ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf127d05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY090541.1| Deschampsia antarctica clone Dacor 1.0 polyubiquitin 2 mRNA, complete cds Length = 831 Score = 692 bits (349), Expect = 0.0 Identities = 439/469 (93%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| Sbjct: 115 gagaagatgcagatcttcgtcaagaccctgacggggaagaccatcaccctcgaggtggag 174 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 ||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||| Sbjct: 175 agcagcgacaccatcgataacgtcaaggccaaaatccaggacaaagaagggattcctcca 234 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 ||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 235 gaccaacaacgtttgatatttgctggcaagcagttggaagatggacgcacacttgctgat 294 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatg 375 ||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct: 295 tacaatattcaaaaggagtctactcttcacttggtcctcaggctcaggggcggtactatg 354 Query: 376 atcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacg 435 ||||| || ||||| |||||||| |||||||| |||||||||||||||||||| |||||| Sbjct: 355 atcaaggttaagacactcactggaaaggagatcgaaattgacattgagcccactgacacg 414 Query: 436 attgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaagg 495 ||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 415 attgatagggtcaaggagcgtgttgaggagaaagaaggcattcctcccgtgcagcaaagg 474 Query: 496 ctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaa 555 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 475 ttgatttatgctggtaagcagcttgcagatgacaagactgcgaaggactacaacatcgaa 534 Query: 556 ggtggctcggtcctccatcttgtcctcgccctgaggggtggttactagt 604 |||||||| |||||||||||||| || || ||||||||||||||||||| Sbjct: 535 ggtggctccgtcctccatcttgtacttgctctgaggggtggttactagt 583 Score = 67.9 bits (34), Expect = 5e-08 Identities = 43/46 (93%) Strand = Plus / Plus Query: 681 taacaaactagctttgcttagtgggaggggatgtcttccatgttat 726 ||||||||||||||| | |||||||||||| ||||||||||||||| Sbjct: 672 taacaaactagcttttcctagtgggaggggctgtcttccatgttat 717 Score = 52.0 bits (26), Expect = 0.003 Identities = 29/30 (96%) Strand = Plus / Plus Query: 632 tgagagaagtgaccattggtggtatggaac 661 ||||||||||||| |||||||||||||||| Sbjct: 628 tgagagaagtgactattggtggtatggaac 657
>emb|CT831851.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA002A21, full insert sequence Length = 783 Score = 630 bits (318), Expect = e-177 Identities = 435/474 (91%) Strand = Plus / Plus Query: 137 agaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgaga 196 ||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| Sbjct: 140 agaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggaga 199 Query: 197 gcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgg 256 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 200 gcagcgacaccatcgacaacgtcaaggccaaaatccaggacaaggaagggatccctccag 259 Query: 257 accagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgact 316 | || |||||||||||||| || ||||||||| |||| ||||| |||||||| || |||| Sbjct: 260 atcaacagcgtttgatattcgccggcaagcagctggaagatgggcgcacactggccgact 319 Query: 317 acaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatga 376 ||||||||||||||||||| ||||||||||||||||||||||||||||| || || |||| Sbjct: 320 acaacattcagaaggagtcaactcttcacttggtcctcaggctcaggggtggcactatga 379 Query: 377 tcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacga 436 |||| || ||||| |||||||| || |||||||||||||||||||||||||||||||||| Sbjct: 380 tcaaggttaagaccctcactggaaaagagattgaaattgacattgagcccaccgacacga 439 Query: 437 ttgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggc 496 | || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 440 tcgataggatcaaggagcgtgttgaggagaaagaaggcattcctcccgtgcagcaaaggc 499 Query: 497 tgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaag 556 | || |||||||| ||||||||||| || ||||||||||| |||||||| |||||||||| Sbjct: 500 ttatctatgctggtaagcagcttgccgacgacaagactgcgaaggactataacatcgaag 559 Query: 557 gtggctcggtcctccatcttgtcctcgccctgaggggtggttactagttaagct 610 ||||||| ||||||||||||||||| || |||||||||||||| |||| ||||| Sbjct: 560 gtggctctgtcctccatcttgtccttgctctgaggggtggttattagtaaagct 613 Score = 44.1 bits (22), Expect = 0.73 Identities = 31/34 (91%) Strand = Plus / Plus Query: 693 tttgcttagtgggaggggatgtcttccatgttat 726 ||||| ||||||||| || ||||||||||||||| Sbjct: 714 tttgcctagtgggagaggttgtcttccatgttat 747
>ref|NM_001069734.1| Oryza sativa (japonica cultivar-group) Os09g0420800 (Os09g0420800) mRNA, complete cds Length = 792 Score = 630 bits (318), Expect = e-177 Identities = 435/474 (91%) Strand = Plus / Plus Query: 137 agaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgaga 196 ||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| Sbjct: 146 agaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggaga 205 Query: 197 gcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgg 256 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 206 gcagcgacaccatcgacaacgtcaaggccaaaatccaggacaaggaagggatccctccag 265 Query: 257 accagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgact 316 | || |||||||||||||| || ||||||||| |||| ||||| |||||||| || |||| Sbjct: 266 atcaacagcgtttgatattcgccggcaagcagctggaagatgggcgcacactggccgact 325 Query: 317 acaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatga 376 ||||||||||||||||||| ||||||||||||||||||||||||||||| || || |||| Sbjct: 326 acaacattcagaaggagtcaactcttcacttggtcctcaggctcaggggtggcactatga 385 Query: 377 tcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacga 436 |||| || ||||| |||||||| || |||||||||||||||||||||||||||||||||| Sbjct: 386 tcaaggttaagaccctcactggaaaagagattgaaattgacattgagcccaccgacacga 445 Query: 437 ttgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggc 496 | || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 446 tcgataggatcaaggagcgtgttgaggagaaagaaggcattcctcccgtgcagcaaaggc 505 Query: 497 tgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaag 556 | || |||||||| ||||||||||| || ||||||||||| |||||||| |||||||||| Sbjct: 506 ttatctatgctggtaagcagcttgccgacgacaagactgcgaaggactataacatcgaag 565 Query: 557 gtggctcggtcctccatcttgtcctcgccctgaggggtggttactagttaagct 610 ||||||| ||||||||||||||||| || |||||||||||||| |||| ||||| Sbjct: 566 gtggctctgtcctccatcttgtccttgctctgaggggtggttattagtaaagct 619 Score = 44.1 bits (22), Expect = 0.73 Identities = 31/34 (91%) Strand = Plus / Plus Query: 693 tttgcttagtgggaggggatgtcttccatgttat 726 ||||| ||||||||| || ||||||||||||||| Sbjct: 720 tttgcctagtgggagaggttgtcttccatgttat 753
>dbj|AK099513.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029K20, full insert sequence Length = 795 Score = 630 bits (318), Expect = e-177 Identities = 435/474 (91%) Strand = Plus / Plus Query: 137 agaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgaga 196 ||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| Sbjct: 149 agaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggaga 208 Query: 197 gcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgg 256 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 209 gcagcgacaccatcgacaacgtcaaggccaaaatccaggacaaggaagggatccctccag 268 Query: 257 accagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgact 316 | || |||||||||||||| || ||||||||| |||| ||||| |||||||| || |||| Sbjct: 269 atcaacagcgtttgatattcgccggcaagcagctggaagatgggcgcacactggccgact 328 Query: 317 acaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatga 376 ||||||||||||||||||| ||||||||||||||||||||||||||||| || || |||| Sbjct: 329 acaacattcagaaggagtcaactcttcacttggtcctcaggctcaggggtggcactatga 388 Query: 377 tcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacga 436 |||| || ||||| |||||||| || |||||||||||||||||||||||||||||||||| Sbjct: 389 tcaaggttaagaccctcactggaaaagagattgaaattgacattgagcccaccgacacga 448 Query: 437 ttgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggc 496 | || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 449 tcgataggatcaaggagcgtgttgaggagaaagaaggcattcctcccgtgcagcaaaggc 508 Query: 497 tgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaag 556 | || |||||||| ||||||||||| || ||||||||||| |||||||| |||||||||| Sbjct: 509 ttatctatgctggtaagcagcttgccgacgacaagactgcgaaggactataacatcgaag 568 Query: 557 gtggctcggtcctccatcttgtcctcgccctgaggggtggttactagttaagct 610 ||||||| ||||||||||||||||| || |||||||||||||| |||| ||||| Sbjct: 569 gtggctctgtcctccatcttgtccttgctctgaggggtggttattagtaaagct 622 Score = 44.1 bits (22), Expect = 0.73 Identities = 31/34 (91%) Strand = Plus / Plus Query: 693 tttgcttagtgggaggggatgtcttccatgttat 726 ||||| ||||||||| || ||||||||||||||| Sbjct: 723 tttgcctagtgggagaggttgtcttccatgttat 756
>gb|AY104764.1| Zea mays PCO108118 mRNA sequence Length = 878 Score = 573 bits (289), Expect = e-160 Identities = 424/469 (90%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||| Sbjct: 178 gagaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggag 237 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 |||||||||||| |||||||||||||||||||||| |||||||||||||||||||| || Sbjct: 238 agcagcgacaccgtcgacaacgtcaaggccaaaatccaggacaaggaagggattccccca 297 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 || || ||||| ||||||| |||||||||||| |||||||||||||||| || |||||| Sbjct: 298 gatcaacagcgactgatattcgctggcaagcagctggaggatggacgcacgctggctgac 357 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatg 375 |||||||| || |||||||| |||||||| |||||||||||||| ||||| || || ||| Sbjct: 358 tacaacatccaaaaggagtcaactcttcatttggtcctcaggcttaggggtggaaccatg 417 Query: 376 atcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacg 435 ||||| ||||| |||||||||||||| ||||| || || |||||||| ||||| ||| || Sbjct: 418 atcaaggtcaaaactctcactgggaaagagatcgagatcgacattgaacccactgactcg 477 Query: 436 attgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaagg 495 |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct: 478 attgacaggatcaaggagcgtgttgaagagaaagaaggcattcctcccgtgcagcaaagg 537 Query: 496 ctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaa 555 || || |||||||| ||||||||||| ||||||||||| || ||||||||||||||||| Sbjct: 538 ctcatctatgctggtaagcagcttgctgatgacaagaccgcaaaggactacaacatcgag 597 Query: 556 ggtggctcggtcctccatcttgtcctcgccctgaggggtggttactagt 604 ||||| || ||||||||||||||||| || ||||||||||||||||||| Sbjct: 598 ggtggatctgtcctccatcttgtccttgctctgaggggtggttactagt 646
>gb|DQ246023.1| Zea mays clone 2970 mRNA sequence Length = 853 Score = 565 bits (285), Expect = e-158 Identities = 423/469 (90%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||| Sbjct: 106 gagaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggag 165 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 |||||||||||| ||||||||||||| |||||||| |||||||||||||||||||| || Sbjct: 166 agcagcgacaccgtcgacaacgtcaaagccaaaatccaggacaaggaagggattccccca 225 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 || || ||||| ||||||| |||||||||||| |||||||||||||||| || |||||| Sbjct: 226 gatcaacagcgactgatattcgctggcaagcagctggaggatggacgcacgctggctgac 285 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatg 375 |||||||| || |||||||| |||||||| |||||||||||||| ||||| || || ||| Sbjct: 286 tacaacatccaaaaggagtcaactcttcatttggtcctcaggcttaggggtggaaccatg 345 Query: 376 atcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacg 435 ||||| ||||| |||||||||||||| ||||| || || |||||||| ||||| ||| || Sbjct: 346 atcaaggtcaaaactctcactgggaaagagatcgagatcgacattgaacccactgactcg 405 Query: 436 attgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaagg 495 |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct: 406 attgacaggatcaaggagcgtgttgaagagaaagaaggcattcctcccgtgcagcaaagg 465 Query: 496 ctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaa 555 || || |||||||| ||||||||||| ||||||||||| || ||||||||||||||||| Sbjct: 466 ctcatctatgctggtaagcagcttgctgatgacaagaccgcaaaggactacaacatcgag 525 Query: 556 ggtggctcggtcctccatcttgtcctcgccctgaggggtggttactagt 604 ||||| || ||||||||||||||||| || ||||||||||||||||||| Sbjct: 526 ggtggatctgtcctccatcttgtccttgctctgaggggtggttactagt 574
>emb|CT986676.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 717 Score = 400 bits (202), Expect = e-108 Identities = 397/462 (85%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||| ||||||||||||||| || ||||| ||||||||||| |||||||||||||||||| Sbjct: 81 gagacgatgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtcgag 140 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 141 agcagcgacaccatcgacaacgtcaaggccaagattcaggacaaggaaggtattcctcca 200 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 ||||||||||| ||||| |||||||| ||||| ||||| |||||||| || ||||| ||| Sbjct: 201 gaccagcagcgattgatttttgctggtaagcaattggaagatggacgaactcttgcggac 260 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatg 375 || ||||| || ||||||||||||||||| |||| | ||||||||||| || || ||| Sbjct: 261 tataacatccaaaaggagtcgactcttcatctggtgttgaggctcaggggaggaaccatg 320 Query: 376 atcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacg 435 || || || ||||| || ||||| |||||||||||||| || |||||||| || || || Sbjct: 321 attaaggttaagacccttactggaaaggagattgaaatagatattgagccgacggatacc 380 Query: 436 attgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaagg 495 |||||| | |||||||| | ||||| ||||||||||||||||| ||||| ||||||||| Sbjct: 381 attgaccgtatcaaggaaagggttgaagagaaagaaggcattccacctgtccagcaaagg 440 Query: 496 ctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaa 555 || || ||||| || |||||||||||||| || || || || |||||||||||||| Sbjct: 441 cttatatatgccggtaagcagcttgcagacgataaaacagctcgagactacaacatcgag 500 Query: 556 ggtggctcggtcctccatcttgtcctcgccctgaggggtggt 597 |||||||| |||||||||||||| || || ||||| |||||| Sbjct: 501 ggtggctctgtcctccatcttgtgcttgcgctgagaggtggt 542
>emb|CT985646.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 718 Score = 400 bits (202), Expect = e-108 Identities = 397/462 (85%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||| ||||||||||||||| || ||||| ||||||||||| |||||||||||||||||| Sbjct: 81 gagacgatgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtcgag 140 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 141 agcagcgacaccatcgacaacgtcaaggccaagattcaggacaaggaaggtattcctcca 200 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 ||||||||||| ||||| |||||||| ||||| ||||| |||||||| || ||||| ||| Sbjct: 201 gaccagcagcgattgatttttgctggtaagcaattggaagatggacgaactcttgcggac 260 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatg 375 || ||||| || ||||||||||||||||| |||| | ||||||||||| || || ||| Sbjct: 261 tataacatccaaaaggagtcgactcttcatctggtgttgaggctcaggggaggaaccatg 320 Query: 376 atcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacg 435 || || || ||||| || ||||| |||||||||||||| || |||||||| || || || Sbjct: 321 attaaggttaagacccttactggaaaggagattgaaatagatattgagccgacggatacc 380 Query: 436 attgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaagg 495 |||||| | |||||||| | ||||| ||||||||||||||||| ||||| ||||||||| Sbjct: 381 attgaccgtatcaaggaaagggttgaagagaaagaaggcattccacctgtccagcaaagg 440 Query: 496 ctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaa 555 || || ||||| || |||||||||||||| || || || || |||||||||||||| Sbjct: 441 cttatatatgccggtaagcagcttgcagacgataaaacagctcgagactacaacatcgag 500 Query: 556 ggtggctcggtcctccatcttgtcctcgccctgaggggtggt 597 |||||||| |||||||||||||| || || ||||| |||||| Sbjct: 501 ggtggctctgtcctccatcttgtgcttgcgctgagaggtggt 542
>emb|CT985546.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 718 Score = 400 bits (202), Expect = e-108 Identities = 397/462 (85%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||| ||||||||||||||| || ||||| ||||||||||| |||||||||||||||||| Sbjct: 81 gagacgatgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtcgag 140 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 141 agcagcgacaccatcgacaacgtcaaggccaagattcaggacaaggaaggtattcctcca 200 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 ||||||||||| ||||| |||||||| ||||| ||||| |||||||| || ||||| ||| Sbjct: 201 gaccagcagcgattgatttttgctggtaagcaattggaagatggacgaactcttgcggac 260 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatg 375 || ||||| || ||||||||||||||||| |||| | ||||||||||| || || ||| Sbjct: 261 tataacatccaaaaggagtcgactcttcatctggtgttgaggctcaggggaggaaccatg 320 Query: 376 atcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacg 435 || || || ||||| || ||||| |||||||||||||| || |||||||| || || || Sbjct: 321 attaaggttaagacccttactggaaaggagattgaaatagatattgagccgacggatacc 380 Query: 436 attgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaagg 495 |||||| | |||||||| | ||||| ||||||||||||||||| ||||| ||||||||| Sbjct: 381 attgaccgtatcaaggaaagggttgaagagaaagaaggcattccacctgtccagcaaagg 440 Query: 496 ctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaa 555 || || ||||| || |||||||||||||| || || || || |||||||||||||| Sbjct: 441 cttatatatgccggtaagcagcttgcagacgataaaacagctcgagactacaacatcgag 500 Query: 556 ggtggctcggtcctccatcttgtcctcgccctgaggggtggt 597 |||||||| |||||||||||||| || || ||||| |||||| Sbjct: 501 ggtggctctgtcctccatcttgtgcttgcgctgagaggtggt 542
>emb|CT982252.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 718 Score = 400 bits (202), Expect = e-108 Identities = 397/462 (85%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||| ||||||||||||||| || ||||| ||||||||||| |||||||||||||||||| Sbjct: 81 gagacgatgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtcgag 140 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 141 agcagcgacaccatcgacaacgtcaaggccaagattcaggacaaggaaggtattcctcca 200 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 ||||||||||| ||||| |||||||| ||||| ||||| |||||||| || ||||| ||| Sbjct: 201 gaccagcagcgattgatttttgctggtaagcaattggaagatggacgaactcttgcggac 260 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatg 375 || ||||| || ||||||||||||||||| |||| | ||||||||||| || || ||| Sbjct: 261 tataacatccaaaaggagtcgactcttcatctggtgttgaggctcaggggaggaaccatg 320 Query: 376 atcaaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacg 435 || || || ||||| || ||||| |||||||||||||| || |||||||| || || || Sbjct: 321 attaaggttaagacccttactggaaaggagattgaaatagatattgagccgacggatacc 380 Query: 436 attgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaagg 495 |||||| | |||||||| | ||||| ||||||||||||||||| ||||| ||||||||| Sbjct: 381 attgaccgtatcaaggaaagggttgaagagaaagaaggcattccacctgtccagcaaagg 440 Query: 496 ctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaa 555 || || ||||| || |||||||||||||| || || || || |||||||||||||| Sbjct: 441 cttatatatgccggtaagcagcttgcagacgataaaacagctcgagactacaacatcgag 500 Query: 556 ggtggctcggtcctccatcttgtcctcgccctgaggggtggt 597 |||||||| |||||||||||||| || || ||||| |||||| Sbjct: 501 ggtggctctgtcctccatcttgtgcttgcgctgagaggtggt 542
>ref|NM_001064756.1| Oryza sativa (japonica cultivar-group) Os06g0650100 (Os06g0650100) mRNA, complete cds Length = 832 Score = 373 bits (188), Expect = e-100 Identities = 389/456 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 146 atgcagatcttcgtgaagacgctgacggggaagaccatcactctcgaggtcgagagcagc 205 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||||||||| || |||||||| || || ||||| || |||||| Sbjct: 206 gacaccatcgacaatgtcaaggccaagatccaggacaaagagggtattcccccagaccag 265 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 || | |||| || || || ||||| |||| |||||||| ||| | ||||| |||||| Sbjct: 266 caaaggctgattttcgcagggaagcaactggaagatggacgtacattagctgattacaac 325 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 |||||||| ||||| || || || |||||||| ||||||||||| || || |||||||| Sbjct: 326 attcagaaagagtcaacgctccatttggtcctgaggctcaggggtggaaccatgatcaag 385 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||| |||||||||||||| || || || |||||||||||||| || || ||||| Sbjct: 386 gtgaagacactcactgggaaggaaatcgagatcgacattgagcccactgataccattgat 445 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 || |||||||||||||||||||||||||| || ||||| ||||| ||||| ||||| ||| Sbjct: 446 agaatcaaggagcgtgttgaggagaaagagggtattccacctgttcagcagaggctcatt 505 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 |||||||| ||||| ||||| ||||| || ||||||||||| |||||||| ||||||||| Sbjct: 506 tatgctgggaagcaacttgctgatgataaaactgccaaggattacaacattgaaggtggc 565 Query: 562 tcggtcctccatcttgtcctcgccctgaggggtggt 597 || || |||||||| || || || |||||||||||| Sbjct: 566 tcagtgctccatctcgtgcttgctctgaggggtggt 601
>dbj|AK062354.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-101-G08, full insert sequence Length = 832 Score = 373 bits (188), Expect = e-100 Identities = 389/456 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 146 atgcagatcttcgtgaagacgctgacggggaagaccatcactctcgaggtcgagagcagc 205 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||||||||| || |||||||| || || ||||| || |||||| Sbjct: 206 gacaccatcgacaatgtcaaggccaagatccaggacaaagagggtattcccccagaccag 265 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 || | |||| || || || ||||| |||| |||||||| ||| | ||||| |||||| Sbjct: 266 caaaggctgattttcgcagggaagcaactggaagatggacgtacattagctgattacaac 325 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 |||||||| ||||| || || || |||||||| ||||||||||| || || |||||||| Sbjct: 326 attcagaaagagtcaacgctccatttggtcctgaggctcaggggtggaaccatgatcaag 385 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||| |||||||||||||| || || || |||||||||||||| || || ||||| Sbjct: 386 gtgaagacactcactgggaaggaaatcgagatcgacattgagcccactgataccattgat 445 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 || |||||||||||||||||||||||||| || ||||| ||||| ||||| ||||| ||| Sbjct: 446 agaatcaaggagcgtgttgaggagaaagagggtattccacctgttcagcagaggctcatt 505 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 |||||||| ||||| ||||| ||||| || ||||||||||| |||||||| ||||||||| Sbjct: 506 tatgctgggaagcaacttgctgatgataaaactgccaaggattacaacattgaaggtggc 565 Query: 562 tcggtcctccatcttgtcctcgccctgaggggtggt 597 || || |||||||| || || || |||||||||||| Sbjct: 566 tcagtgctccatctcgtgcttgctctgaggggtggt 601
>emb|CT833398.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN063M20, full insert sequence Length = 765 Score = 367 bits (185), Expect = 4e-98 Identities = 389/457 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| ||||| || ||||||||||||||||| ||||||||||||||||| Sbjct: 113 gatgcagatcttcgtgaagacgctgacggggaagaccatcactctcgaggtcgagagcag 172 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||||||| ||||||||||| || |||||||| || || ||||| || ||||| Sbjct: 173 cgacaccatcgacaatgtcaaggccaagatccaggacaaagagggtattcccccagacca 232 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||| | |||| || || || ||||| |||| |||||||| ||| | ||||| ||||| Sbjct: 233 gcaaaggctgattttcgcagggaagcaactggaagatggacgtacattagctgattacaa 292 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaa 380 ||||||||| ||||| || || || |||||||| ||||||||||| || || |||||||| Sbjct: 293 cattcagaaagagtcaacgctccatttggtcctgaggctcaggggtggaaccatgatcaa 352 Query: 381 agtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattga 440 || ||||| |||||||||||||| || || || ||||| |||||||| || || ||||| Sbjct: 353 ggtgaagacactcactgggaaggaaatcgagatcgacatcgagcccactgataccattga 412 Query: 441 caggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgat 500 || |||||||||||||||||||||||||| || ||||| ||||| ||||| ||||| || Sbjct: 413 tagaatcaaggagcgtgttgaggagaaagagggtattccacctgttcagcagaggctcat 472 Query: 501 ttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtgg 560 ||||||||| ||||| ||||| ||||| || ||||||||||| |||||||| |||||||| Sbjct: 473 ttatgctgggaagcaacttgctgatgataaaactgccaaggattacaacattgaaggtgg 532 Query: 561 ctcggtcctccatcttgtcctcgccctgaggggtggt 597 ||| || |||||||| || || || |||||||||||| Sbjct: 533 ctcagtgctccatctcgtgcttgctctgaggggtggt 569
