggagg 113



to top

>ref|XM_001109977.1| PREDICTED: Macaca mulatta similar to SUMO1/sentrin/SMT3 specific
           protease 3, transcript variant 2 (LOC715884), mRNA
          Length = 2512

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 50  ggaggggaaggaggaggagg 69
           ||||||||||||||||||||
Sbjct: 94  ggaggggaaggaggaggagg 113



to top

>ref|XM_001110023.1| PREDICTED: Macaca mulatta similar to SUMO1/sentrin/SMT3 specific
           protease 3, transcript variant 3 (LOC715884), mRNA
          Length = 2563

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 50  ggaggggaaggaggaggagg 69
           ||||||||||||||||||||
Sbjct: 94  ggaggggaaggaggaggagg 113



to top

>ref|XM_001102669.1| PREDICTED: Macaca mulatta nuclear receptor co-repressor 2, transcript
            variant 1 (NCOR2), mRNA
          Length = 8386

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   caaggaggggaaggaggaggaggc 70
            |||||||| |||||||||||||||
Sbjct: 2424 caaggaggagaaggaggaggaggc 2447



to top

>ref|XM_001102940.1| PREDICTED: Macaca mulatta nuclear receptor co-repressor 2, transcript
            variant 4 (NCOR2), mRNA
          Length = 8524

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   caaggaggggaaggaggaggaggc 70
            |||||||| |||||||||||||||
Sbjct: 2424 caaggaggagaaggaggaggaggc 2447



to top

>ref|XM_001102847.1| PREDICTED: Macaca mulatta nuclear receptor co-repressor 2, transcript
            variant 3 (NCOR2), mRNA
          Length = 8554

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   caaggaggggaaggaggaggaggc 70
            |||||||| |||||||||||||||
Sbjct: 2478 caaggaggagaaggaggaggaggc 2501



to top

>ref|XM_001102754.1| PREDICTED: Macaca mulatta nuclear receptor co-repressor 2, transcript
            variant 2 (NCOR2), mRNA
          Length = 8575

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   caaggaggggaaggaggaggaggc 70
            |||||||| |||||||||||||||
Sbjct: 2478 caaggaggagaaggaggaggaggc 2501



to top

>ref|XM_001116660.1| PREDICTED: Macaca mulatta similar to differentially expressed in FDCP
            6 homolog, transcript variant 1 (LOC718845), mRNA
          Length = 2217

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   gaaggaggaggaggctgccc 75
            ||||||||||||||||||||
Sbjct: 1211 gaaggaggaggaggctgccc 1230



to top

>ref|XM_001116665.1| PREDICTED: Macaca mulatta similar to differentially expressed in FDCP
            6 homolog, transcript variant 2 (LOC718845), mRNA
          Length = 2292

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   gaaggaggaggaggctgccc 75
            ||||||||||||||||||||
Sbjct: 1286 gaaggaggaggaggctgccc 1305



to top

>gb|AC165317.9| Mus musculus chromosome 5, clone RP23-265O20, complete sequence
          Length = 191270

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 54642 aggaggggaaggaggaggag 54661



to top

>ref|XM_899453.2| PREDICTED: Mus musculus hypothetical LOC626609 (LOC626609), mRNA
          Length = 636

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 49  aggaggggaaggaggaggag 68
           ||||||||||||||||||||
Sbjct: 188 aggaggggaaggaggaggag 207



to top

>ref|XM_369632.1| Magnaporthe grisea 70-15 chromosome III predicted protein
           (MG05832.4) partial mRNA
          Length = 1236

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 49  aggaggggaaggaggaggag 68
           ||||||||||||||||||||
Sbjct: 191 aggaggggaaggaggaggag 210



to top

>gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete sequence
          Length = 122876

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 406    taataatatgtgaagactac 425
              ||||||||||||||||||||
Sbjct: 111867 taataatatgtgaagactac 111886



to top

>gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete sequence
          Length = 133030

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  taataatatgtgaagactac 425
            ||||||||||||||||||||
Sbjct: 9839 taataatatgtgaagactac 9820



to top

>gb|AC115905.8| Mus musculus chromosome 1, clone RP24-472N17, complete sequence
          Length = 173914

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    aaggaggggaaggaggagga 67
             ||||||||||||||||||||
Sbjct: 34679 aaggaggggaaggaggagga 34660



to top

>gb|AC121143.12| Mus musculus chromosome 1, clone RP24-177B16, complete sequence
          Length = 176008

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 49     aggaggggaaggaggaggag 68
              ||||||||||||||||||||
Sbjct: 154348 aggaggggaaggaggaggag 154367



to top

>gb|AC102159.10| Mus musculus chromosome 19, clone RP23-398L11, complete sequence
          Length = 197134

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 50     ggaggggaaggaggaggagg 69
              ||||||||||||||||||||
Sbjct: 182681 ggaggggaaggaggaggagg 182700



to top

>gb|AC166830.3| Mus musculus BAC clone RP23-246O1 from chromosome 13, complete sequence
          Length = 213487

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 69872 aggaggggaaggaggaggag 69891



to top

>gb|AY248424.1| HIV-1 isolate 02SP00055143 gag-pol polyprotein gene, partial cds
          Length = 746

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  agacaaggaggggaaggagg 63
           ||||||||||||||||||||
Sbjct: 414 agacaaggaggggaaggagg 433



to top

>gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, complete sequence
          Length = 156107

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     aaggaggggaaggaggagga 67
              ||||||||||||||||||||
Sbjct: 120872 aaggaggggaaggaggagga 120891



to top

>gb|AC137853.21| Mus musculus chromosome 19, clone RP24-276L14, complete sequence
          Length = 173430

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 37143 aggaggggaaggaggaggag 37124



to top

>gb|AC135562.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0087P19, complete sequence
          Length = 172066

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 49    aggaggggaaggaggaggaggctg 72
             |||||| |||||||||||||||||
Sbjct: 86442 aggaggagaaggaggaggaggctg 86465



to top

>gb|AC165970.3| Mus musculus BAC clone RP23-129J20 from chromosome 6, complete
            sequence
          Length = 207303

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 48   aaggaggggaaggaggagga 67
            ||||||||||||||||||||
Sbjct: 4372 aaggaggggaaggaggagga 4391



to top

>gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, complete sequence
          Length = 203058

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aggaggggaaggaggaggag 68
             ||||||||||||||||||||
Sbjct: 16743 aggaggggaaggaggaggag 16762


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 62,033,436
Number of extensions: 3835957
Number of successful extensions: 499984
Number of sequences better than 10.0: 395
Number of HSP's gapped: 499981
Number of HSP's successfully gapped: 439
Length of query: 451
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 429
Effective length of database: 18,508,616,841
Effective search space: 7940196624789
Effective search space used: 7940196624789
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
to top