>gb|DQ244529.1| Zea mays clone 8885 mRNA sequence Length = 797 Score = 365 bits (184), Expect = 2e-97 Identities = 388/456 (85%) Strand = Plus / Plus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 |||||||||||||||||| ||||| || || || ||||||||||| |||||||||||||| Sbjct: 135 gaagatgcagatcttcgtgaagacgctgaccggcaagaccatcacgctcgaggtcgagag 194 Query: 198 cagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgga 257 |||||||||||||||||||||||||||||| || ||||||||||| || ||||| || || Sbjct: 195 cagcgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccaga 254 Query: 258 ccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgacta 317 ||||| | | || |||||||| ||||||||||| ||||| || ||| | ||||| || Sbjct: 255 tcagcaaaggctaatttttgctggaaagcagttggaagatgggcgaacattagctgatta 314 Query: 318 caacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgat 377 |||||||||||| |||||||| || || |||||||| ||||||||||| || || ||||| Sbjct: 315 caacattcagaaagagtcgacgctccatttggtcctgaggctcaggggtggaactatgat 374 Query: 378 caaagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgat 437 ||| || ||||| || ||||||||||| || || ||||| ||||||||||| ||||| || Sbjct: 375 caaggtgaagacacttactgggaaggaaatcgagattgatattgagcccactgacacaat 434 Query: 438 tgacaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggct 497 ||| || |||||||| ||||||||||||||||| || ||||| ||||| || || ||||| Sbjct: 435 tgatagaatcaaggaacgtgttgaggagaaagagggtattccacctgttcaacagaggct 494 Query: 498 gatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaagg 557 || |||||||| ||||| || || |||||||| ||||| |||||||||||||| ||||| Sbjct: 495 catctatgctgggaagcaactcgctgatgacaaaactgctaaggactacaacattgaagg 554 Query: 558 tggctcggtcctccatcttgtcctcgccctgagggg 593 ||| || || ||||||||||| || || |||||||| Sbjct: 555 tggttcagtgctccatcttgtgcttgctctgagggg 590
>gb|AF240445.1|AF240445 Populus tremula x Populus tremuloides polyubiquitin (Ubi) mRNA, complete cds Length = 750 Score = 353 bits (178), Expect = 6e-94 Identities = 388/458 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||||||||| | || || |||||||| || |||||||||||||| || Sbjct: 91 gatgcagatcttcgtcaagacattgactggcaagaccataactctcgaggtcgagagtag 150 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||| |||||||||||||||| ||||| ||||| ||||||||||| || ||||| || || Sbjct: 151 cgacgccatcgacaacgtcaaagccaagattcaagacaaggaaggcatccctcctgatca 210 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||| | ||||| |||||||| || || || || |||||||| || |||||||| ||||| Sbjct: 211 gcaaagattgatttttgctggtaaacaattagaagatggacgtactcttgctgattacaa 270 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaa 380 ||| ||||||||||| ||||||||| |||| | ||||| ||||| || || |||||||| Sbjct: 271 catccagaaggagtccactcttcacctggttttgaggcttaggggaggaactatgatcaa 330 Query: 381 agtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattga 440 || |||||||||||||| || || ||||||||||||||||| || | || || ||||| Sbjct: 331 ggtgaagactctcactggaaaagaaattgaaattgacattgaaccaaatgataccattga 390 Query: 441 caggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgat 500 ||||||||||| || ||||||||||||||||| |||||||| |||||||||||||| || Sbjct: 391 taggatcaaggaacgggttgaggagaaagaaggaattcctccagtgcagcaaaggcttat 450 Query: 501 ttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtgg 560 |||||||||||||||||||| |||||||||||| || |||||||| || || ||||| Sbjct: 451 ttatgctggcaagcagcttggagatgacaagacagctcgcgactacaatattgagggtgg 510 Query: 561 ctcggtcctccatcttgtcctcgccctgaggggtggtt 598 ||| || || |||||||| || || ||||||||||||| Sbjct: 511 ctctgtgcttcatcttgttcttgctctgaggggtggtt 548
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9 Length = 22696651 Score = 341 bits (172), Expect = 2e-90 Identities = 241/264 (91%) Strand = Plus / Plus Query: 232 caggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttg 291 ||||||||||||||||| ||||| || || |||||||||||||| || ||||||||| || Sbjct: 15107514 caggacaaggaagggatccctccagatcaacagcgtttgatattcgccggcaagcagctg 15107573 Query: 292 gaggatggacgcacacttgctgactacaacattcagaaggagtcgactcttcacttggtc 351 || ||||| |||||||| || ||||||||||||||||||||||| ||||||||||||||| Sbjct: 15107574 gaagatgggcgcacactggccgactacaacattcagaaggagtcaactcttcacttggtc 15107633 Query: 352 ctcaggctcaggggcggtacgatgatcaaagtcaagactctcactgggaaggagattgaa 411 |||||||||||||| || || |||||||| || ||||| |||||||| || ||||||||| Sbjct: 15107634 ctcaggctcaggggtggcactatgatcaaggttaagaccctcactggaaaagagattgaa 15107693 Query: 412 attgacattgagcccaccgacacgattgacaggatcaaggagcgtgttgaggagaaagaa 471 |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 15107694 attgacattgagcccaccgacacgatcgataggatcaaggagcgtgttgaggagaaagaa 15107753 Query: 472 ggcattcctcctgtgcagcaaagg 495 ||||||||||| |||||||||||| Sbjct: 15107754 ggcattcctcccgtgcagcaaagg 15107777 Score = 165 bits (83), Expect = 3e-37 Identities = 95/99 (95%) Strand = Plus / Plus Query: 137 agaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgaga 196 ||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| Sbjct: 15106387 agaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggaga 15106446 Query: 197 gcagcgacaccatcgacaacgtcaaggccaaaattcagg 235 |||||||||||||||||||||||||||||||||| |||| Sbjct: 15106447 gcagcgacaccatcgacaacgtcaaggccaaaatccagg 15106485 Score = 165 bits (83), Expect = 3e-37 Identities = 101/107 (94%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 22391375 aagatgcagatcttcgtgaagaccctaacggggaagaccatcacgctcgaggtcgagagc 22391434 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||| ||||||||||| || |||||||||||||| Sbjct: 22391435 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagg 22391481 Score = 141 bits (71), Expect = 4e-30 Identities = 98/107 (91%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| ||||| |||||||| ||||| || ||||| |||||| Sbjct: 16919130 aagatgcagatcttcgtgaagacgctcaccgggaagacgatcacgctggaggtggagagc 16919189 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||||||||||||||| || |||||||||||||| Sbjct: 16919190 agcgacaccatcgacaacgtcaaggccaagatccaggacaaggaagg 16919236 Score = 141 bits (71), Expect = 4e-30 Identities = 98/107 (91%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| || ||||||||||| ||||| || ||||| |||||| Sbjct: 18500321 aagatgcagatcttcgtgaagacgctgacggggaagacgatcacgctggaggtggagagc 18500380 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||||||||||||||| || |||||||||||||| Sbjct: 18500381 agcgacaccatcgacaacgtcaaggccaagatccaggacaaggaagg 18500427 Score = 139 bits (70), Expect = 2e-29 Identities = 106/118 (89%) Strand = Plus / Plus Query: 493 aggctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatc 552 ||||| || |||||||| ||||||||||| || ||||||||||| |||||||| |||||| Sbjct: 15107918 aggcttatctatgctggtaagcagcttgccgacgacaagactgcgaaggactataacatc 15107977 Query: 553 gaaggtggctcggtcctccatcttgtcctcgccctgaggggtggttactagttaagct 610 ||||||||||| ||||||||||||||||| || |||||||||||||| |||| ||||| Sbjct: 15107978 gaaggtggctctgtcctccatcttgtccttgctctgaggggtggttattagtaaagct 15108035 Score = 133 bits (67), Expect = 1e-27 Identities = 97/107 (90%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| || ||||||||| | ||||| || ||||| |||||| Sbjct: 18495070 aagatgcagatcttcgtgaagacgctgacggggaagtcgatcacgctggaggtggagagc 18495129 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||||||||||||||| || |||||||||||||| Sbjct: 18495130 agcgacaccatcgacaacgtcaaggccaagatccaggacaaggaagg 18495176 Score = 83.8 bits (42), Expect = 9e-13 Identities = 84/98 (85%) Strand = Plus / Plus Query: 253 ccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgct 312 ||||||||||||||| | || || || || |||||| | |||||||| ||||| || || Sbjct: 16920153 ccggaccagcagcgtctcatcttcgcggggaagcagctcgaggatggccgcaccctggcc 16920212 Query: 313 gactacaacattcagaaggagtcgactcttcacttggt 350 |||||||||||||||||||||||||| |||||| |||| Sbjct: 16920213 gactacaacattcagaaggagtcgacgcttcacctggt 16920250 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Plus Query: 250 cctccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacactt 309 ||||||||||||||||| | || || || ||||||||| |||||||||| ||||| || Sbjct: 22391585 cctccggaccagcagcgcctcatcttcgccggcaagcagctggaggatggccgcaccctg 22391644 Query: 310 gctgactacaacattcagaaggagtc 335 || ||||||||||| ||||||||||| Sbjct: 22391645 gccgactacaacatccagaaggagtc 22391670 Score = 73.8 bits (37), Expect = 8e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 250 cctccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacactt 309 ||||||||||||||||| | || || || || |||||| |||||||||| ||||| || Sbjct: 18495799 cctccggaccagcagcgcctcatcttcgcggggaagcagctggaggatggccgcaccctg 18495858 Query: 310 gctgactacaacattcagaaggagtcgac 338 || ||||||||||| |||||||||||||| Sbjct: 18495859 gccgactacaacatccagaaggagtcgac 18495887 Score = 52.0 bits (26), Expect = 0.003 Identities = 71/86 (82%) Strand = Plus / Plus Query: 253 ccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgct 312 |||||||||||||| | || || || || |||||| |||| || || ||||| || || Sbjct: 18501509 ccggaccagcagcgcctcatcttcgccgggaagcagctggatgacggccgcaccctggcc 18501568 Query: 313 gactacaacattcagaaggagtcgac 338 ||||||||||| |||||||||||||| Sbjct: 18501569 gactacaacatccagaaggagtcgac 18501594 Score = 44.1 bits (22), Expect = 0.73 Identities = 31/34 (91%) Strand = Plus / Plus Query: 693 tttgcttagtgggaggggatgtcttccatgttat 726 ||||| ||||||||| || ||||||||||||||| Sbjct: 15108136 tttgcctagtgggagaggttgtcttccatgttat 15108169
>dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1740_D06 Length = 187410 Score = 341 bits (172), Expect = 2e-90 Identities = 241/264 (91%) Strand = Plus / Plus Query: 232 caggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttg 291 ||||||||||||||||| ||||| || || |||||||||||||| || ||||||||| || Sbjct: 1490 caggacaaggaagggatccctccagatcaacagcgtttgatattcgccggcaagcagctg 1549 Query: 292 gaggatggacgcacacttgctgactacaacattcagaaggagtcgactcttcacttggtc 351 || ||||| |||||||| || ||||||||||||||||||||||| ||||||||||||||| Sbjct: 1550 gaagatgggcgcacactggccgactacaacattcagaaggagtcaactcttcacttggtc 1609 Query: 352 ctcaggctcaggggcggtacgatgatcaaagtcaagactctcactgggaaggagattgaa 411 |||||||||||||| || || |||||||| || ||||| |||||||| || ||||||||| Sbjct: 1610 ctcaggctcaggggtggcactatgatcaaggttaagaccctcactggaaaagagattgaa 1669 Query: 412 attgacattgagcccaccgacacgattgacaggatcaaggagcgtgttgaggagaaagaa 471 |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 1670 attgacattgagcccaccgacacgatcgataggatcaaggagcgtgttgaggagaaagaa 1729 Query: 472 ggcattcctcctgtgcagcaaagg 495 ||||||||||| |||||||||||| Sbjct: 1730 ggcattcctcccgtgcagcaaagg 1753 Score = 165 bits (83), Expect = 3e-37 Identities = 95/99 (95%) Strand = Plus / Plus Query: 137 agaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgaga 196 ||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| Sbjct: 363 agaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggaga 422 Query: 197 gcagcgacaccatcgacaacgtcaaggccaaaattcagg 235 |||||||||||||||||||||||||||||||||| |||| Sbjct: 423 gcagcgacaccatcgacaacgtcaaggccaaaatccagg 461 Score = 139 bits (70), Expect = 2e-29 Identities = 106/118 (89%) Strand = Plus / Plus Query: 493 aggctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatc 552 ||||| || |||||||| ||||||||||| || ||||||||||| |||||||| |||||| Sbjct: 1894 aggcttatctatgctggtaagcagcttgccgacgacaagactgcgaaggactataacatc 1953 Query: 553 gaaggtggctcggtcctccatcttgtcctcgccctgaggggtggttactagttaagct 610 ||||||||||| ||||||||||||||||| || |||||||||||||| |||| ||||| Sbjct: 1954 gaaggtggctctgtcctccatcttgtccttgctctgaggggtggttattagtaaagct 2011 Score = 44.1 bits (22), Expect = 0.73 Identities = 31/34 (91%) Strand = Plus / Plus Query: 693 tttgcttagtgggaggggatgtcttccatgttat 726 ||||| ||||||||| || ||||||||||||||| Sbjct: 2112 tttgcctagtgggagaggttgtcttccatgttat 2145
>dbj|AP005426.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0668D04 Length = 148848 Score = 341 bits (172), Expect = 2e-90 Identities = 241/264 (91%) Strand = Plus / Plus Query: 232 caggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttg 291 ||||||||||||||||| ||||| || || |||||||||||||| || ||||||||| || Sbjct: 99157 caggacaaggaagggatccctccagatcaacagcgtttgatattcgccggcaagcagctg 99216 Query: 292 gaggatggacgcacacttgctgactacaacattcagaaggagtcgactcttcacttggtc 351 || ||||| |||||||| || ||||||||||||||||||||||| ||||||||||||||| Sbjct: 99217 gaagatgggcgcacactggccgactacaacattcagaaggagtcaactcttcacttggtc 99276 Query: 352 ctcaggctcaggggcggtacgatgatcaaagtcaagactctcactgggaaggagattgaa 411 |||||||||||||| || || |||||||| || ||||| |||||||| || ||||||||| Sbjct: 99277 ctcaggctcaggggtggcactatgatcaaggttaagaccctcactggaaaagagattgaa 99336 Query: 412 attgacattgagcccaccgacacgattgacaggatcaaggagcgtgttgaggagaaagaa 471 |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 99337 attgacattgagcccaccgacacgatcgataggatcaaggagcgtgttgaggagaaagaa 99396 Query: 472 ggcattcctcctgtgcagcaaagg 495 ||||||||||| |||||||||||| Sbjct: 99397 ggcattcctcccgtgcagcaaagg 99420 Score = 165 bits (83), Expect = 3e-37 Identities = 95/99 (95%) Strand = Plus / Plus Query: 137 agaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgaga 196 ||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| Sbjct: 98030 agaagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtggaga 98089 Query: 197 gcagcgacaccatcgacaacgtcaaggccaaaattcagg 235 |||||||||||||||||||||||||||||||||| |||| Sbjct: 98090 gcagcgacaccatcgacaacgtcaaggccaaaatccagg 98128 Score = 139 bits (70), Expect = 2e-29 Identities = 106/118 (89%) Strand = Plus / Plus Query: 493 aggctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatc 552 ||||| || |||||||| ||||||||||| || ||||||||||| |||||||| |||||| Sbjct: 99561 aggcttatctatgctggtaagcagcttgccgacgacaagactgcgaaggactataacatc 99620 Query: 553 gaaggtggctcggtcctccatcttgtcctcgccctgaggggtggttactagttaagct 610 ||||||||||| ||||||||||||||||| || |||||||||||||| |||| ||||| Sbjct: 99621 gaaggtggctctgtcctccatcttgtccttgctctgaggggtggttattagtaaagct 99678 Score = 44.1 bits (22), Expect = 0.73 Identities = 31/34 (91%) Strand = Plus / Plus Query: 693 tttgcttagtgggaggggatgtcttccatgttat 726 ||||| ||||||||| || ||||||||||||||| Sbjct: 99779 tttgcctagtgggagaggttgtcttccatgttat 99812
>gb|DQ246185.1| Zea mays clone 13530 mRNA sequence Length = 772 Score = 325 bits (164), Expect = 1e-85 Identities = 389/464 (83%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||| || ||| || ||||||||||||||||| ||||||||||||| | Sbjct: 121 agatgcagatcttcatcttgacgctgacggggaagaccatcacggtcgaggtcgagagta 180 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||||| || ||||||||||| || ||||||||||| || ||| || |||| Sbjct: 181 gcgacaccatcgaaaatgtcaaggccaagatccaggacaaggagggcattttgcctgacc 240 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 | ||| | |||| |||||||||||||| ||||||||||| || | ||||| |||| Sbjct: 241 accagaggctgatttttgctggcaagcaattggaggatgggaaaactttagctgattaca 300 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatca 379 |||||||||||||||| || || | |||||| | ||||||| ||| || || ||||||| Sbjct: 301 acattcagaaggagtcaacactccctttggtcttgaggctcaagggtggaactatgatca 360 Query: 380 aagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattg 439 | || ||||| || ||||||||||| || || |||||||| ||||||| ||||| ||| Sbjct: 361 aggtgaagacactaactgggaaggaaatcgagattgacatcgagcccaatgacacaattc 420 Query: 440 acaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctga 499 | ||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||| | Sbjct: 421 ataggatcaaggagcgtgttgaggagaaagaaggcatcccacctgttcagcagaggctca 480 Query: 500 tttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtg 559 |||||||||| ||||| ||||| |||||||| ||| ||||||| |||||||| ||||||| Sbjct: 481 tttatgctgggaagcaacttgctgatgacaaaactaccaaggattacaacattgaaggtg 540 Query: 560 gctcggtcctccatcttgtcctcgccctgaggggtggttactag 603 | || || ||||||||||| || || ||||||||||||| |||| Sbjct: 541 gttcagttctccatcttgttcttgctctgaggggtggttgctag 584
>dbj|AK230268.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL23-28-B17 Length = 1724 Score = 272 bits (137), Expect = 2e-69 Identities = 377/457 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || ||||| ||||| |||||||| |||||| Sbjct: 648 atgcagatcttcgtcaaaaccctcaccggaaaaaccataaccctagaggtcgaaagcagc 589 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||| ||||||||||||||||| || || || || || || || Sbjct: 588 gacaccatcgacaatgtcaaagccaaaattcaggacaaagagggaataccacctgatcaa 529 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||||||||| |||||| | || ||||| | ||| | || || |||||| Sbjct: 528 cagaggttgatatttgctggtaagcagcttgaagatggtagaacattagcggattacaac 469 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 |||||||| || ||||||||||||||||| | ||||| ||||| || || ||||| || Sbjct: 468 attcagaaagaatcgactcttcacttggtattgaggcttaggggtgggactatgattaag 409 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||||||||| |||||||| ||||| ||||| || || || ||||| || ||||| Sbjct: 408 gtgaagactctcacagggaaggaaattgagattgatatcgaaccaaccgatactattgat 349 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 |||| ||||| |||||||||||||||||||| || |||||||| || |||||||| || Sbjct: 348 cggattaaggaacgtgttgaggagaaagaaggtatccctcctgttcaacaaaggctaatc 289 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 || || || || ||||| || |||||||| || || |||||||||||||| || || ||| Sbjct: 288 tacgccggaaaacagctagctgatgacaaaacggcaaaggactacaacatagagggaggc 229 Query: 562 tcggtcctccatcttgtcctcgccctgaggggtggtt 598 || || || ||||| || || ||||| |||||||||| Sbjct: 228 tctgttcttcatctggttcttgcccttaggggtggtt 192
>dbj|AK228591.1| Arabidopsis thaliana mRNA for putative ubiquitin, complete cds, clone: RAFL15-38-H20 Length = 712 Score = 272 bits (137), Expect = 2e-69 Identities = 377/457 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || ||||| ||||| |||||||| |||||| Sbjct: 40 atgcagatcttcgtcaaaaccctcaccggaaaaaccataaccctagaggtcgaaagcagc 99 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||| ||||||||||||||||| || || || || || || || Sbjct: 100 gacaccatcgacaatgtcaaagccaaaattcaggacaaagagggaataccacctgatcaa 159 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||||||||| |||||| | || ||||| | ||| | || || |||||| Sbjct: 160 cagaggttgatatttgctggtaagcagcttgaagatggtagaacattagcggattacaac 219 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 |||||||| || ||||||||||||||||| | ||||| ||||| || || ||||| || Sbjct: 220 attcagaaagaatcgactcttcacttggtattgaggcttaggggtgggactatgattaag 279 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||||||||| |||||||| ||||| ||||| || || || ||||| || ||||| Sbjct: 280 gtgaagactctcacagggaaggaaattgagattgatatcgaaccaaccgatactattgat 339 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 |||| ||||| |||||||||||||||||||| || |||||||| || |||||||| || Sbjct: 340 cggattaaggaacgtgttgaggagaaagaaggtatccctcctgttcaacaaaggctaatc 399 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 || || || || ||||| || |||||||| || || |||||||||||||| || || ||| Sbjct: 400 tacgccggaaaacagctagctgatgacaaaacggcaaaggactacaacatagagggaggc 459 Query: 562 tcggtcctccatcttgtcctcgccctgaggggtggtt 598 || || || ||||| || || ||||| |||||||||| Sbjct: 460 tctgttcttcatctggttcttgcccttaggggtggtt 496
>ref|NM_102873.3| Arabidopsis thaliana RUB1 (RELATED TO UBIQUITIN 1) (RUB1) mRNA, complete cds Length = 702 Score = 272 bits (137), Expect = 2e-69 Identities = 377/457 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || ||||| ||||| |||||||| |||||| Sbjct: 40 atgcagatcttcgtcaaaaccctcaccggaaaaaccataaccctagaggtcgaaagcagc 99 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||| ||||||||||||||||| || || || || || || || Sbjct: 100 gacaccatcgacaatgtcaaagccaaaattcaggacaaagagggaataccacctgatcaa 159 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||||||||| |||||| | || ||||| | ||| | || || |||||| Sbjct: 160 cagaggttgatatttgctggtaagcagcttgaagatggtagaacattagcggattacaac 219 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 |||||||| || ||||||||||||||||| | ||||| ||||| || || ||||| || Sbjct: 220 attcagaaagaatcgactcttcacttggtattgaggcttaggggtgggactatgattaag 279 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||||||||| |||||||| ||||| ||||| || || || ||||| || ||||| Sbjct: 280 gtgaagactctcacagggaaggaaattgagattgatatcgaaccaaccgatactattgat 339 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 |||| ||||| |||||||||||||||||||| || |||||||| || |||||||| || Sbjct: 340 cggattaaggaacgtgttgaggagaaagaaggtatccctcctgttcaacaaaggctaatc 399 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 || || || || ||||| || |||||||| || || |||||||||||||| || || ||| Sbjct: 400 tacgccggaaaacagctagctgatgacaaaacggcaaaggactacaacatagagggaggc 459 Query: 562 tcggtcctccatcttgtcctcgccctgaggggtggtt 598 || || || ||||| || || ||||| |||||||||| Sbjct: 460 tctgttcttcatctggttcttgcccttaggggtggtt 496
>gb|BT006110.1| Arabidopsis thaliana clone U50103 putative ubiquitin (AtRUB1) (At1g31340) mRNA, complete cds Length = 502 Score = 272 bits (137), Expect = 2e-69 Identities = 377/457 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || ||||| ||||| |||||||| |||||| Sbjct: 1 atgcagatcttcgtcaaaaccctcaccggaaaaaccataaccctagaggtcgaaagcagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||| ||||||||||||||||| || || || || || || || Sbjct: 61 gacaccatcgacaatgtcaaagccaaaattcaggacaaagagggaataccacctgatcaa 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||||||||| |||||| | || ||||| | ||| | || || |||||| Sbjct: 121 cagaggttgatatttgctggtaagcagcttgaagatggtagaacattagcggattacaac 180 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 |||||||| || ||||||||||||||||| | ||||| ||||| || || ||||| || Sbjct: 181 attcagaaagaatcgactcttcacttggtattgaggcttaggggtgggactatgattaag 240 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||||||||| |||||||| ||||| ||||| || || || ||||| || ||||| Sbjct: 241 gtgaagactctcacagggaaggaaattgagattgatatcgaaccaaccgatactattgat 300 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 |||| ||||| |||||||||||||||||||| || |||||||| || |||||||| || Sbjct: 301 cggattaaggaacgtgttgaggagaaagaaggtatccctcctgttcaacaaaggctaatc 360 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 || || || || ||||| || |||||||| || || |||||||||||||| || || ||| Sbjct: 361 tacgccggaaaacagctagctgatgacaaaacggcaaaggactacaacatagagggaggc 420 Query: 562 tcggtcctccatcttgtcctcgccctgaggggtggtt 598 || || || ||||| || || ||||| |||||||||| Sbjct: 421 tctgttcttcatctggttcttgcccttaggggtggtt 457
>gb|BT005749.1| Arabidopsis thaliana clone RAFL15-38-H20 (R50103) putative ubiquitin (AtRUB1) (At1g31340) mRNA, complete cds Length = 742 Score = 272 bits (137), Expect = 2e-69 Identities = 377/457 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || ||||| ||||| |||||||| |||||| Sbjct: 40 atgcagatcttcgtcaaaaccctcaccggaaaaaccataaccctagaggtcgaaagcagc 99 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||| ||||||||||||||||| || || || || || || || Sbjct: 100 gacaccatcgacaatgtcaaagccaaaattcaggacaaagagggaataccacctgatcaa 159 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||||||||| |||||| | || ||||| | ||| | || || |||||| Sbjct: 160 cagaggttgatatttgctggtaagcagcttgaagatggtagaacattagcggattacaac 219 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 |||||||| || ||||||||||||||||| | ||||| ||||| || || ||||| || Sbjct: 220 attcagaaagaatcgactcttcacttggtattgaggcttaggggtgggactatgattaag 279 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||||||||| |||||||| ||||| ||||| || || || ||||| || ||||| Sbjct: 280 gtgaagactctcacagggaaggaaattgagattgatatcgaaccaaccgatactattgat 339 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 |||| ||||| |||||||||||||||||||| || |||||||| || |||||||| || Sbjct: 340 cggattaaggaacgtgttgaggagaaagaaggtatccctcctgttcaacaaaggctaatc 399 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 || || || || ||||| || |||||||| || || |||||||||||||| || || ||| Sbjct: 400 tacgccggaaaacagctagctgatgacaaaacggcaaaggactacaacatagagggaggc 459 Query: 562 tcggtcctccatcttgtcctcgccctgaggggtggtt 598 || || || ||||| || || ||||| |||||||||| Sbjct: 460 tctgttcttcatctggttcttgcccttaggggtggtt 496
>emb|CT829200.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA001O13, full insert sequence Length = 634 Score = 232 bits (117), Expect = 1e-57 Identities = 177/197 (89%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 55 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctcgaggtcgagagc 114 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| ||||||||||| || |||||||||||||| || ||||||||| Sbjct: 115 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaaggcatccctccggac 174 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| |||||||||| ||||| || || |||||| Sbjct: 175 cagcagcgcctcatcttcgccggcaagcagctggaggatggccgcaccctggccgactac 234 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 235 aacatccagaaggagtc 251
>gb|BT018987.1| Zea mays clone Contig444.F mRNA sequence Length = 668 Score = 228 bits (115), Expect = 2e-56 Identities = 184/207 (88%) Strand = Plus / Minus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| || || |||||||||||||||||||||||||||||| Sbjct: 609 aagatgcagatcttcgtgaagacgctgacagggaagaccatcaccctcgaggtcgagagc 550 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| ||||||||||| || ||||||||||||||||| || |||||| Sbjct: 549 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagggatcccgccggac 490 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| |||| ||||| || |||||| |||||||||| ||||| ||||| ||||| Sbjct: 489 cagcagcggctgatctttgccgggaagcagctggaggatggccgcacccttgcggactat 430 Query: 319 aacattcagaaggagtcgactcttcac 345 ||||| || |||||||| || |||||| Sbjct: 429 aacatccaaaaggagtctacgcttcac 403
>gb|DQ245520.1| Zea mays clone 16666 mRNA sequence Length = 686 Score = 226 bits (114), Expect = 9e-56 Identities = 195/222 (87%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| || || |||||||||||||||||||||||||||||| Sbjct: 69 aagatgcagatcttcgtgaagacgctgacagggaagaccatcaccctcgaggtcgagagc 128 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| ||||||||||| || ||||||||||||||||| || |||||| Sbjct: 129 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagggatcccgccggac 188 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| |||| ||||| || |||||| |||||||||| ||||| ||||| ||||| Sbjct: 189 cagcagcggctgatctttgccgggaagcagctggaggatggccgcacccttgcggactat 248 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 ||||| || |||||||| || || ||| | || ||||||||| Sbjct: 249 aacatccaaaaggagtctacgctccacctcgtgctcaggctc 290
>ref|NM_001066203.1| Oryza sativa (japonica cultivar-group) Os07g0489500 (Os07g0489500) mRNA, complete cds Length = 432 Score = 224 bits (113), Expect = 4e-55 Identities = 176/197 (89%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 1 atgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtcgagagcagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||||||||| || ||||||||||||||||| || ||||||||| Sbjct: 61 gacaccatcgacaatgtcaaggccaagatccaggacaaggaagggatcccgccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || || || |||||| ||||||| || || || || || ||||||||| Sbjct: 121 cagcggctgatcttcgccgggaagcagctggaggacggccggacgctggccgactacaac 180 Query: 322 attcagaaggagtcgac 338 || |||||||||||||| Sbjct: 181 atccagaaggagtcgac 197
>gb|AY098526.1| Ananas comosus tetrameric ubiquitin mRNA, complete cds Length = 1199 Score = 224 bits (113), Expect = 4e-55 Identities = 176/197 (89%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | | Sbjct: 267 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcc 326 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||||||||||| ||||||||||| ||||| || ||||||||| Sbjct: 327 gacaccatcgacaatgtcaaggccaaaatccaggacaaggaggggatccccccggaccag 386 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || || ||||||||||||||||| || ||||| ||||| ||||||||| Sbjct: 387 cagcgtctgatcttcgcaggcaagcagttggaggacggccgcactcttgcggactacaac 446 Query: 322 attcagaaggagtcgac 338 || |||||||||||||| Sbjct: 447 atccagaaggagtcgac 463 Score = 206 bits (104), Expect = 9e-50 Identities = 176/200 (88%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||| ||||||||||||||||| || || |||||||||||||||||||||||| Sbjct: 36 aagatgcaaatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcg 95 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||| |||||||||||||| ||||||||||| ||||| || |||||| Sbjct: 96 tccgacaccatcgacaatgtcaaggccaaaatccaggacaaggaggggatccccccggac 155 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| ||||| || || ||||||||||||||||| || ||||| || || |||||| Sbjct: 156 cagcagcggttgatcttcgccggcaagcagttggaggacggccgcactctcgcggactac 215 Query: 319 aacattcagaaggagtcgac 338 ||||| |||||||||||||| Sbjct: 216 aacatccagaaggagtcgac 235 Score = 200 bits (101), Expect = 5e-48 Identities = 173/197 (87%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | | Sbjct: 495 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcc 554 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || ||||||||||| ||||||||||| || || || ||||||||| Sbjct: 555 gacaccatcgacaatgttaaggccaaaatccaggacaaggagggtatcccgccggaccag 614 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || || ||||||||||||||||| || ||||| || || ||||||||| Sbjct: 615 cagcgtctgatcttcgcaggcaagcagttggaggacggccgcactctggcggactacaac 674 Query: 322 attcagaaggagtcgac 338 || |||||||||||||| Sbjct: 675 atccagaaggagtcgac 691 Score = 149 bits (75), Expect = 2e-32 Identities = 162/191 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| || || |||||||||||||||||||||||| | | Sbjct: 723 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcc 782 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||||||||| || || || ||||||||||| || || || ||||||||| Sbjct: 783 gacacgatcgacaacgtcaaagctaagatccaggacaaggagggcatcccgccggaccag 842 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||| || |||||||||||||| || ||||| || || ||||||||| Sbjct: 843 cagcggctcatctttgccggtaagcagttggaggacggccgcactctggcggactacaac 902 Query: 322 attcagaagga 332 || |||||||| Sbjct: 903 atccagaagga 913
>gb|AY104761.1| Zea mays PCO089720 mRNA sequence Length = 803 Score = 218 bits (110), Expect = 2e-53 Identities = 194/222 (87%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| || || |||||||||||||||||||||||||||||| Sbjct: 117 aagatgcagatctttgtgaagacgctgacagggaagaccatcaccctcgaggtcgagagc 176 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| ||||||||||| || ||||||||||||||||| || |||||| Sbjct: 177 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagggatcccgccggac 236 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| |||| ||||| || |||||| |||||||||| ||||| ||||| ||||| Sbjct: 237 cagcagcggctgatctttgccgggaagcagctggaggatggccgcacccttgcggactat 296 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 ||||| || |||||||| || || ||| | || ||||||||| Sbjct: 297 aacatccaaaaggagtctacgctccacctcgtgctcaggctc 338
>gb|DQ245516.1| Zea mays clone 16648 mRNA sequence Length = 686 Score = 216 bits (109), Expect = 9e-53 Identities = 193/221 (87%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||||| ||||| || || ||||||||||||||||||||||||||||||| Sbjct: 70 agatgcagatcttcgtgaagacgctgacagggaagaccatcaccctcgaggtcgagagca 129 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||||||||| | ||||||||| || ||||||||||||||||| || ||||||| Sbjct: 130 gcgacaccatcgacaatggcaaggccaagatccaggacaaggaagggatcccgccggacc 189 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 | ||||| |||| ||||| || |||||| |||||||||||||||| ||||| ||||| | Sbjct: 190 atcagcggctgatctttgccgggaagcagctggaggatggacgcacccttgcggactata 249 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctc 360 |||| || |||||||| || || ||| | || ||||||||| Sbjct: 250 acatccaaaaggagtctacgctccacctcgtgctcaggctc 290
>emb|CT837725.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN066B19, full insert sequence Length = 791 Score = 214 bits (108), Expect = 4e-52 Identities = 186/212 (87%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| ||||| |||||||| ||||| || ||||| |||||| Sbjct: 87 aagatgcagatcttcgtgaagacgctcaccgggaagacgatcacgctggaggtggagagc 146 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||||||||||||||| || |||||||||||||| || || |||||| Sbjct: 147 agcgacaccatcgacaacgtcaaggccaagatccaggacaaggaaggtatcccgccggac 206 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || || || |||||| | |||||||| ||||| || || |||||| Sbjct: 207 cagcagcgtctcatcttcgcggggaagcagctcgaggatggccgcaccctggccgactac 266 Query: 319 aacattcagaaggagtcgactcttcacttggt 350 |||||||||||||||||||| |||||| |||| Sbjct: 267 aacattcagaaggagtcgacgcttcacctggt 298
>ref|NM_001056014.1| Oryza sativa (japonica cultivar-group) Os03g0234200 (Os03g0234200) mRNA, complete cds Length = 611 Score = 214 bits (108), Expect = 4e-52 Identities = 201/232 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||| |||||||| |||||||| || ||||||||||||||||||||||| |||||| Sbjct: 25 aagatgcaaatcttcgtgaagaccctgactgggaagaccatcaccctcgaggtggagagc 84 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || || ||||||||||| || || || |||||| Sbjct: 85 agcgacaccatcgacaatgtcaaggctaagatccaggacaaggagggaatcccgccggac 144 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| |||| || || || |||||| ||||||| |||||||| || ||||||||| Sbjct: 145 cagcagcggctgatcttcgccgggaagcagctggaggacggacgcaccctggctgactac 204 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 ||||| ||||||||||| || || ||| | |||||||||||| | ||||||| Sbjct: 205 aacatccagaaggagtccaccctccacctcgtcctcaggctccgtggcggta 256
>dbj|D12629.1|RICRPOLYP Oryza sativa (japonica cultivar-group) mRNA for ubiquitin/ribosomal polyprotein, ubiquitin, ribosomal protein, complete cds Length = 615 Score = 214 bits (108), Expect = 4e-52 Identities = 201/232 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||| |||||||| |||||||| || ||||||||||||||||||||||| |||||| Sbjct: 25 aagatgcaaatcttcgtgaagaccctgactgggaagaccatcaccctcgaggtggagagc 84 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || || ||||||||||| || || || |||||| Sbjct: 85 agcgacaccatcgacaatgtcaaggctaagatccaggacaaggagggaatcccgccggac 144 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| |||| || || || |||||| ||||||| |||||||| || ||||||||| Sbjct: 145 cagcagcggctgatcttcgccgggaagcagctggaggacggacgcaccctggctgactac 204 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 ||||| ||||||||||| || || ||| | |||||||||||| | ||||||| Sbjct: 205 aacatccagaaggagtccaccctccacctcgtcctcaggctccgtggcggta 256
>ref|NM_129118.3| Arabidopsis thaliana UBQ7 (UBQ7) mRNA, complete cds Length = 688 Score = 210 bits (106), Expect = 5e-51 Identities = 325/398 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || || || ||||| || || ||||||||| Sbjct: 51 atgcagatcttcgtcaaaaccctcaccggcaaaactataaccctagaagttgagagcagc 110 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || || |||||||| |||||||| || || || || || || || Sbjct: 111 gacaccatcgacaatgttaaagccaaaatccaggacaaagagggcataccacctgatcaa 170 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| |||||||| ||||| ||||| ||||| || || | ||||| |||||| Sbjct: 171 cagaggctgatttttgctggtaagcaattggaagatggccggaccttagctgattacaac 230 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 || ||||| ||||| |||||||| | |||||||||||||| || || || |||||||| Sbjct: 231 atccagaaagagtctactcttcatcttgtcctcaggctcagaggtggaaccatgatcaag 290 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||| |||||||| || || || || ||||| || || || |||||||| ||||| Sbjct: 291 gtgaagacactcactggaaaagaaatcgagattgatatcgaaccaaccgacactattgat 350 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 ||||||| || |||||||| |||||||||||||| |||||||| || |||||||| || Sbjct: 351 cggatcaaagaacgtgttgaagagaaagaaggcatccctcctgttcaacaaaggctcata 410 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaa 539 ||||| || || |||||||| |||||||| || ||||| Sbjct: 411 tatgccggaaaacagcttgctgatgacaaaacggccaa 448
>gb|AY093802.1| Arabidopsis thaliana At1g31340/T19E23_4 mRNA, complete cds Length = 465 Score = 210 bits (106), Expect = 5e-51 Identities = 325/398 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || || || ||||| || || ||||||||| Sbjct: 1 atgcagatcttcgtcaaaaccctcaccggcaaaactataaccctagaagttgagagcagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || || |||||||| |||||||| || || || || || || || Sbjct: 61 gacaccatcgacaatgttaaagccaaaatccaggacaaagagggcataccacctgatcaa 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| |||||||| ||||| ||||| ||||| || || | ||||| |||||| Sbjct: 121 cagaggctgatttttgctggtaagcaattggaagatggccggaccttagctgattacaac 180 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 || ||||| ||||| |||||||| | |||||||||||||| || || || |||||||| Sbjct: 181 atccagaaagagtctactcttcatcttgtcctcaggctcagaggtggaaccatgatcaag 240 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||| |||||||| || || || || ||||| || || || |||||||| ||||| Sbjct: 241 gtgaagacactcactggaaaagaaatcgagattgatatcgaaccaaccgacactattgat 300 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 ||||||| || |||||||| |||||||||||||| |||||||| || |||||||| || Sbjct: 301 cggatcaaagaacgtgttgaagagaaagaaggcatccctcctgttcaacaaaggctcata 360 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaa 539 ||||| || || |||||||| |||||||| || ||||| Sbjct: 361 tatgccggaaaacagcttgctgatgacaaaacggccaa 398
>gb|AY074850.1| Arabidopsis thaliana At1g31340/T19E23_4 mRNA, complete cds Length = 641 Score = 210 bits (106), Expect = 5e-51 Identities = 325/398 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || || || ||||| || || ||||||||| Sbjct: 51 atgcagatcttcgtcaaaaccctcaccggcaaaactataaccctagaagttgagagcagc 110 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || || |||||||| |||||||| || || || || || || || Sbjct: 111 gacaccatcgacaatgttaaagccaaaatccaggacaaagagggcataccacctgatcaa 170 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| |||||||| ||||| ||||| ||||| || || | ||||| |||||| Sbjct: 171 cagaggctgatttttgctggtaagcaattggaagatggccggaccttagctgattacaac 230 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 || ||||| ||||| |||||||| | |||||||||||||| || || || |||||||| Sbjct: 231 atccagaaagagtctactcttcatcttgtcctcaggctcagaggtggaaccatgatcaag 290 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||| |||||||| || || || || ||||| || || || |||||||| ||||| Sbjct: 291 gtgaagacactcactggaaaagaaatcgagattgatatcgaaccaaccgacactattgat 350 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 ||||||| || |||||||| |||||||||||||| |||||||| || |||||||| || Sbjct: 351 cggatcaaagaacgtgttgaagagaaagaaggcatccctcctgttcaacaaaggctcata 410 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaa 539 ||||| || || |||||||| |||||||| || ||||| Sbjct: 411 tatgccggaaaacagcttgctgatgacaaaacggccaa 448
>dbj|AK118678.1| Arabidopsis thaliana mRNA for ubiquitin-like protein, complete cds, clone: RAFL19-95-A01 Length = 660 Score = 210 bits (106), Expect = 5e-51 Identities = 325/398 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || || || ||||| || || ||||||||| Sbjct: 51 atgcagatcttcgtcaaaaccctcaccggcaaaactataaccctagaagttgagagcagc 110 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || || |||||||| |||||||| || || || || || || || Sbjct: 111 gacaccatcgacaatgttaaagccaaaatccaggacaaagagggcataccacctgatcaa 170 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| |||||||| ||||| ||||| ||||| || || | ||||| |||||| Sbjct: 171 cagaggctgatttttgctggtaagcaattggaagatggccggaccttagctgattacaac 230 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 || ||||| ||||| |||||||| | |||||||||||||| || || || |||||||| Sbjct: 231 atccagaaagagtctactcttcatcttgtcctcaggctcagaggtggaaccatgatcaag 290 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || ||||| |||||||| || || || || ||||| || || || |||||||| ||||| Sbjct: 291 gtgaagacactcactggaaaagaaatcgagattgatatcgaaccaaccgacactattgat 350 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 ||||||| || |||||||| |||||||||||||| |||||||| || |||||||| || Sbjct: 351 cggatcaaagaacgtgttgaagagaaagaaggcatccctcctgttcaacaaaggctcata 410 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaa 539 ||||| || || |||||||| |||||||| || ||||| Sbjct: 411 tatgccggaaaacagcttgctgatgacaaaacggccaa 448
>ref|NM_001069872.1| Oryza sativa (japonica cultivar-group) Os09g0452700 (Os09g0452700) mRNA, complete cds Length = 423 Score = 208 bits (105), Expect = 2e-50 Identities = 183/209 (87%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| |||||||| ||||| || ||||| ||||||||| Sbjct: 1 atgcagatcttcgtgaagacgctcaccgggaagacgatcacgctggaggtggagagcagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||||||||| || || ||||||||| Sbjct: 61 gacaccatcgacaacgtcaaggccaagatccaggacaaggaaggtatcccgccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || || |||||| | |||||||| ||||| || || ||||||||| Sbjct: 121 cagcgtctcatcttcgcggggaagcagctcgaggatggccgcaccctggccgactacaac 180 Query: 322 attcagaaggagtcgactcttcacttggt 350 ||||||||||||||||| |||||| |||| Sbjct: 181 attcagaaggagtcgacgcttcacctggt 209
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 208 bits (105), Expect = 2e-50 Identities = 360/445 (80%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||||||| Sbjct: 25760876 agatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagagca 25760935 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||| ||| | ||||||||||| || | ||||||||||| ||||| || ||||||| Sbjct: 25760936 gcgacacgatccagaacgtcaaggcgaaggtgcaggacaaggaggggatcccgccggacc 25760995 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||||| | || || || ||||||||| ||||||| || ||||| || || ||||||| Sbjct: 25760996 agcagcggctcatcttcgccggcaagcagctggaggacgggcgcacgctggccgactaca 25761055 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatca 379 |||| |||||||||||||| || ||| |||| ||| | ||| | ||||| || ||| Sbjct: 25761056 acatccagaaggagtcgacgctgcacctggtgctccgcctccgcggcggcctgaacgtca 25761115 Query: 380 aagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattg 439 | || | ||| ||||| || |||||||| || || ||||| ||| || |||||| | | Sbjct: 25761116 aggtgaggacgctcaccggcaaggagatcgacatcgacatcgagatgacggacacggtgg 25761175 Query: 440 acaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctga 499 |||||||||||||||| || ||||||| || ||||| || || |||||||| ||||| | Sbjct: 25761176 acaggatcaaggagcgcgtcgaggagagggagggcatcccgcccgtgcagcagaggctca 25761235 Query: 500 tttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtg 559 | || | || ||||||||||| || |||||||| || | |||||||| ||||| | || Sbjct: 25761236 tctacggcgggaagcagcttgccgacgacaagacggcgcacgactacaagatcgaggctg 25761295 Query: 560 gctcggtcctccatcttgtcctcgc 584 |||| |||||||| || |||||||| Sbjct: 25761296 gctccgtcctccacctcgtcctcgc 25761320 Score = 145 bits (73), Expect = 3e-31 Identities = 169/201 (84%) Strand = Plus / Minus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 |||||||||||||||||| |||||||| ||||||||||| ||||| || ||||| ||| Sbjct: 12629182 gaagatgcagatcttcgtgaagaccctgacggggaagacgatcacgctggaggtggagtc 12629123 Query: 198 cagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgga 257 | ||||||||||||||||| ||||| || || ||||||||||| ||||| || || || Sbjct: 12629122 ctcggacaccatcgacaacgtgaaggcgaagatccaggacaaggaggggatcccgcccga 12629063 Query: 258 ccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgacta 317 ||||||||| | || || || ||||||||| ||||||| || ||||| || || ||||| Sbjct: 12629062 ccagcagcggctcatcttcgccggcaagcagctggaggacgggcgcaccctcgccgacta 12629003 Query: 318 caacattcagaaggagtcgac 338 |||||| |||||||||||||| Sbjct: 12629002 caacatccagaaggagtcgac 12628982 Score = 87.7 bits (44), Expect = 5e-14 Identities = 161/200 (80%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||| ||||| |||||||| | |||| ||||||||| |||| |||||| ||| Sbjct: 25765297 aagatgcagatattcgtgaagaccctgaacgggaggaccatcacgctcgtggtcgacagc 25765356 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| | |||| ||||||||||| | || || |||| ||| || | || ||| || Sbjct: 25765357 tgcgactcggtcgagaacgtcaaggcgaggatccacgacagggagggcgtcccgccgcac 25765416 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| ||||||| || ||||| || || |||||| Sbjct: 25765417 cagcagcggctcatcttcgccggcaagcagctggaggacggccgcacgctggccgactac 25765476 Query: 319 aacattcagaaggagtcgac 338 ||||| |||||||||||||| Sbjct: 25765477 aacatccagaaggagtcgac 25765496 Score = 58.0 bits (29), Expect = 5e-05 Identities = 59/69 (85%) Strand = Plus / Plus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 ||||||||||||| |||| |||||| | ||||||| |||||| |||||||| ||||| Sbjct: 25769432 gaagatgcagatcgtcgtggagacccagatggggaagctcatcacgctcgaggtggagag 25769491 Query: 198 cagcgacac 206 ||||||||| Sbjct: 25769492 cagcgacac 25769500 Score = 50.1 bits (25), Expect = 0.012 Identities = 55/65 (84%) Strand = Plus / Plus Query: 391 ctcactgggaaggagattgaaattgacattgagcccaccgacacgattgacaggatcaag 450 |||||||| ||||||||||| | ||||| ||||| || ||||| || | |||||||||| Sbjct: 25765552 ctcactggcaaggagattgacgtggacatcgagccgacggacactatgggcaggatcaag 25765611 Query: 451 gagcg 455 ||||| Sbjct: 25765612 gagcg 25765616
>emb|X76064.1|OSPOLUBI O.sativa rub1 mRNA for polyubiquitin Length = 1673 Score = 208 bits (105), Expect = 2e-50 Identities = 198/229 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | Sbjct: 729 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcg 788 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 789 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggcatccccccggaccag 848 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || ||||||||||||||| |||||||||| ||||| ||||| ||||||||| Sbjct: 849 cagcgtctcatctttgctggcaagcagctggaggatggccgcacccttgccgactacaac 908 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 909 atccagaaggagtccaccctccaccttgtgctcaggctcaggggtggta 957 Score = 180 bits (91), Expect = 5e-42 Identities = 193/227 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || |||||||||||||| |||||||||||||||||||| ||| | Sbjct: 42 aagatgcagatctttgtgaagaccctcacgggcaagaccatcaccctcgaggttgagtcc 101 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||| ||||| ||||||||||| || ||||||||||| || || || |||||| Sbjct: 102 tcggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggac 161 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || |||||||||||| | |||||||| ||||| || || |||||| Sbjct: 162 cagcagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactac 221 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| ||||||||||| || || ||| | || |||||||||||||| Sbjct: 222 aacatccagaaggagtccaccctccaccttgtgctcaggctcagggg 268 Score = 174 bits (88), Expect = 3e-40 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 957 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggtcgagtcctcg 1016 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || |||||||| || ||||||||||| || || || ||||||||| Sbjct: 1017 gacacgatcgacaatgtgaaggccaagatccaggacaaggagggtatccccccggaccag 1076 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| | |||||||||||| Sbjct: 1077 cagcgtctcatcttcgccggcaagcagctggaggatggccgcaccttggctgactacaac 1136 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 1137 atccagaaggagtccacccttcacctggttctcaggctcagggg 1180 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 501 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 560 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || || |||||| Sbjct: 561 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccagaccag 620 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| ||||||||||||||| Sbjct: 621 cagcgtctcatcttcgccggcaagcagctggaggatggccgcacccttgctgactacaac 680 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 681 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 729 Score = 167 bits (84), Expect = 7e-38 Identities = 189/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 273 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 332 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 333 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggaccag 392 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || |||||||||||| Sbjct: 393 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggctgactacaac 452 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | || |||||||||||||| Sbjct: 453 atccagaaggagtccaccctccaccttgtgctcaggctcagggg 496 Score = 117 bits (59), Expect = 6e-23 Identities = 161/195 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 1184 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 1243 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 1244 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 1303 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| |||||||| |||||| | |||||||| ||||| | || || ||||| Sbjct: 1304 gcagcgtctgatctttgctggtaagcagcttgaggatggccgcaccttggcggattacaa 1363 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 1364 catccagaaggagtc 1378
>dbj|AP003855.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0039G05 Length = 138429 Score = 208 bits (105), Expect = 2e-50 Identities = 360/445 (80%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||||||| Sbjct: 63340 agatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagagca 63399 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||| ||| | ||||||||||| || | ||||||||||| ||||| || ||||||| Sbjct: 63400 gcgacacgatccagaacgtcaaggcgaaggtgcaggacaaggaggggatcccgccggacc 63459 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||||| | || || || ||||||||| ||||||| || ||||| || || ||||||| Sbjct: 63460 agcagcggctcatcttcgccggcaagcagctggaggacgggcgcacgctggccgactaca 63519 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatca 379 |||| |||||||||||||| || ||| |||| ||| | ||| | ||||| || ||| Sbjct: 63520 acatccagaaggagtcgacgctgcacctggtgctccgcctccgcggcggcctgaacgtca 63579 Query: 380 aagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattg 439 | || | ||| ||||| || |||||||| || || ||||| ||| || |||||| | | Sbjct: 63580 aggtgaggacgctcaccggcaaggagatcgacatcgacatcgagatgacggacacggtgg 63639 Query: 440 acaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctga 499 |||||||||||||||| || ||||||| || ||||| || || |||||||| ||||| | Sbjct: 63640 acaggatcaaggagcgcgtcgaggagagggagggcatcccgcccgtgcagcagaggctca 63699 Query: 500 tttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtg 559 | || | || ||||||||||| || |||||||| || | |||||||| ||||| | || Sbjct: 63700 tctacggcgggaagcagcttgccgacgacaagacggcgcacgactacaagatcgaggctg 63759 Query: 560 gctcggtcctccatcttgtcctcgc 584 |||| |||||||| || |||||||| Sbjct: 63760 gctccgtcctccacctcgtcctcgc 63784 Score = 87.7 bits (44), Expect = 5e-14 Identities = 161/200 (80%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||| ||||| |||||||| | |||| ||||||||| |||| |||||| ||| Sbjct: 67761 aagatgcagatattcgtgaagaccctgaacgggaggaccatcacgctcgtggtcgacagc 67820 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| | |||| ||||||||||| | || || |||| ||| || | || ||| || Sbjct: 67821 tgcgactcggtcgagaacgtcaaggcgaggatccacgacagggagggcgtcccgccgcac 67880 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| ||||||| || ||||| || || |||||| Sbjct: 67881 cagcagcggctcatcttcgccggcaagcagctggaggacggccgcacgctggccgactac 67940 Query: 319 aacattcagaaggagtcgac 338 ||||| |||||||||||||| Sbjct: 67941 aacatccagaaggagtcgac 67960 Score = 58.0 bits (29), Expect = 5e-05 Identities = 59/69 (85%) Strand = Plus / Plus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 ||||||||||||| |||| |||||| | ||||||| |||||| |||||||| ||||| Sbjct: 71896 gaagatgcagatcgtcgtggagacccagatggggaagctcatcacgctcgaggtggagag 71955 Query: 198 cagcgacac 206 ||||||||| Sbjct: 71956 cagcgacac 71964 Score = 50.1 bits (25), Expect = 0.012 Identities = 55/65 (84%) Strand = Plus / Plus Query: 391 ctcactgggaaggagattgaaattgacattgagcccaccgacacgattgacaggatcaag 450 |||||||| ||||||||||| | ||||| ||||| || ||||| || | |||||||||| Sbjct: 68016 ctcactggcaaggagattgacgtggacatcgagccgacggacactatgggcaggatcaag 68075 Query: 451 gagcg 455 ||||| Sbjct: 68076 gagcg 68080
>dbj|AP003725.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0510C12 Length = 177049 Score = 208 bits (105), Expect = 2e-50 Identities = 360/445 (80%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||||||| Sbjct: 800 agatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagagca 859 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||| ||| | ||||||||||| || | ||||||||||| ||||| || ||||||| Sbjct: 860 gcgacacgatccagaacgtcaaggcgaaggtgcaggacaaggaggggatcccgccggacc 919 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||||| | || || || ||||||||| ||||||| || ||||| || || ||||||| Sbjct: 920 agcagcggctcatcttcgccggcaagcagctggaggacgggcgcacgctggccgactaca 979 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatca 379 |||| |||||||||||||| || ||| |||| ||| | ||| | ||||| || ||| Sbjct: 980 acatccagaaggagtcgacgctgcacctggtgctccgcctccgcggcggcctgaacgtca 1039 Query: 380 aagtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattg 439 | || | ||| ||||| || |||||||| || || ||||| ||| || |||||| | | Sbjct: 1040 aggtgaggacgctcaccggcaaggagatcgacatcgacatcgagatgacggacacggtgg 1099 Query: 440 acaggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctga 499 |||||||||||||||| || ||||||| || ||||| || || |||||||| ||||| | Sbjct: 1100 acaggatcaaggagcgcgtcgaggagagggagggcatcccgcccgtgcagcagaggctca 1159 Query: 500 tttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtg 559 | || | || ||||||||||| || |||||||| || | |||||||| ||||| | || Sbjct: 1160 tctacggcgggaagcagcttgccgacgacaagacggcgcacgactacaagatcgaggctg 1219 Query: 560 gctcggtcctccatcttgtcctcgc 584 |||| |||||||| || |||||||| Sbjct: 1220 gctccgtcctccacctcgtcctcgc 1244 Score = 87.7 bits (44), Expect = 5e-14 Identities = 161/200 (80%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||| ||||| |||||||| | |||| ||||||||| |||| |||||| ||| Sbjct: 5221 aagatgcagatattcgtgaagaccctgaacgggaggaccatcacgctcgtggtcgacagc 5280 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| | |||| ||||||||||| | || || |||| ||| || | || ||| || Sbjct: 5281 tgcgactcggtcgagaacgtcaaggcgaggatccacgacagggagggcgtcccgccgcac 5340 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| ||||||| || ||||| || || |||||| Sbjct: 5341 cagcagcggctcatcttcgccggcaagcagctggaggacggccgcacgctggccgactac 5400 Query: 319 aacattcagaaggagtcgac 338 ||||| |||||||||||||| Sbjct: 5401 aacatccagaaggagtcgac 5420 Score = 58.0 bits (29), Expect = 5e-05 Identities = 59/69 (85%) Strand = Plus / Plus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 ||||||||||||| |||| |||||| | ||||||| |||||| |||||||| ||||| Sbjct: 9356 gaagatgcagatcgtcgtggagacccagatggggaagctcatcacgctcgaggtggagag 9415 Query: 198 cagcgacac 206 ||||||||| Sbjct: 9416 cagcgacac 9424 Score = 50.1 bits (25), Expect = 0.012 Identities = 55/65 (84%) Strand = Plus / Plus Query: 391 ctcactgggaaggagattgaaattgacattgagcccaccgacacgattgacaggatcaag 450 |||||||| ||||||||||| | ||||| ||||| || ||||| || | |||||||||| Sbjct: 5476 ctcactggcaaggagattgacgtggacatcgagccgacggacactatgggcaggatcaag 5535 Query: 451 gagcg 455 ||||| Sbjct: 5536 gagcg 5540
>ref|NM_001050219.1| Oryza sativa (japonica cultivar-group) Os01g0641200 (Os01g0641200) mRNA, complete cds Length = 465 Score = 204 bits (103), Expect = 3e-49 Identities = 358/443 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| ||||||||||||||||| || ||||| ||||||||| Sbjct: 1 atgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagagcagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||| | ||||||||||| || | ||||||||||| ||||| || ||||||||| Sbjct: 61 gacacgatccagaacgtcaaggcgaaggtgcaggacaaggaggggatcccgccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || ||||||||| ||||||| || ||||| || || ||||||||| Sbjct: 121 cagcggctcatcttcgccggcaagcagctggaggacgggcgcacgctggccgactacaac 180 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggtacgatgatcaaa 381 || |||||||||||||| || ||| |||| ||| | ||| | ||||| || |||| Sbjct: 181 atccagaaggagtcgacgctgcacctggtgctccgcctccgcggcggcctgaacgtcaag 240 Query: 382 gtcaagactctcactgggaaggagattgaaattgacattgagcccaccgacacgattgac 441 || | ||| ||||| || |||||||| || || ||||| ||| || |||||| | ||| Sbjct: 241 gtgaggacgctcaccggcaaggagatcgacatcgacatcgagatgacggacacggtggac 300 Query: 442 aggatcaaggagcgtgttgaggagaaagaaggcattcctcctgtgcagcaaaggctgatt 501 |||||||||||||| || ||||||| || ||||| || || |||||||| ||||| || Sbjct: 301 aggatcaaggagcgcgtcgaggagagggagggcatcccgcccgtgcagcagaggctcatc 360 Query: 502 tatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatcgaaggtggc 561 || | || ||||||||||| || |||||||| || | |||||||| ||||| | |||| Sbjct: 361 tacggcgggaagcagcttgccgacgacaagacggcgcacgactacaagatcgaggctggc 420 Query: 562 tcggtcctccatcttgtcctcgc 584 || |||||||| || |||||||| Sbjct: 421 tccgtcctccacctcgtcctcgc 443
>emb|X64344.1|PCCUBI41 P.crispum mRNA Pcubi4-1 for polyubiquitin Length = 1592 Score = 202 bits (102), Expect = 1e-48 Identities = 192/222 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||| ||||| || || |||||||| || ||||||||||| || |||||||| ||| Sbjct: 24 aagatgcaaatctttgtgaaaaccctcaccggaaagaccatcactcttgaggtcgaaagc 83 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| |||||||||||||||||||| ||||||||||||||||||||||| || ||| Sbjct: 84 tctgacacaatcgacaacgtcaaggccaagattcaggacaaggaagggattcccccagac 143 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| |||||||| ||||||||||| ||||| | || |||||||||||| Sbjct: 144 cagcagagattgatctttgctggaaagcagttggaagatggcaggactcttgctgactac 203 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 ||||| ||||||||||| ||||| || ||||| ||||||||| Sbjct: 204 aacatccagaaggagtcaactctccatttggtgctcaggctc 245 Score = 135 bits (68), Expect = 3e-28 Identities = 167/200 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| || || ||||| ||||| ||||||||||| ||||| || || ||||| Sbjct: 939 atgcagatttttgtgaagactctcacagggaagaccattacccttgaagtggagagttct 998 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| || |||||||| || ||||| |||||||| || || || |||||| Sbjct: 999 gacaccattgacaatgtgaaggccaagatccaggataaggaaggaatcccaccagaccag 1058 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||||||||| |||||||||||||| ||||| || || | || ||||| ||||||||| Sbjct: 1059 cagcgtttgatctttgctggcaagcaattggaagacggcaggactcttgcagactacaac 1118 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 1119 attcagaaggagtctactct 1138 Score = 107 bits (54), Expect = 6e-20 Identities = 159/194 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| ||||||||||||||| | || || |||||||| || || |||||||| ||| Sbjct: 255 atgcaaatcttcgtcaagaccttgacaggaaagaccattactcttgaggtcgaaagctct 314 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || || || || |||||||| |||||||||||||| || ||||| || |||||| Sbjct: 315 gacacaattgataatgttaaggccaagattcaggacaaggagggaattcccccagaccag 374 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| |||||||| || || | |||||||| | || ||||||||||||||| Sbjct: 375 cagaggttgatctttgctggaaaacaacttgaggatggcaggacccttgctgactacaac 434 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 435 atccagaaggagtc 448 Score = 107 bits (54), Expect = 6e-20 Identities = 159/194 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || || ||||| ||||| || || || |||||| | Sbjct: 483 atgcagatctttgttaagaccttgactggaaagacgatcactcttgaagttgagagctcc 542 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||||||||| || || |||||||||||||| ||||| || |||||| Sbjct: 543 gacaccattgacaacgtcaaggctaagatccaggacaaggaaggaattcccccagaccag 602 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||| | |||||||| | || || || ||||||||| Sbjct: 603 cagaggttgatcttcgctggaaagcaacttgaggatggcaggaccctagccgactacaac 662 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 663 atccagaaggagtc 676 Score = 97.6 bits (49), Expect = 6e-17 Identities = 124/149 (83%) Strand = Plus / Plus Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || ||||| || |||||||| |||||||| ||||| || |||||||| || ||| Sbjct: 1227 gacactattgacaatgtgaaggccaagattcaggataaggagggtattcctccagatcag 1286 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| |||||||| |||||| | ||||||||| | || || ||||| || || Sbjct: 1287 cagaggttgatctttgctggaaagcagctcgaggatggaaggaccctagctgattataat 1346 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| |||||||||||||| Sbjct: 1347 atccagaaggagtctactcttcacttggt 1375 Score = 93.7 bits (47), Expect = 9e-16 Identities = 164/203 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || || ||||| || || || || || |||||| | Sbjct: 711 atgcagatctttgttaagaccttgactggaaagactataactcttgaagttgagagctcc 770 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| |||||||| || || |||||||| ||||| ||||| || |||||| Sbjct: 771 gacaccattgacaatgtcaaggctaagatccaggacaaagaaggcattcccccagaccag 830 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||||||||||||||| ||||| | || || ||||| ||||| Sbjct: 831 cagagattgattttcgctggcaagcagttggaagatggcaggaccctggctgattacaat 890 Query: 322 attcagaaggagtcgactcttca 344 || || ||||| ||||| ||||| Sbjct: 891 atccaaaaggaatcgacccttca 913
>gb|U29158.1|ZMU29158 Zea mays polyubiquitin (MubC5) mRNA, complete cds Length = 1381 Score = 198 bits (100), Expect = 2e-47 Identities = 169/192 (88%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || ||||| |||||||||||||| ||| Sbjct: 255 atgcagatcttcgtcaagaccctcactggaaagactatcaccctcgaggtggagtcttct 314 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||| Sbjct: 315 gacaccatcgacaacgtcaaggccaagatccaggacaaggaggggattcctccggaccag 374 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| ||||||||||||||| | ||||| || ||||| || || ||||||||| Sbjct: 375 cagcgcctgatctttgctggcaagcagctcgaggacgggcgcacgctggccgactacaac 434 Query: 322 attcagaaggag 333 |||||||||||| Sbjct: 435 attcagaaggag 446 Score = 180 bits (91), Expect = 5e-42 Identities = 169/195 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||||||||| ||||| || ||||| |||||||||||||| ||| | Sbjct: 24 aagatgcagatcttcgtcaagactctcactggaaagactatcaccctcgaggtggagtcc 83 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||| ||||||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 84 tctgacaccattgacaacgtcaaggccaagatccaggacaaggaaggcattcccccggac 143 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || |||||||||||| | ||||| || ||||||||||| |||||| Sbjct: 144 cagcagcggctcatcttcgctggcaagcagctcgaggacgggcgcacacttgccgactac 203 Query: 319 aacattcagaaggag 333 ||||| ||||||||| Sbjct: 204 aacatccagaaggag 218 Score = 151 bits (76), Expect = 4e-33 Identities = 163/192 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||| |||||||| ||||| ||| | Sbjct: 711 atgcagatcttcgtgaagacacttactggcaagacgatcacccttgaggtggagtcctcg 770 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 771 gacaccatcgacaatgtcaaggccaagatccaggacaaggagggcattccaccggaccag 830 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| ||||||||||||||| |||||||||| || || || || ||||||||| Sbjct: 831 cagcgcctgatctttgctggcaagcagctggaggatggccgtaccctcgccgactacaac 890 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 891 atccagaaggag 902 Score = 151 bits (76), Expect = 4e-33 Identities = 163/192 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || || |||||||| ||||| ||||| |||||| | Sbjct: 939 atgcagatctttgtgaagaccttgactggcaagaccataaccctggaggttgagagctcc 998 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| ||||| || || |||||||| || || || ||||| |||||| Sbjct: 999 gacaccatcgacaacgtgaaggcgaagatccaggacaaagagggcatccctccagaccag 1058 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| ||||| ||||||||| |||||||||| ||||| || || ||||||||| Sbjct: 1059 cagcgtctgatctttgccggcaagcagctggaggatggccgcaccctagcagactacaac 1118 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 1119 atccagaaggag 1130 Score = 127 bits (64), Expect = 6e-26 Identities = 160/192 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||| |||||||| ||||||||| Sbjct: 483 atgcagatcttcgtgaagactctgactggcaagactatcacccttgaggtcgagtcttct 542 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||| ||||| ||||||||||| || ||||||||||| || || |||||||||||| Sbjct: 543 gataccattgacaatgtcaaggccaagatccaggacaaggagggcatccctccggaccag 602 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||| ||||||||| | ||||| || ||||| ||||| ||||||||| Sbjct: 603 cagcggctcatttttgccggcaagcagctcgaggacgggcgcacgcttgccgactacaac 662 Query: 322 attcagaaggag 333 |||||||||||| Sbjct: 663 attcagaaggag 674
>gb|U77939.1|PVU77939 Phaseolus vulgaris ubiquitin-like protein mRNA, complete cds Length = 1399 Score = 198 bits (100), Expect = 2e-47 Identities = 178/204 (87%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||||| ||||| |||||||| ||||| ||||| |||||| Sbjct: 1040 atgcagattttcgtcaagacccttacgggtaagaccattacccttgaggtggagagctct 1099 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || ||||| ||||||||||||||||| || || || ||||||||| Sbjct: 1100 gacaccatcgacaatgtgaaggcgaaaattcaggacaaggagggcatcccaccggaccag 1159 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || |||||||||||||||||| | || |||||||| |||||| Sbjct: 1160 cagaggttgatctttgcagggaagcagttggaggatggaagaacccttgctgattacaac 1219 Query: 322 attcagaaggagtcgactcttcac 345 |||||||||||||| ||||||||| Sbjct: 1220 attcagaaggagtccactcttcac 1243 Score = 168 bits (85), Expect = 2e-38 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||| || || || |||||||||||||| ||||| |||||| Sbjct: 356 atgcagatctttgtgaagactcttaccggaaagaccatcacccttgaggtggagagctct 415 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 416 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggaattcccccggaccag 475 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| |||||| |||||||||| ||||| || || ||||||||| Sbjct: 476 cagaggttgatcttcgctggaaagcagctggaggatgggcgcaccctcgccgactacaac 535 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||| || || |||||| |||| Sbjct: 536 atccagaaggaatcaacccttcacctggt 564 Score = 153 bits (77), Expect = 1e-33 Identities = 176/209 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||| || || || |||||||||||||||||||| |||||| Sbjct: 584 atgcagatctttgtgaagactcttaccggcaagaccatcaccctcgaggtggagagctct 643 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 644 gacaccatcgacaacgtgaaggccaagatccaggacaaggagggaatacccccggaccag 703 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| || ||| ||||||||||| | || || || ||||| ||| Sbjct: 704 cagaggttgatcttcgctggaaaacagctggaggatggaaggaccctcgccgactataac 763 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| ||||| |||||||| Sbjct: 764 atccagaaggagtcaactctccacttggt 792 Score = 95.6 bits (48), Expect = 2e-16 Identities = 165/204 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||||||||| || ||||| || || || ||||| ||||| Sbjct: 812 atgcagatctttgtgaagaccctcactggtaagactattactcttgaggtggagagttcg 871 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || ||||| || |||||||| || ||||| ||||| || ||||| ||||| ||| Sbjct: 872 gacactattgacaatgtgaaggccaagatccaggataaggagggtattcccccggatcag 931 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||| ||||| |||||| | ||||| || | || ||||||||||| ||| Sbjct: 932 cagaggttgatattcgctgggaagcagcttgaggacgggaggacccttgctgactataac 991 Query: 322 attcagaaggagtcgactcttcac 345 ||||||||||| || || |||||| Sbjct: 992 attcagaaggaatctacccttcac 1015 Score = 54.0 bits (27), Expect = 8e-04 Identities = 54/63 (85%) Strand = Plus / Plus Query: 283 aagcagttggaggatggacgcacacttgctgactacaacattcagaaggagtcgactctt 342 |||||| |||||||||| ||||| || || |||||||||||||| ||||| || || ||| Sbjct: 269 aagcagctggaggatgggcgcaccctcgccgactacaacattcaaaaggaatcaaccctt 328 Query: 343 cac 345 ||| Sbjct: 329 cac 331
>ref|NM_001070042.1| Oryza sativa (japonica cultivar-group) Os09g0483200 (Os09g0483200) mRNA, complete cds Length = 396 Score = 192 bits (97), Expect = 1e-45 Identities = 172/197 (87%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || ||||||||| | ||||| || ||||| ||||||||| Sbjct: 1 atgcagatcttcgtgaagacgctgacggggaagtcgatcacgctggaggtggagagcagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||||||||| || |||||||||||| Sbjct: 61 gacaccatcgacaacgtcaaggccaagatccaggacaaggaaggtatccctccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || || |||||| |||||||||| ||||| || || ||||||||| Sbjct: 121 cagcgcctcatcttcgcggggaagcagctggaggatggccgcaccctggccgactacaac 180 Query: 322 attcagaaggagtcgac 338 || |||||||||||||| Sbjct: 181 atccagaaggagtcgac 197
>emb|AJ879118.2| Capsicum chinense mRNA for polyubiquitin (ubi gene) Length = 969 Score = 192 bits (97), Expect = 1e-45 Identities = 184/213 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||||||||| ||||||||||| ||||| ||||| |||||| | Sbjct: 540 atgcagattttcgtcaagaccctcactgggaagaccattaccctggaggttgagagctcc 599 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||| ||||| |||||||||||||| || ||||| || |||||| Sbjct: 600 gacaccatcgacaatgtcaaagccaagattcaggacaaggagggaattccaccagaccag 659 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| |||||||| |||||| |||||||||| || || |||||||||||||| Sbjct: 660 cagaggttgatctttgctggtaagcagctggaggatgggcgtacccttgctgactacaat 719 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || |||||||| || ||||| ||| | |||||| Sbjct: 720 atccagaaggaatccactctgcaccttgtcctc 752 Score = 159 bits (80), Expect = 2e-35 Identities = 161/188 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| ||||||||||| ||||| ||||| |||||| | Sbjct: 312 atgcagatctttgtcaagaccctcactgggaagaccattaccctggaggttgagagctcc 371 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || ||||| ||||| ||||||||||| || ||||| || |||||| Sbjct: 372 gacaccatcgacaatgtgaaggcgaaaatccaggacaaggagggcattcccccagaccag 431 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || ||||| || || |||||||||||||| ||||| ||||||||||| ||| Sbjct: 432 cagaggcttatttttgcaggaaaacagttggaggatgggcgcacccttgctgactataac 491 Query: 322 attcagaa 329 || ||||| Sbjct: 492 atccagaa 499 Score = 58.0 bits (29), Expect = 5e-05 Identities = 104/129 (80%) Strand = Plus / Plus Query: 205 accatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccagcag 264 ||||| ||||||||||||||||| || ||||| ||||| || || || || ||||||||| Sbjct: 147 accattgacaacgtcaaggccaagatccaggataaggagggcatccccccagaccagcag 206 Query: 265 cgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaacatt 324 | | || ||||| || |||||| | || ||||| || || || || ||||||||||| Sbjct: 207 aggcttatctttgccggaaagcagctagaagatggccgtaccctcgcggactacaacatc 266 Query: 325 cagaaggag 333 ||||||||| Sbjct: 267 cagaaggag 275
>gb|AF184279.1|AF184279 Oryza sativa polyubiquitin (RUBQ1) gene, complete cds Length = 3184 Score = 192 bits (97), Expect = 1e-45 Identities = 196/229 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | Sbjct: 2386 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcg 2445 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || || ||||| || ||||||||||| || || || ||||||||| Sbjct: 2446 gacacgatcgacaatgtgaaagccaagatccaggacaaggagggcatccccccggaccag 2505 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || ||||||||||||||| |||||||||| ||||| ||||| ||||||||| Sbjct: 2506 cagcgtctcatctttgctggcaagcagctggaggatggccgcacccttgccgactacaac 2565 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 2566 atccagaaggagtccaccctccaccttgtgctcaggctcaggggtggta 2614 Score = 176 bits (89), Expect = 8e-41 Identities = 194/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||||||||||||| Sbjct: 2158 atgcagatcttcgtcaagaccttgactggcaagaccatcaccctcgaggtcgagtcgtct 2217 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || || |||||| Sbjct: 2218 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccagaccag 2277 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| ||||||||||||||| Sbjct: 2278 cagcgtctcatcttcgccggcaagcagctggaggatggccgcacccttgctgactacaac 2337 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 2338 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 2386 Score = 170 bits (86), Expect = 5e-39 Identities = 191/226 (84%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 1700 agatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggttgagtcct 1759 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||| Sbjct: 1760 cggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggacc 1819 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||||||| | || || |||||||||||| | |||||||| ||||| || || ||||||| Sbjct: 1820 agcagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactaca 1879 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 |||| ||||||||||| || || ||| | || |||||||||||||| Sbjct: 1880 acatccagaaggagtccaccctccaccttgtgctcaggctcagggg 1925 Score = 167 bits (84), Expect = 7e-38 Identities = 189/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 1930 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 1989 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 1990 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggaccag 2049 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || |||||||||||| Sbjct: 2050 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggctgactacaac 2109 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | || |||||||||||||| Sbjct: 2110 atccagaaggagtccaccctccaccttgtgctcaggctcagggg 2153 Score = 167 bits (84), Expect = 7e-38 Identities = 189/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 2614 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggtcgagtcctcg 2673 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || |||||||| || ||||||||||| || || || ||||||||| Sbjct: 2674 gacacgatcgacaatgtgaaggccaagatccaggacaaggagggtatccccccggaccag 2733 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| | |||||||||||| Sbjct: 2734 cagcgtctcatcttcgccggcaagcagcttgaggatggccgcaccttggctgactacaac 2793 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 2794 atccagaaggagtccacccttcacctggttctcaggctcagggg 2837 Score = 117 bits (59), Expect = 6e-23 Identities = 161/195 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 2841 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 2900 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 2901 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 2960 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| |||||||| |||||| | |||||||| ||||| | || || ||||| Sbjct: 2961 gcagcgtctgatctttgctggtaagcagcttgaggatggccgcaccttggcggattacaa 3020 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 3021 catccagaaggagtc 3035
>gb|AF154647.1| Nicotiana tabacum clone PR32 mRNA sequence Length = 637 Score = 192 bits (97), Expect = 1e-45 Identities = 184/213 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||| Sbjct: 214 atgcagatcttcgtcaaaaccctcaccggcaagaccatcacccttgaggtcgagagttct 273 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||||||||||||||||| ||||| || ||||| || |||||| Sbjct: 274 gacaccatcgacaatgtcaaggccaaaattcaggataaggagggcattcccccagaccag 333 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||| |||||||||||| | |||||||| || || || ||||| |||||| Sbjct: 334 cagaggttgatattcgctggcaagcagctcgaggatggccgtaccctagctgattacaac 393 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || |||||||| ||||| |||||| | |||||| Sbjct: 394 atccagaaggaatcgacccttcaccttgtcctc 426 Score = 85.7 bits (43), Expect = 2e-13 Identities = 148/183 (80%) Strand = Plus / Plus Query: 172 aagaccatcaccctcgaggtcgagagcagcgacaccatcgacaacgtcaaggccaaaatt 231 |||||||| || |||||||| ||||| |||||| ||||||||||| || |||||||| Sbjct: 16 aagaccattactctcgaggttgagagttccgacacaatcgacaacgtaaaagccaaaatc 75 Query: 232 caggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttg 291 |||||||||||||| ||||| || || ||||| | | || || || ||||||||| | Sbjct: 76 caggacaaggaaggaattcccccagatcagcaaaggcttatcttcgccggcaagcagctt 135 Query: 292 gaggatggacgcacacttgctgactacaacattcagaaggagtcgactcttcacttggtc 351 ||||| ||||| || || || || |||||||| ||||||||||| || |||||| | ||| Sbjct: 136 gaggacggacgtaccctagccgattacaacatccagaaggagtctacccttcaccttgtc 195 Query: 352 ctc 354 ||| Sbjct: 196 ctc 198
>gb|DQ246173.1| Zea mays clone 11511 mRNA sequence Length = 935 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| ||||| || |||||||||||||||||||| |||||| Sbjct: 58 aagatgcagatcttcgttaagactctcaccggaaagaccatcaccctcgaggtggagagc 117 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||||| ||||| || ||||| |||||||| || || || || Sbjct: 118 tcggacaccatcgacaacgtcaaagccaagatccaggataaggaaggcatcccccccgat 177 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| || || || |||||||||||||||||||| || || ||||||||| Sbjct: 178 cagcagaggttgatcttcgccggaaagcagttggaggatggacgtactctcgctgactac 237 Query: 319 aacattcagaaggagtcgactcttcacttggt 350 ||||| ||||||||||| ||||| |||||||| Sbjct: 238 aacatccagaaggagtctactctccacttggt 269 Score = 176 bits (89), Expect = 8e-41 Identities = 179/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| ||||||||| | || || ||||||||||| || ||||| ||||| Sbjct: 517 atgcagatctttgtcaagaccttaaccggaaagaccatcacactggaggtggagagttcg 576 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || |||||||||||||| || || |||||||||||||| |||||||||||| Sbjct: 577 gacaccattgataacgtcaaggccaagatccaagacaaggaagggatccctccggaccag 636 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | |||||||| ||||| ||||| ||||||||| Sbjct: 637 cagcgtctcatcttcgctggaaagcagcttgaggatggtcgcacccttgccgactacaac 696 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| ||||| |||||||| Sbjct: 697 attcagaaggagtctactctccacttggt 725 Score = 155 bits (78), Expect = 3e-34 Identities = 174/206 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || ||||| ||||| ||||| || ||||||||||| | Sbjct: 289 atgcagatctttgtcaagacactgacgggaaagacgatcactctagaggtcgagagttcc 348 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || ||||| || || |||| || || |||||||||||||| |||||||||||| Sbjct: 349 gacactattgacaatgtgaaaaccaagatccaagacaaggaagggatccctccggaccag 408 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || ||||| ||||||||| | |||||||| ||||| ||||| ||||||||| Sbjct: 409 cagcgtctcatctttgccggcaagcagcttgaggatggtcgcacccttgccgactacaac 468 Query: 322 attcagaaggagtcgactcttcactt 347 || ||||||||||| ||||| ||||| Sbjct: 469 atccagaaggagtctactctccactt 494
>tpe|BN000705.1| TPA_exp: Vitis vinifera mRNA for ubiquitin-60S ribosomal L40 fusion protein Length = 743 Score = 190 bits (96), Expect = 5e-45 Identities = 165/188 (87%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || ||||| || ||||||||||||||||||||||| || |||| Sbjct: 65 atgcagatcttcgtgaaaaccctaactgggaagaccatcaccctcgaggttgaatccagc 124 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 125 gataccatcgacaatgtcaaggccaagatccaggacaaggaagggattcctccggaccag 184 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| |||||||| |||||| | |||||||| ||||| |||||||| ||||| Sbjct: 185 cagcgactgatctttgctggaaagcagcttgaggatggccgcactcttgctgattacaat 244 Query: 322 attcagaa 329 || ||||| Sbjct: 245 atccagaa 252
>gb|AF361365.1| Oncorhynchus mykiss polyubiquitin mRNA, complete cds Length = 1162 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| || || |||||||||||||| ||||||||| ||| Sbjct: 741 atgcagatcttcgtgaagacccttaccggcaagaccatcaccctggaggtcgagcccagt 800 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| |||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 801 gacaccatcgagaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 860 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| || ||||| |||||| |||| ||||| ||||| || ||||||||||| Sbjct: 861 cagcgcttgatcttcgctggtaagcagctggaagatggtcgcacgctctctgactacaac 920 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||| ||||||| Sbjct: 921 atccagaaggagtccactcttcacctggtcct 952 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 285 atgcagatcttcgtgaagacccttaccggcaagaccatcaccctggaggttgagcccagt 344 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| || || || || |||||| Sbjct: 345 gacaccattgagaatgtgaaggccaagatccaggacaaggagggcatccccccagaccag 404 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| ||||| ||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 405 cagcgcttgatctttgccggcaagcagctggaagatggtcgcactctctccgactacaac 464 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 465 atccagaaggagtc 478 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 513 atgcagatcttcgtgaagacccttaccggcaagaccatcaccctggaggttgagcccagt 572 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| || || || || |||||| Sbjct: 573 gacaccattgagaatgtgaaggccaagatccaggacaaggagggcatccccccagaccag 632 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| ||||| ||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 633 cagcgcttgatctttgccggcaagcagctggaagatggtcgcactctctccgactacaac 692 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 693 atccagaaggagtc 706 Score = 121 bits (61), Expect = 4e-24 Identities = 163/197 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| || || || |||||||||||||| ||||||||| | Sbjct: 54 aagatgcagatctttgtgaagacacttaccggcaagaccatcaccctggaggtcgagccc 113 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 || ||||||||||| || || |||||||| || ||||||||||| || || || || ||| Sbjct: 114 agtgacaccatcgagaatgtgaaggccaagatccaggacaaggagggcatccccccagac 173 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| ||||| || || || |||||| |||| ||||| ||||| || | ||||| Sbjct: 174 cagcagcgcttgatcttcgccggtaagcagctggaagatggtcgcactctctccgactat 233 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 234 aacatccagaaggagtc 250
>gb|AY056295.1| Arabidopsis thaliana At4g05320 mRNA sequence Length = 1637 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1207 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1266 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1267 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1326 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1327 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1386 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1387 atccagaaggagtctactcttcacttggtcct 1418 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 64 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 123 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 124 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 183 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 184 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 243 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 244 aatatccagaaggaatccaccctccacttggtcctcaggctc 285 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 979 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1038 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 1039 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 1098 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 1099 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 1158 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 1159 atccagaaggagtcgacccttcacttggt 1187 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 295 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 354 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 355 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 414 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 415 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 474 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 475 atccagaaggagtccacccttca 497 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 810 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 811 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 870 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 871 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 930 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 931 attcagaaggagtccacacttcacttggtc 960 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 694 gactacaacattcagaaggagtccacactccacttggtc 732
>gb|AY139999.1| Arabidopsis thaliana polyubiquitin UBQ10 (At4g05320) mRNA, complete cds Length = 1815 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1207 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1266 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1267 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1326 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1327 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1386 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1387 atccagaaggagtctactcttcacttggtcct 1418 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 64 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 123 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 124 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 183 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 184 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 243 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 244 aatatccagaaggaatccaccctccacttggtcctcaggctc 285 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 979 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1038 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 1039 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 1098 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 1099 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 1158 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 1159 atccagaaggagtcgacccttcacttggt 1187 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 295 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 354 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 355 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 414 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 415 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 474 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 475 atccagaaggagtccacccttca 497 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 810 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 811 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 870 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 871 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 930 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 931 attcagaaggagtccacacttcacttggtc 960 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 694 gactacaacattcagaaggagtccacactccacttggtc 732
>gb|AY057500.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, complete cds Length = 1319 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 979 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1038 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1039 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1098 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1099 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1158 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1159 atccagaaggagtctactcttcacttggtcct 1190 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 64 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 123 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 124 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 183 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 184 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 243 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 244 aatatccagaaggaatccaccctccacttggtcctcaggctc 285 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 810 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 811 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 870 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 871 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 930 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 931 atccagaaggagtcgacccttcacttggt 959 Score = 127 bits (64), Expect = 6e-26 Identities = 175/212 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 295 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 354 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 355 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 414 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || |||||| |||| ||||| | || | |||||||||||| Sbjct: 415 cagagattgatcttcgccggaaagcagctggaagatggcagaactttggctgactacaac 474 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 |||||||||||||| || ||||| |||||||| Sbjct: 475 attcagaaggagtccacccttcatttggtcct 506 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 523 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 582 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 583 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 642 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 643 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 702 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 703 attcagaaggagtccacacttcacttggtc 732
>gb|AY052698.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, complete cds Length = 1356 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 979 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1038 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1039 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1098 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1099 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1158 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1159 atccagaaggagtctactcttcacttggtcct 1190 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 64 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 123 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 124 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 183 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 184 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 243 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 244 aatatccagaaggaatccaccctccacttggtcctcaggctc 285 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 810 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 811 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 870 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 871 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 930 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 931 atccagaaggagtcgacccttcacttggt 959 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 295 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 354 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 355 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 414 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 415 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 474 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 475 atccagaaggagtccacccttca 497 Score = 91.7 bits (46), Expect = 3e-15 Identities = 124/150 (82%) Strand = Plus / Plus Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || ||||||||||||||| Sbjct: 583 gacaccattgataacgtgaaagccaagatccaggacaaagagggtattcctccggaccag 642 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 643 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 702 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 703 attcagaaggagtccacacttcacttggtc 732
>emb|BX818394.1|CNS0AEC9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL76ZH04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 625 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 353 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 294 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 293 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 234 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 233 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 174 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 173 atccagaaggagtctactcttcacttggtcct 142 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 581 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 522 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 521 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 462 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 461 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 402 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 401 atccagaaggagtcgacccttcacttggt 373
>emb|BX828380.1|CNS0A30T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH81ZH07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1525 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1205 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1264 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1265 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1324 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1325 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1384 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1385 atccagaaggagtctactcttcacttggtcct 1416 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 50 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 109 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 110 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 169 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 170 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 229 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 230 aatatccagaaggaatccaccctccacttggtcctcaggctc 271 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Plus Query: 310 gctgactacaacattcagaaggagtcgactcttcacttggtc 351 |||||||||||||||||||||||||| || ||| |||||||| Sbjct: 914 gctgactacaacattcagaaggagtccacactttacttggtc 955 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 689 gactacaacattcagaaggagtccacactccacttggtc 727 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 316 tacaacattcagaaggagtcgactcttcacttggt 350 |||||||| |||||||||||||| ||||||||||| Sbjct: 1152 tacaacatccagaaggagtcgacccttcacttggt 1186 Score = 48.1 bits (24), Expect = 0.047 Identities = 63/76 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 974 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1033 Query: 202 gacaccatcgacaacg 217 |||||||| ||||||| Sbjct: 1034 gacaccattgacaacg 1049
>emb|BX828308.1|CNS0A2WH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1214 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 925 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 984 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 985 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1044 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1045 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1104 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1105 atccagaaggagtctactcttcacttggtcct 1136 Score = 99.6 bits (50), Expect = 1e-17 Identities = 111/130 (85%), Gaps = 1/130 (0%) Strand = Plus / Plus Query: 206 ccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccagcagc 265 |||||||||||||||||||||| || || ||||| || || |||||||||||||||||| Sbjct: 75 ccatcgacaacgtcaaggccaagatccaagacaaaga-ggtattcctccggaccagcaga 133 Query: 266 gtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaacattc 325 | |||| || || || ||||||||||||||||| | || |||||||||||||| || | Sbjct: 134 ggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaatatcc 193 Query: 326 agaaggagtc 335 |||||||||| Sbjct: 194 agaaggagtc 203 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 469 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 528 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 529 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 588 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 589 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 648 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 649 attcagaaggagtccacacttcacttggtc 678 Score = 97.6 bits (49), Expect = 6e-17 Identities = 169/209 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 697 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 756 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||| || |||| |||||||| || |||||||||||| Sbjct: 757 gacaccattgacaacgtgccccccaagatccaggctaaggaaggaatccctccggaccag 816 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 817 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 876 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 877 atccagaaggagtcgacccttcacttggt 905 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 412 gactacaacattcagaaggagtccacactccacttggtc 450
>emb|BX827035.1|CNS0A37F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB89ZE09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1555 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1203 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1262 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1263 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1322 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1323 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1382 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1383 atccagaaggagtctactcttcacttggtcct 1414 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| | Sbjct: 57 atgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagctcc 116 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| ||| Sbjct: 117 gacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggatcag 176 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || ||||||||| | |||||||| || || | ||||| ||||| Sbjct: 177 cagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattacaat 236 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || |||||||| || || || |||||||||||||||||| Sbjct: 237 atccagaaggaatccaccctccacttggtcctcaggctc 275 Score = 119 bits (60), Expect = 2e-23 Identities = 159/192 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 285 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 344 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 345 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 404 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 405 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 464 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 465 atccagaaggag 476 Score = 67.9 bits (34), Expect = 5e-08 Identities = 118/146 (80%) Strand = Plus / Plus Query: 203 acaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccagc 262 ||||||| || ||||| || ||||| || |||||||| || || || || |||||||||| Sbjct: 803 acaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccagc 862 Query: 263 agcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaaca 322 || | ||||| || || || ||||| | || |||||| | || | ||||||||||||| Sbjct: 863 agagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaaca 922 Query: 323 ttcagaaggagtcgactcttcacttg 348 ||||||||||||| || ||||||||| Sbjct: 923 ttcagaaggagtccacacttcacttg 948 Score = 52.0 bits (26), Expect = 0.003 Identities = 56/66 (84%) Strand = Plus / Plus Query: 233 aggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttgg 292 |||| |||||||| || ||||||||||||||| | ||||| ||||| || || || |||| Sbjct: 1064 aggataaggaaggaatccctccggaccagcagaggttgatctttgccggaaaacaattgg 1123 Query: 293 aggatg 298 |||||| Sbjct: 1124 aggatg 1129 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtc 335 ||||||||||||||||||||||| Sbjct: 685 gactacaacattcagaaggagtc 707
>emb|BX829786.1|CNS0A19O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB37ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1023 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 400 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 341 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 340 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 281 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 280 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 221 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 220 atccagaaggagtctactcttcacttggtcct 189 Score = 97.6 bits (49), Expect = 6e-17 Identities = 169/209 (80%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || || || || || ||||| ||||| | ||||| |||||| Sbjct: 628 atgcagatcttcgtgaaaactctaaccggaaagactatcactttagaggtagagagctct 569 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| | | |||| ||| ||||||| || || |||||||| || |||||||||||| Sbjct: 568 gacaccattgtctacgtgaagaccaaaatccaagataaggaaggaatccctccggaccag 509 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 508 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 449 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 448 atccagaaggagtcgacccttcacttggt 420 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 310 gctgactacaacattcagaaggagtcgactcttcacttggtc 351 |||||||||||||||||||||||||| || |||| ||||||| Sbjct: 688 gctgactacaacattcagaaggagtccacacttctcttggtc 647
>gb|AC012477.1|AC012477 Genomic Sequence For Arabidopsis thaliana Clone C6L9, Chromosome IV, complete sequence Length = 145453 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 57143 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 57084 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 57083 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 57024 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 57023 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 56964 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 56963 atccagaaggagtctactcttcacttggtcct 56932 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 57371 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 57312 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 57311 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 57252 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 57251 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 57192 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 57191 atccagaaggagtcgacccttcacttggt 57163 Score = 137 bits (69), Expect = 7e-29 Identities = 183/221 (82%) Strand = Plus / Minus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 58285 agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagct 58226 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| | Sbjct: 58225 ccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggatc 58166 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | | || || || ||||||||| | |||||||| || || | ||||| |||| Sbjct: 58165 agcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattaca 58106 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctc 360 | || |||||||| || || || |||||||||||||||||| Sbjct: 58105 atatccagaaggaatccaccctccacttggtcctcaggctc 58065 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 58055 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 57996 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 57995 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 57936 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 57935 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 57876 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 57875 atccagaaggagtccacccttca 57853 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 57599 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 57540 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 57539 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 57480 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 57479 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 57420 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 57419 attcagaaggagtccacacttcacttggtc 57390 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 57656 gactacaacattcagaaggagtccacactccacttggtc 57618
>gb|L05361.1|ATHUBQ10R Arabidopsis thaliana polyubiquitin (ubq10) mRNA, complete cds Length = 1577 Score = 190 bits (96), Expect = 5e-45 Identities = 183/212 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1183 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1242 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1243 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1302 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1303 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1362 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1363 atccagaaggagtctactcttcacttggtcct 1394 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 40 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 99 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 100 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 159 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 160 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 219 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 220 aatatccagaaggaatccaccctccacttggtcctcaggctc 261 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 955 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1014 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 1015 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 1074 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 1075 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 1134 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 1135 atccagaaggagtcgacccttcacttggt 1163 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 271 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 330 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 331 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 390 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 391 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 450 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 451 atccagaaggagtccacccttca 473 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 727 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 786 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 787 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 846 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 847 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 906 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 907 attcagaaggagtccacacttcacttggtc 936 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 670 gactacaacattcagaaggagtccacactccacttggtc 708
>gb|DQ445914.1| Gladiolus grandiflorus polyubiquitin (UBQ) gene, promoter region and partial cds Length = 2392 Score = 188 bits (95), Expect = 2e-44 Identities = 185/215 (86%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||| || |||||||||||||| || || || ||||||||||||||||| |||||| Sbjct: 1906 agatgcaaattttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagagct 1965 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||| ||||| || ||||| |||||||| ||||||||||| |||||||||||||||| Sbjct: 1966 ccgacacaatcgataatgtcaaagccaaaatccaggacaaggaggggattcctccggacc 2025 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | | || |||||||| |||||| | |||||||| ||||| ||||| ||||||| Sbjct: 2026 agcagaggctaatctttgctggaaagcagcttgaggatggccgcactcttgccgactaca 2085 Query: 320 acattcagaaggagtcgactcttcacttggtcctc 354 |||| ||||||||||| || ||||| ||||||||| Sbjct: 2086 acatccagaaggagtctacacttcatttggtcctc 2120 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || || |||||||| || |||||||||||| | || || ||||| Sbjct: 2136 atgcagatctttgttaaaaccctcacaggcaagaccatcaccttggaagtggagagttct 2195 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||| ||||||||||||||||| ||||| || ||||| || |||||| Sbjct: 2196 gacaccatcgataacgtgaaggccaaaattcaggataaggagggtattcccccagaccag 2255 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 || | | ||||||||||||||||||||||||||||| ||||| ||||| ||||| ||| Sbjct: 2256 caaaggcttatatttgctggcaagcagttggaggatggccgcacccttgcggactataac 2315 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 2316 atccagaaggagtc 2329
>gb|DQ839402.1| Morus bombycis ubiquitin mRNA, complete cds Length = 448 Score = 186 bits (94), Expect = 8e-44 Identities = 169/194 (87%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || ||||| |||||||||||||| |||||| Sbjct: 1 atgcagatcttcgtgaagaccctcaccggcaagacgatcaccctcgaggttgagagctct 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || || ||||||||||| ||||| || |||||||||||||| || ||||| ||||||||| Sbjct: 61 gatacgatcgacaacgtgaaggcgaagattcaggacaaggagggcattcccccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || ||||| || ||||||||||||||||| ||||| |||||||| ||||| Sbjct: 121 cagcgtctcatctttgcagggaagcagttggaggatggtcgcactcttgctgattacaat 180 Query: 322 attcagaaggagtc 335 |||||||||||||| Sbjct: 181 attcagaaggagtc 194
>gb|AY042884.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 927 Score = 186 bits (94), Expect = 8e-44 Identities = 178/206 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 65 aagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagc 124 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||||||||||| || || |||||||| || |||||||||||| Sbjct: 125 tctgacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggac 184 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| || ||||| ||||||||||||||||| | || |||||||||||| Sbjct: 185 cagcagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactac 244 Query: 319 aacattcagaaggagtcgactcttca 344 ||||| ||||||||||| || ||||| Sbjct: 245 aacatccagaaggagtccacacttca 270 Score = 117 bits (59), Expect = 6e-23 Identities = 179/219 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||| | ||| | || |||||||| || || || || |||||| | Sbjct: 524 atgcagattttcgtgaagcctctccctggaaagaccattactcttgaagttgagagctcc 583 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 584 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 643 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 644 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 703 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 704 atccagaaggagtctacccttcacttggtgctaaggctc 742 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 296 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 355 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 356 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 415 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 416 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 475 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 476 attcagaaggagtctacacttcacttggt 504
>ref|NM_001064913.1| Oryza sativa (japonica cultivar-group) Os06g0681400 (Os06g0681400) mRNA, complete cds Length = 1660 Score = 184 bits (93), Expect = 3e-43 Identities = 195/229 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | Sbjct: 739 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcg 798 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || |||||||| || ||||||||||| || || || ||||||||| Sbjct: 799 gacacgatcgacaatgtgaaggccaagatccaggacaaggagggcatccccccggaccag 858 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| ||||||| || ||||| ||||| ||||||||| Sbjct: 859 cagcgtctcatcttcgctggcaagcagctggaggacggccgcacccttgccgactacaac 918 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 919 atccagaaggagtccaccctccaccttgtgctcaggctcaggggtggta 967 Score = 180 bits (91), Expect = 5e-42 Identities = 193/227 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 52 aagatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggttgagtcc 111 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||| ||||| ||||||||||| || ||||||||||| || || || |||||| Sbjct: 112 tcggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggac 171 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || ||||||||||||||| | |||||||| ||||| || || |||||| Sbjct: 172 cagcagcgtctcatctttgctggcaagcagcttgaggatggccgcaccctggccgactac 231 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| ||||||||||| || || ||| | || |||||||||||||| Sbjct: 232 aacatccagaaggagtccaccctccaccttgtgctcaggctcagggg 278 Score = 174 bits (88), Expect = 3e-40 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 967 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggtcgagtcctcg 1026 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 1027 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggtatccccccggaccag 1086 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || ||||||||| |||||||||| ||||| | |||||||||||| Sbjct: 1087 cagcgcctcatcttcgccggcaagcagctggaggatggccgcaccttggctgactacaac 1146 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 1147 atccagaaggagtccacccttcacctggttctcaggctcagggg 1190 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 511 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 570 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || || |||||| Sbjct: 571 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccagaccag 630 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| ||||||||||||||| Sbjct: 631 cagcgtctcatcttcgccggcaagcagctggaggatggccgcacccttgctgactacaac 690 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 691 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 739 Score = 159 bits (80), Expect = 2e-35 Identities = 188/224 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 283 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 342 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 343 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggaccag 402 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 403 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactacaac 462 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | || |||||||||||||| Sbjct: 463 atccagaaggagtctaccctccaccttgtgctcaggctcagggg 506 Score = 133 bits (67), Expect = 1e-27 Identities = 163/195 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 1194 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 1253 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 1254 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 1313 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| |||||||| |||||| | |||||||| ||||| ||||| || ||||| Sbjct: 1314 gcagcgtctgatctttgctggtaagcagcttgaggatggccgcacccttgcggattacaa 1373 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 1374 catccagaaggagtc 1388
>ref|NM_001056148.1| Oryza sativa (japonica cultivar-group) Os03g0259500 (Os03g0259500) mRNA, complete cds Length = 420 Score = 184 bits (93), Expect = 3e-43 Identities = 180/209 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || |||||||||||||||||||||||||| |||| |||| Sbjct: 1 atgcagatcttcgtgaagacgctgacggggaagaccatcaccctcgaggtggagaacagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||| || ||| ||||||||||||||| || |||||||||||||| || || ||||||||| Sbjct: 61 gacgccgtcgccaacgtcaaggccaagatccaggacaaggaaggtatcccgccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || || |||||| |||||||||| ||||| || || ||||||||| Sbjct: 121 cagcgcctcatcttcgccgggaagcagctggaggatggccgcacgctggccgactacaac 180 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| || |||||| |||| Sbjct: 181 atccagaaggagtccacgcttcacctggt 209
>dbj|AB089616.1| Pongo pygmaeus UbC gene for polyubiquitin C, complete cds Length = 2286 Score = 184 bits (93), Expect = 3e-43 Identities = 183/213 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||| ||| ||| Sbjct: 2052 gatgcagatcttcgtgaagaccctgacaggcaagaccatcaccctcgaggtggagcccag 2111 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || || ||||||||||| |||||||| ||||| Sbjct: 2112 tgacaccatcgagaatgtcaaggcaaagatccaagacaaggaaggcattcctcctgacca 2171 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| || ||| |||| ||||||||||| || |||||||||| Sbjct: 2172 gcagaggttgatctttgctgggaaacagctggaagatggacgcaccctgtctgactacaa 2231 Query: 321 cattcagaaggagtcgactcttcacttggtcct 353 ||| ||||| ||||| ||||| ||||||||||| Sbjct: 2232 catccagaaagagtccactctgcacttggtcct 2264 Score = 157 bits (79), Expect = 7e-35 Identities = 166/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||| ||| ||| Sbjct: 456 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggtggagcccag 515 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| ||||||||||| || || || ||||||||||| |||||||| ||||| Sbjct: 516 tgacaccatcgagaacgtcaaggcaaagatccaagacaaggaaggcattcctcctgacca 575 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||| ||||| ||||| || |||| ||||| Sbjct: 576 gcagaggttgatctttgcgggaaagcagctggaagatggtcgcaccctgtctgattacaa 635 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 636 catccagaaagagtc 650 Score = 149 bits (75), Expect = 2e-32 Identities = 165/195 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| ||||| ||||| || |||||||||||||||||||||||| ||| Sbjct: 1824 gatgcagatcttcgtgaagacactcactggcaagaccatcaccctcgaggtcgagcccag 1883 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||| || || |||||||| || || |||||||||||||| || ||||| ||||| Sbjct: 1884 tgacaccattgagaatgtcaaggcaaagatccaggacaaggaaggcatccctcctgacca 1943 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||| ||||| || || || |||||||||| Sbjct: 1944 gcagaggttgatctttgccggaaagcagctggaagatggtcgtaccctgtctgactacaa 2003 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 2004 catccagaaagagtc 2018 Score = 141 bits (71), Expect = 4e-30 Identities = 164/195 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||| ||| ||| Sbjct: 228 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctcgaggtggagcccag 287 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||| || || |||||||| || || || ||||||||||| |||||||| ||||| Sbjct: 288 tgacaccattgagaatgtcaaggcaaagatccaagacaaggaaggcattcctcctgacca 347 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||| ||||| ||||| || |||| ||||| Sbjct: 348 gcagaggttgatctttgccggaaagcagctggaagatggtcgcaccctgtctgattacaa 407 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 408 catccagaaagagtc 422 Score = 139 bits (70), Expect = 2e-29 Identities = 175/210 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || ||||||||||| |||||||| ||| || Sbjct: 1140 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggtggagcctag 1199 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||| || || ||||||||||| || || || ||||||||||| |||||||| ||||| Sbjct: 1200 tgacactattgagaacgtcaaggcaaagatccaagacaaggaaggcattcctcctgacca 1259 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| || ||| |||| ||||| ||||| || |||||||||| Sbjct: 1260 gcagaggttgatctttgctgggaaacagctggaagatggtcgcaccctgtctgactacaa 1319 Query: 321 cattcagaaggagtcgactcttcacttggt 350 ||| ||||| ||||| ||||| ||| |||| Sbjct: 1320 catccagaaagagtccactctgcacctggt 1349 Score = 133 bits (67), Expect = 1e-27 Identities = 163/195 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| ||||| ||||| || ||||| |||||||| ||||||||| ||| Sbjct: 1368 gatgcagatcttcgtgaagacactcactggcaagactatcacccttgaggtcgagcccag 1427 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || ||||| || || || || ||||||||||| || ||||| ||||| Sbjct: 1428 tgacaccatcgagaatgtcaaagcaaagatccaagacaaggaaggcatccctcctgacca 1487 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||| ||||| ||||| || |||||||||| Sbjct: 1488 gcagaggttgatctttgccggaaagcagctggaagatggtcgcaccctgtctgactacaa 1547 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 1548 catccagaaagagtc 1562 Score = 131 bits (66), Expect = 4e-27 Identities = 174/210 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || ||||||||||| || ||||||||| || Sbjct: 684 gatgcagatcttcgtgaagaccctgactggcaagaccatcactcttgaggtcgagcctag 743 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||| || || ||||||||||| || || ||||||||||| || |||||||| ||||| Sbjct: 744 tgacactattgagaacgtcaaggcaaagatccaggacaaggagggcattcctcctgacca 803 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || || ||| |||| ||||| ||||| || |||||||||| Sbjct: 804 gcagaggttgatctttgccggaaaacagctggaagatggtcgcaccctgtctgactacaa 863 Query: 321 cattcagaaggagtcgactcttcacttggt 350 ||| ||||| ||||| ||||| ||| |||| Sbjct: 864 catccagaaagagtctactctgcacctggt 893 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || |||||||||||||||||||| ||| ||| Sbjct: 1 atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggtggagcccagt 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| || |||||||| || || || || |||||||| || ||||| |||||| Sbjct: 61 gacaccatcgagaatgtcaaggcaaagatccaagataaggaaggcatccctcctgaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || |||||| |||| ||||| ||||| || |||| |||||| Sbjct: 121 cagaggttgatctttgccggaaagcagctggaagatggtcgcaccctgtctgattacaac 180 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 181 atccagaaagagtc 194 Score = 117 bits (59), Expect = 6e-23 Identities = 161/195 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||| ||| ||| Sbjct: 1596 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggtggagcccag 1655 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||| || || |||||||| || || || || |||||||| || ||||| ||||| Sbjct: 1656 tgacaccattgagaatgtcaaggcaaagatccaagataaggaaggcatccctcctgacca 1715 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || || ||| |||| ||||| || || || |||||||||| Sbjct: 1716 gcagaggttgatttttgccgggaaacagctggaagatggtcgtaccctgtctgactacaa 1775 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 1776 catccagaaagagtc 1790 Score = 109 bits (55), Expect = 1e-20 Identities = 160/195 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| ||| Sbjct: 912 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggtagagcccag 971 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 || ||||| || || ||||| || || || ||||||||||| || |||||||| || || Sbjct: 972 tgataccattgagaatgtcaaagcaaagatccaggacaaggagggcattcctcctgatca 1031 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||| | ||||| ||||| || |||||| |||| ||||||||||| || |||||||||| Sbjct: 1032 gcaaaggttgatctttgcgggaaagcagctggaagatggacgcaccctctctgactacaa 1091 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 1092 catccagaaagagtc 1106
>ref|XM_001210780.1| Aspergillus terreus NIH2624 ubiquitin (ATEG_00694) mRNA, complete cds Length = 918 Score = 182 bits (92), Expect = 1e-42 Identities = 173/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| ||||| || ||||||||||| || ||||||||| |||| Sbjct: 1 atgcagatcttcgtcaagactctcaccggcaagaccatcactctagaggtcgagtccagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||| |||| |||||||||||||| || |||||||| |||||| Sbjct: 61 gacaccatcgacaatgtcaagtccaagattcaggacaaggagggtattcctcctgaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || || || || ||| | |||||||| ||||| || | ||||||||| Sbjct: 121 cagcgcctgattttcgcgggtaaacagctcgaggatggccgcactctgtccgactacaac 180 Query: 322 attcagaaggagtcgactct 341 |||||||||||||||||||| Sbjct: 181 attcagaaggagtcgactct 200 Score = 151 bits (76), Expect = 4e-33 Identities = 178/212 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| ||||||||||||||||| || || |||||||||||||| ||||||||| |||| Sbjct: 229 atgcaaatcttcgtcaagaccctgactggcaagaccatcaccctggaggtcgagtccagc 288 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||||||| | || || ||||| |||||||| || ||||| || ||| Sbjct: 289 gacaccatcgataacgtcaagtcgaagatccaggataaggaaggtatccctcccgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || ||||| |||||| ||||||| || || || || | ||||||||| Sbjct: 349 cagcgcctgatcttcgctggtaagcagctggaggacggtcgtaccctgtccgactacaac 408 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || |||||||| || || |||||||||||||| Sbjct: 409 atccagaaggaatccacccttcacttggtcct 440 Score = 111 bits (56), Expect = 4e-21 Identities = 173/212 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||| ||||| || | | Sbjct: 457 atgcagatcttcgtcaagaccctgaccggaaagaccatcaccctggaggtggaatcctcc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||||||| | || ||||| |||||||| || || || || |||||| Sbjct: 517 gacacgatcgacaacgtcaagtctaagattcaagacaaggagggcatcccgcccgaccag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || || ||||||||| | || ||||| ||||| || | || |||||| Sbjct: 577 cagcgtctgatcttcgccggcaagcagcttgaagatggccgcaccctctccgattacaac 636 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||| ||||| || || ||| ||||||| Sbjct: 637 atccagaaagagtctaccctgcacctggtcct 668 Score = 111 bits (56), Expect = 4e-21 Identities = 158/192 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||| |||||||| || ||||||||||| | || || || ||| Sbjct: 685 atgcagattttcgtcaaaaccctcaccggaaagaccatcacattggaagtagaaagctcg 744 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||||||| |||| || ||||||||||| || ||||| || |||||| Sbjct: 745 gacacgatcgacaacgtcaagtccaagatccaggacaaggagggcattcccccagaccag 804 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| |||| ||||| ||||| || | ||||||||| Sbjct: 805 cagcgtctcatcttcgctggtaagcagctggaagatggtcgcacgctctcggactacaac 864 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 865 atccagaaggag 876
>ref|NM_001070044.1| Oryza sativa (japonica cultivar-group) Os09g0483400 (Os09g0483400) mRNA, complete cds Length = 781 Score = 182 bits (92), Expect = 1e-42 Identities = 173/200 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| || ||||||||||| ||||| || ||||| |||||| Sbjct: 76 aagatgcagatcttcgtgaagacgctgacggggaagacgatcacgctggaggtggagagc 135 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||||||||||||||| || |||||||||||||| || || |||||| Sbjct: 136 agcgacaccatcgacaacgtcaaggccaagatccaggacaaggaaggtatcccgccggac 195 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || || |||||| |||| || || ||||| || || |||||| Sbjct: 196 cagcagcgcctcatcttcgccgggaagcagctggatgacggccgcaccctggccgactac 255 Query: 319 aacattcagaaggagtcgac 338 ||||| |||||||||||||| Sbjct: 256 aacatccagaaggagtcgac 275
>gb|BT016665.1| Zea mays clone Contig498 mRNA sequence Length = 1012 Score = 182 bits (92), Expect = 1e-42 Identities = 167/192 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || ||||| |||||||||||||| ||| Sbjct: 307 atgcagatcttcgtcaagaccctcactggaaagactatcaccctcgaggtggagtcttct 366 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || |||||||||||| Sbjct: 367 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccctccggaccag 426 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| ||||||||||||||| |||||||||| || || || || ||||||||| Sbjct: 427 cagcgcctgatctttgctggcaagcagctggaggatggccgtaccctcgccgactacaac 486 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 487 atccagaaggag 498 Score = 180 bits (91), Expect = 5e-42 Identities = 169/195 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||||||||| ||||| || ||||| |||||||||||||| ||| | Sbjct: 76 aagatgcagatcttcgtcaagactctcactggaaagactatcaccctcgaggtggagtcc 135 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||| ||||||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 136 tctgacaccattgacaacgtcaaggccaagatccaggacaaggaaggcattcccccggac 195 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || |||||||||||| | ||||| || ||||||||||| |||||| Sbjct: 196 cagcagcggctcatcttcgctggcaagcagctcgaggacgggcgcacacttgccgactac 255 Query: 319 aacattcagaaggag 333 ||||| ||||||||| Sbjct: 256 aacatccagaaggag 270 Score = 135 bits (68), Expect = 3e-28 Identities = 161/192 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || || |||||||| ||||| ||||| |||||| | Sbjct: 535 atgcagatctttgtgaagaccttgactggcaagaccataaccctggaggttgagagctcc 594 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| ||||| || || |||||||| || || || || || |||||| Sbjct: 595 gacaccatcgacaacgtgaaggcgaagatccaggacaaagagggcatccccccagaccag 654 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || || ||||||||| |||||||||| ||||| || || ||||||||| Sbjct: 655 cagcgtctgatcttcgccggcaagcagctggaggatggccgcaccctagcagactacaac 714 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 715 atccagaaggag 726
>gb|DQ097725.1| Arachis hypogaea ubiquitin fusion protein mRNA, complete cds Length = 606 Score = 182 bits (92), Expect = 1e-42 Identities = 173/200 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| || ||||| |||||||||||||||||||| ||||| || Sbjct: 50 aagatgcagatcttcgtgaaaaccctaacggggaagaccatcaccctggaggtggaatct 109 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 || ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||| Sbjct: 110 agtgacaccatcgataacgtcaaggccaagattcaggacaaggaagggattccgccggac 169 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| || || || |||||| | |||||||| || ||||| || || ||| Sbjct: 170 cagcagaggttgatcttcgccggaaagcagcttgaggatggccgtacactcgccgattac 229 Query: 319 aacattcagaaggagtcgac 338 |||||||| ||||||||||| Sbjct: 230 aacattcaaaaggagtcgac 249
>emb|CR695211.2|CNS0FZDJ Tetraodon nigroviridis full-length cDNA Length = 795 Score = 182 bits (92), Expect = 1e-42 Identities = 173/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||||||||||| |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtcaaggccaaaatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 153 bits (77), Expect = 1e-33 Identities = 164/193 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagt 334 || |||||||||| Sbjct: 638 atccagaaggagt 650 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150
>dbj|AK103890.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033150D17, full insert sequence Length = 783 Score = 182 bits (92), Expect = 1e-42 Identities = 173/200 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| || ||||||||||| ||||| || ||||| |||||| Sbjct: 77 aagatgcagatcttcgtgaagacgctgacggggaagacgatcacgctggaggtggagagc 136 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||||||||||||||| || |||||||||||||| || || |||||| Sbjct: 137 agcgacaccatcgacaacgtcaaggccaagatccaggacaaggaaggtatcccgccggac 196 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || || |||||| |||| || || ||||| || || |||||| Sbjct: 197 cagcagcgcctcatcttcgccgggaagcagctggatgacggccgcaccctggccgactac 256 Query: 319 aacattcagaaggagtcgac 338 ||||| |||||||||||||| Sbjct: 257 aacatccagaaggagtcgac 276
>gb|U37687.1|OSU37687 Oryza sativa polyubiquitin (Rubq1) mRNA, complete cds Length = 1679 Score = 182 bits (92), Expect = 1e-42 Identities = 191/224 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | Sbjct: 738 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcg 797 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || || ||||| || ||||||||||| || || || ||||||||| Sbjct: 798 gacacgatcgacaatgtgaaagccaagatccaggacaaggagggtatccccccggaccag 857 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| | |||||||||||| Sbjct: 858 cagcgtctcatcttcgccggcaagcagctggaggatggccgcaccttggctgactacaac 917 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 918 atccagaaggagtccacccttcacctggtactcaggctcagggg 961 Score = 180 bits (91), Expect = 5e-42 Identities = 193/227 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 51 aagatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggttgagtcc 110 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||| ||||| ||||||||||| || ||||||||||| || || || |||||| Sbjct: 111 tcggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggac 170 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || |||||||||||| | |||||||| ||||| || || |||||| Sbjct: 171 cagcagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactac 230 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| ||||||||||| || || ||| | ||||||||||||||||| Sbjct: 231 aacatccagaaggagtccaccctccaccttgtcctcaggctcagggg 277 Score = 176 bits (89), Expect = 8e-41 Identities = 194/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||||||||||||| Sbjct: 510 atgcagatcttcgtcaagaccttgactggcaagaccatcaccctcgaggtcgagtcgtct 569 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || || |||||| Sbjct: 570 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccagaccag 629 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| ||||||||||||||| Sbjct: 630 cagcgtctcatcttcgccggcaagcagctggaggatggccgcacccttgctgactacaac 689 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 690 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 738 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 282 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 341 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 342 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggaccag 401 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || |||||||||||| Sbjct: 402 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggctgactacaac 461 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 462 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 510 Score = 153 bits (77), Expect = 1e-33 Identities = 188/225 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 965 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 1024 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 1025 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 1084 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || || || ||||||||| |||||||||| ||||| | ||||||||||| Sbjct: 1085 gcagcgtctcatcttcgccggcaagcagctggaggatggccgcaccttggctgactacaa 1144 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 1145 catccagaaggagtccacccttcacctggttctcaggctcagggg 1189 Score = 123 bits (62), Expect = 1e-24 Identities = 176/214 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 1193 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 1252 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 1253 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 1312 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| |||||||| |||||| | |||||||| ||||| | || || ||||| Sbjct: 1313 gcagcgtctgatctttgctggtaagcagcttgaggatggccgcaccttggcggattacaa 1372 Query: 321 cattcagaaggagtcgactcttcacttggtcctc 354 ||| ||||||||||| || || ||| |||||||| Sbjct: 1373 catccagaaggagtccacactccacctggtcctc 1406
>gb|DQ249171.1| Lotus corniculatus var. japonicus ubiquitin mRNA, complete cds Length = 1380 Score = 180 bits (91), Expect = 5e-42 Identities = 193/227 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||||||||| || ||||||||||| ||||||||||||||| Sbjct: 43 aagatgcagatcttcgtgaagaccctcaccggaaagaccatcactctcgaggtcgagagc 102 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| ||||| || || ||||| ||||| |||||||| |||||| Sbjct: 103 tccgacaccatcgacaacgttaaggcaaagatccaggataaggaggggattcccccggac 162 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| || || || |||||| | |||||||| || || || || |||||| Sbjct: 163 cagcagaggttgatcttcgccggaaagcagcttgaggatggtcgtaccctcgccgactac 222 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| ||||||||||| || || ||| | |||||| | |||||||| Sbjct: 223 aacatccagaaggagtcaaccctccaccttgtcctccgtctcagggg 269 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||| |||||| Sbjct: 502 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggttgagagctct 561 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||||||||| || || || |||||||| || || || ||||||||| Sbjct: 562 gacaccatcgacaacgtcaaggctaagatccaagacaaggagggaatccccccggaccag 621 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| ||||||||| | |||||||| ||||| ||||||||||||||| Sbjct: 622 cagaggttgatctttgccggcaagcagctcgaggatggtcgcacccttgctgactacaac 681 Query: 322 attcagaaggagtcgactcttcac 345 || |||||||| || || |||||| Sbjct: 682 atccagaaggaatctacccttcac 705 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || || |||||||| ||||| ||||| |||||| | Sbjct: 958 atgcagatctttgtgaagaccttgactggtaagaccattaccctggaggtggagagctcc 1017 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||| |||||||| ||||| |||||||| ||||||||||| || || ||||||||| Sbjct: 1018 gataccattgacaacgtgaaggcaaaaattcaagacaaggaaggtatcccaccggaccag 1077 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || |||||||||||||||||| | || ||||||||||||||| Sbjct: 1078 cagaggttgatctttgcagggaagcagttggaggatggaaggacccttgctgactacaac 1137 Query: 322 attcagaaggagtcgactcttcac 345 |||||||||||||| || |||||| Sbjct: 1138 attcagaaggagtccacccttcac 1161 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || ||||||||||||||||||||||| ||| Sbjct: 274 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtcgaaagctct 333 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || |||||||||||||| || || ||||||||||| || ||||| ||||| ||| Sbjct: 334 gacactattgacaacgtcaaggctaagatccaggacaaggagggaattcccccggatcag 393 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || ||||||||| | |||||||| ||||| | || ||||||||| Sbjct: 394 cagaggttgatcttcgccggcaagcagctcgaggatggtcgcaccttggccgactacaac 453 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 454 atccagaaggagtc 467 Score = 109 bits (55), Expect = 1e-20 Identities = 166/203 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| | || || ||||||||||| || ||||| |||||| Sbjct: 730 atgcagattttcgtgaagactttgactggtaagaccatcactcttgaggtggagagctct 789 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || ||||| ||||| || ||||| ||||| ||| Sbjct: 790 gacaccattgacaacgtgaaggctaagatccaggataaggagggtattcccccggatcag 849 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| |||||||| |||||| | ||||||||| | || ||||| || |||||| Sbjct: 850 cagaggttgatttttgctggtaagcagctcgaggatggaaggactcttgcggattacaac 909 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 910 atccagaaggagtccacccttca 932
>gb|BT016508.1| Zea mays clone Contig341 mRNA sequence Length = 658 Score = 180 bits (91), Expect = 5e-42 Identities = 178/207 (85%) Strand = Plus / Minus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 584 aagatgcagatcttcgtgaagaccctgacgggaaagaccatcaccctcgaggtcgagagc 525 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| || |||||||| ||||||||||| || |||||||||||||| || || |||||| Sbjct: 524 agcgatacaatcgacaatgtcaaggccaagatccaggacaaggaaggtatcccgccggac 465 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || || |||||| | || || || ||||| || || |||||| Sbjct: 464 cagcagcgactaatcttcgcggggaagcagcttgaagacggccgcaccctggccgactac 405 Query: 319 aacattcagaaggagtcgactcttcac 345 ||||| ||||||||||| || |||||| Sbjct: 404 aacatccagaaggagtccacccttcac 378
>gb|DQ122773.1| Medicago sativa clone MH5 pentameric polyubiquitin mRNA, partial cds Length = 571 Score = 180 bits (91), Expect = 5e-42 Identities = 166/191 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| |||||||| |||||||| ||||| || ||| | Sbjct: 69 atgcagatcttcgttaagaccctcacagggaagactatcacccttgaggttgaaagctcc 128 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| || ||||| || |||||||||||||| ||||||||||||||| Sbjct: 129 gacaccatcgacaacgtgaaagccaagatccaggacaaggaaggtattcctccggaccag 188 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || |||||| | ||||| || ||||| ||||||||||||||| Sbjct: 189 cagaggttgatcttcgccggaaagcagcttgaggacggccgcacccttgctgactacaac 248 Query: 322 attcagaagga 332 || |||||||| Sbjct: 249 atccagaagga 259 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||| ||||| || || Sbjct: 297 atgcagatcttcgtcaagacccttaccggcaagaccatcacccttgaggtggaaagttct 356 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || |||||||| ||||| ||||| || |||||| Sbjct: 357 gacaccattgacaatgtcaaggccaagatccaggacaaagaaggaattcccccagaccag 416 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || ||||| ||||||||||| || ||| | || || ||||| |||||| Sbjct: 417 cagaggcttatcttcgctggaaagcagttggaagacggaaggaccctagctgattacaac 476 Query: 322 attcagaagga 332 ||||||||||| Sbjct: 477 attcagaagga 487
>emb|AJ697758.1| Eucalyptus globulus subsp. globulus partial mRNA for putative polyubiquitin Length = 228 Score = 180 bits (91), Expect = 5e-42 Identities = 115/123 (93%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || ||||||||||||||||||||||||||| | Sbjct: 67 atgcagatcttcgtcaagaccctcaccggcaagaccatcaccctcgaggtcgagagctcc 126 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||||||||| ||||| ||||||||| Sbjct: 127 gacaccatcgacaacgtcaaggccaagatccaggacaaggaaggaattcccccggaccag 186 Query: 262 cag 264 ||| Sbjct: 187 cag 189
>dbj|AK121590.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037P03, full insert sequence Length = 1983 Score = 180 bits (91), Expect = 5e-42 Identities = 193/227 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 69 aagatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggttgagtcc 128 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||| ||||| ||||||||||| || ||||||||||| || || || |||||| Sbjct: 129 tcggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggac 188 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || ||||||||||||||| | |||||||| ||||| || || |||||| Sbjct: 189 cagcagcgtctcatctttgctggcaagcagcttgaggatggccgcaccctggccgactac 248 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| ||||||||||| || || ||| | || |||||||||||||| Sbjct: 249 aacatccagaaggagtccaccctccaccttgtgctcaggctcagggg 295 Score = 174 bits (88), Expect = 3e-40 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 1212 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggtcgagtcctcg 1271 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 1272 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggtatccccccggaccag 1331 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || ||||||||| |||||||||| ||||| | |||||||||||| Sbjct: 1332 cagcgcctcatcttcgccggcaagcagctggaggatggccgcaccttggctgactacaac 1391 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 1392 atccagaaggagtccacccttcacctggttctcaggctcagggg 1435 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 528 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 587 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || || |||||| Sbjct: 588 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccagaccag 647 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| ||||||||||||||| Sbjct: 648 cagcgtctcatcttcgccggcaagcagctggaggatggccgcacccttgctgactacaac 707 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 708 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 756 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | Sbjct: 756 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcg 815 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 816 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggcatccccccggaccag 875 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| ||||||| || ||||| ||||| ||||||||| Sbjct: 876 cagcgtctcatcttcgccggcaagcagctggaggacggccgcacccttgccgactacaac 935 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || |||||||| || || || ||| | || || ||||||||||| |||| Sbjct: 936 atccagaaggaatccaccctccaccttgtgcttaggctcaggggaggta 984 Score = 161 bits (81), Expect = 5e-36 Identities = 192/229 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 984 atgcagatcttcgtcaagaccctgactggcaagaccatcacacttgaggtcgagtcctcg 1043 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || |||||||| || ||||||||||| || || || ||||||||| Sbjct: 1044 gacacgatcgacaatgtgaaggccaagatccaggacaaggagggcatccccccggaccag 1103 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| ||||||| || ||||| ||||| ||||||||| Sbjct: 1104 cagcgtctcatcttcgctggcaagcagctggaggacggccgcacccttgccgactacaac 1163 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 | ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 1164 gtccagaaggagtccaccctccaccttgtgctcaggctcaggggtggta 1212 Score = 159 bits (80), Expect = 2e-35 Identities = 188/224 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 300 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 359 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 360 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggaccag 419 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 420 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactacaac 479 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | || |||||||||||||| Sbjct: 480 atccagaaggagtctaccctccaccttgtgctcaggctcagggg 523 Score = 125 bits (63), Expect = 2e-25 Identities = 162/195 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||| ||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 1439 gatgcagatattcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 1498 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 1499 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 1558 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| |||||||| |||||| | |||||||| ||||| ||||| || ||||| Sbjct: 1559 gcagcgtctgatctttgctggtaagcagcttgaggatggccgcacccttgcggattacaa 1618 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 1619 catccagaaggagtc 1633
>gb|BT001165.1| Arabidopsis thaliana Unknown protein (At4g02890) mRNA, complete cds Length = 787 Score = 180 bits (91), Expect = 5e-42 Identities = 175/203 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 1 atgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagctct 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 61 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 121 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 180 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 181 atccagaaggagtccacacttca 203 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 457 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 517 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 577 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 636 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 637 atccagaaggagtctacccttcacttggtgctaaggctc 675 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 229 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 288 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 289 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 349 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 408 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 409 attcagaaggagtctacacttcacttggt 437
>gb|DQ245348.1| Zea mays clone 14644 mRNA sequence Length = 659 Score = 178 bits (90), Expect = 2e-41 Identities = 177/206 (85%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||||||||||||| ||||| || || || ||||| |||||||||||||||||||| ||| Sbjct: 23 gagaagatgcagatattcgtgaaaacgctaacgggcaagaccatcaccctcgaggtggag 82 Query: 196 agcagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccg 255 |||||||||||||||||||| ||||||||||| || |||||||| ||||| || |||||| Sbjct: 83 agcagcgacaccatcgacaatgtcaaggccaagatccaggacaaagaaggaatccctccg 142 Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 || |||||| | |||||||| || || |||||| | || ||||| || || || |||||| Sbjct: 143 gatcagcagaggttgatattcgccggaaagcagcttgaagatggtcgtaccctggctgac 202 Query: 316 tacaacattcagaaggagtcgactct 341 |||||||| ||||| |||| |||||| Sbjct: 203 tacaacatccagaaagagtggactct 228
>gb|DQ887087.1| Arachis hypogaea ubiquitin/ribosomal protein S27a mRNA, complete cds Length = 665 Score = 178 bits (90), Expect = 2e-41 Identities = 168/194 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| || ||||| |||||||||||||||||||||||||| ||| Sbjct: 47 aagatgcagatcttcgtgaaaaccctaacggggaagaccatcaccctcgaggtggagtct 106 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||||||||||||| || |||||||||||||| || || |||||| Sbjct: 107 tccgacaccatcgacaacgtcaaggccaagatccaggacaaggaaggcatcccaccggac 166 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 167 cagcagcgtctcatcttcgccggcaagcagctcgaggatggtcgcaccctcgccgactac 226 Query: 319 aacattcagaagga 332 ||||| |||||||| Sbjct: 227 aacatccagaagga 240
>ref|NM_178960.1| Arabidopsis thaliana UBQ14; protein binding (UBQ14) mRNA, complete cds Length = 975 Score = 178 bits (90), Expect = 2e-41 Identities = 177/206 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 66 aagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagc 125 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || || |||||||| || |||||||||||| Sbjct: 126 tctgacaccatcgacaacgttaaggccaagatccaagacaaggagggtattcctccggac 185 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| || ||||| ||||||||||||||||| | || |||||||||||| Sbjct: 186 cagcagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactac 245 Query: 319 aacattcagaaggagtcgactcttca 344 ||||| ||||||||||| || ||||| Sbjct: 246 aacatccagaaggagtccacacttca 271 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 525 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 584 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 585 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 644 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 645 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 704 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 705 atccagaaggagtctacccttcacttggtgctaaggctc 743 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 297 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 356 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 357 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 416 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 417 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 476 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 477 attcagaaggagtctacacttcacttggt 505
>emb|CR731853.1|CNS0GRN6 Tetraodon nigroviridis full-length cDNA Length = 877 Score = 178 bits (90), Expect = 2e-41 Identities = 168/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || |||||||||||||||||||| ||| |||| Sbjct: 527 atgcagatcttcgtcaagaccctcactggcaagaccatcaccctcgaggtggagcccagc 586 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 587 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 646 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 647 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 706 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 707 atccagaaggagtc 720 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 299 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 358 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 359 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 418 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 419 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 478 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 479 atccagaaggagtc 492 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 71 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 130 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||| ||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 131 gacatcattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 190 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| ||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 191 cagaggctgatctttgccggcaagcagcttgaagatggccgcaccctgtccgactacaac 250 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 251 atccagaaggagtc 264 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 398 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 455 Score = 52.0 bits (26), Expect = 0.003 Identities = 50/58 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||| ||||||||||||| ||||| Sbjct: 170 gaaggcattccccctgatcagcagaggctgatctttgccggcaagcagcttgaagatg 227 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 626 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 675
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6 Length = 30731886 Score = 178 bits (90), Expect = 2e-41 Identities = 192/226 (84%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 28018930 agatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggttgagtcct 28018989 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||| Sbjct: 28018990 cggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggacc 28019049 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||||||| | || ||||||||||||||| | |||||||| ||||| || || ||||||| Sbjct: 28019050 agcagcgtctcatctttgctggcaagcagcttgaggatggccgcaccctggccgactaca 28019109 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 |||| ||||||||||| || || ||| | || |||||||||||||| Sbjct: 28019110 acatccagaaggagtccaccctccaccttgtgctcaggctcagggg 28019155 Score = 174 bits (88), Expect = 3e-40 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 28020072 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggtcgagtcctcg 28020131 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 28020132 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggtatccccccggaccag 28020191 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || ||||||||| |||||||||| ||||| | |||||||||||| Sbjct: 28020192 cagcgcctcatcttcgccggcaagcagctggaggatggccgcaccttggctgactacaac 28020251 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 28020252 atccagaaggagtccacccttcacctggttctcaggctcagggg 28020295 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 28019388 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 28019447 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || || |||||| Sbjct: 28019448 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccagaccag 28019507 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| ||||||||||||||| Sbjct: 28019508 cagcgtctcatcttcgccggcaagcagctggaggatggccgcacccttgctgactacaac 28019567 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 28019568 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 28019616 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | Sbjct: 28019616 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcg 28019675 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 28019676 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggcatccccccggaccag 28019735 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| ||||||| || ||||| ||||| ||||||||| Sbjct: 28019736 cagcgtctcatcttcgccggcaagcagctggaggacggccgcacccttgccgactacaac 28019795 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || |||||||| || || || ||| | || || ||||||||||| |||| Sbjct: 28019796 atccagaaggaatccaccctccaccttgtgcttaggctcaggggaggta 28019844 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 28019844 atgcagatcttcgtcaagaccctgactggcaagaccatcacacttgaggtcgagtcctcg 28019903 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || |||||||| || ||||||||||| || || || ||||||||| Sbjct: 28019904 gacacgatcgacaatgtgaaggccaagatccaggacaaggagggcatccccccggaccag 28019963 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| ||||||| || ||||| ||||| ||||||||| Sbjct: 28019964 cagcgtctcatcttcgctggcaagcagctggaggacggccgcacccttgccgactacaac 28020023 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 28020024 atccagaaggagtccaccctccaccttgtgctcaggctcaggggtggta 28020072 Score = 163 bits (82), Expect = 1e-36 Identities = 172/202 (85%) Strand = Plus / Plus Query: 290 tggaggatggacgcacacttgctgactacaacattcagaaggagtcgactcttcacttgg 349 |||| |||||||| ||| | ||||| |||||||||||||| ||||| || || || |||| Sbjct: 26203843 tggaagatggacgtacattagctgattacaacattcagaaagagtcaacgctccatttgg 26203902 Query: 350 tcctcaggctcaggggcggtacgatgatcaaagtcaagactctcactgggaaggagattg 409 |||| ||||||||||| || || |||||||| || ||||| |||||||||||||| || | Sbjct: 26203903 tcctgaggctcaggggtggaaccatgatcaaggtgaagacactcactgggaaggaaatcg 26203962 Query: 410 aaattgacattgagcccaccgacacgattgacaggatcaaggagcgtgttgaggagaaag 469 | || |||||||||||||| || || ||||| || ||||||||||||||||||||||||| Sbjct: 26203963 agatcgacattgagcccactgataccattgatagaatcaaggagcgtgttgaggagaaag 26204022 Query: 470 aaggcattcctcctgtgcagca 491 | || ||||| ||||| ||||| Sbjct: 26204023 agggtattccacctgttcagca 26204044 Score = 159 bits (80), Expect = 2e-35 Identities = 188/224 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 28019160 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 28019219 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 28019220 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggaccag 28019279 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 28019280 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactacaac 28019339 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | || |||||||||||||| Sbjct: 28019340 atccagaaggagtctaccctccaccttgtgctcaggctcagggg 28019383 Score = 133 bits (67), Expect = 1e-27 Identities = 163/195 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 28020299 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 28020358 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 28020359 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 28020418 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| |||||||| |||||| | |||||||| ||||| ||||| || ||||| Sbjct: 28020419 gcagcgtctgatctttgctggtaagcagcttgaggatggccgcacccttgcggattacaa 28020478 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 28020479 catccagaaggagtc 28020493 Score = 131 bits (66), Expect = 4e-27 Identities = 81/86 (94%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 26202053 atgcagatcttcgtgaagacgctgacggggaagaccatcactctcgaggtcgagagcagc 26202112 Query: 202 gacaccatcgacaacgtcaaggccaa 227 |||||||||||||| ||||||||||| Sbjct: 26202113 gacaccatcgacaatgtcaaggccaa 26202138 Score = 119 bits (60), Expect = 2e-23 Identities = 162/196 (82%) Strand = Plus / Minus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || |||||||||||||||||||| ||| | Sbjct: 27575676 agatgcagatctttgtgaagacactcactggcaagaccatcaccctcgaggttgagtcct 27575617 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 || || || ||||| || |||||||| |||||||||||||| || ||||| || |||| Sbjct: 27575616 ctgatacaattgacaatgtgaaggccaagattcaggacaaggagggcattccacctgacc 27575557 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||| ||| | || |||||||||||||| | |||||||| ||||| || || || |||| Sbjct: 27575556 agcaacgtctcatctttgctggcaagcaactagaggatggccgcaccctcgcggattaca 27575497 Query: 320 acattcagaaggagtc 335 |||| ||||||||||| Sbjct: 27575496 acatccagaaggagtc 27575481 Score = 115 bits (58), Expect = 2e-22 Identities = 160/194 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || || ||||||||||| || | ||||||| | Sbjct: 27575446 atgcagatctttgtgaagaccttgacaggaaagaccatcactcttgcggtcgagtcctcg 27575387 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||| |||||||| || ||||| || |||||||||||||| || ||||| ||||||||| Sbjct: 27575386 gacaagatcgacaatgtgaaggcgaagattcaggacaaggagggaattcccccggaccag 27575327 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||| | ||||||| | ||||||||||| ||||| ||||| |||||| Sbjct: 27575326 cagcgcctcatctttgcagacaagcagctcgaggatggacgtacactggctgattacaac 27575267 Query: 322 attcagaaggagtc 335 |||||||||||||| Sbjct: 27575266 attcagaaggagtc 27575253 Score = 97.6 bits (49), Expect = 6e-17 Identities = 91/105 (86%) Strand = Plus / Plus Query: 493 aggctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatc 552 ||||| ||||||||||| ||||| ||||| ||||| || ||||||||||| |||||||| Sbjct: 26204143 aggctcatttatgctgggaagcaacttgctgatgataaaactgccaaggattacaacatt 26204202 Query: 553 gaaggtggctcggtcctccatcttgtcctcgccctgaggggtggt 597 ||||||||||| || |||||||| || || || |||||||||||| Sbjct: 26204203 gaaggtggctcagtgctccatctcgtgcttgctctgaggggtggt 26204247
>emb|X04133.1|HVUBIQR Barley mRNA for ubiquitin polyprecursor fragment Length = 703 Score = 178 bits (90), Expect = 2e-41 Identities = 186/218 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| ||||| ||||||||||| || ||||| ||| | Sbjct: 55 atgcagatcttcgtgaagaccctgacgggcaagaccatcacactggaggtggagtcctct 114 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||||||||| || || ||||||||||| || || |||||||||||| Sbjct: 115 gacaccatcgacaacgtcaaggcgaagatccaggacaaggagggcatccctccggaccag 174 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| | |||||||| ||||| || |||||||| ||| Sbjct: 175 cagcgcctcatctttgctggcaagcagctcgaggatggccgcaccctggctgactataac 234 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggct 359 || ||||||||||| ||||| ||| |||| |||||||| Sbjct: 235 atccagaaggagtccactctccacctggtgctcaggct 272 Score = 145 bits (73), Expect = 3e-31 Identities = 175/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||||||||| || ||||||||||| || ||||| ||| | Sbjct: 283 atgcagattttcgtgaagaccctcaccggcaagaccatcacactggaggtggagtcctct 342 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||||||||| || || ||||||||||| || || |||||||||||| Sbjct: 343 gacaccatcgacaacgtcaaggcgaagatccaggacaaggagggcatccctccggaccag 402 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || ||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 403 cagcgcctcattttcgccggcaagcagctcgaggatggccgcactctggcagactacaac 462 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| || |||||| |||| Sbjct: 463 atccagaaggagtctacccttcacctggt 491
>emb|AJ844616.1| Plantago major mRNA for polyubiquitin (ubq2 gene) Length = 950 Score = 178 bits (90), Expect = 2e-41 Identities = 186/218 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| ||||| || |||||||| ||||| ||||| |||||| Sbjct: 77 atgcagatcttcgtcaagactctcactggcaagaccattacccttgaggtggagagctct 136 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 137 gacacgatcgataatgtcaaggccaaaattcaggacaaggaaggtattcccccggaccag 196 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || |||||| | |||||||| || || | || || |||||| Sbjct: 197 cagaggttgatctttgccggaaagcagctcgaggatggccgtaccttggcagattacaac 256 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggct 359 || ||||||||||| ||||| || |||||||||||||| Sbjct: 257 atccagaaggagtctactctgcatttggtcctcaggct 294 Score = 113 bits (57), Expect = 1e-21 Identities = 171/209 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| ||||| || |||||||| || || ||||||||||||||||| || |||||| Sbjct: 305 atgcaaatctttgttaagacccttactggaaagaccatcaccctcgaagttgagagctct 364 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| |||||||| || || ||||||||||| || ||||| ||||||||| Sbjct: 365 gacaccattgacaatgtcaaggcaaagatacaggacaaggagggtattcccccggaccag 424 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| |||||| |||| ||||| || || | || || || ||| Sbjct: 425 cagaggttgattttcgctggtaagcagctggaagatggccgtaccttggcagattataac 484 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||| ||||| || || |||||||| Sbjct: 485 attcagaaagagtcaaccctgcacttggt 513
>dbj|AP004797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0547F09 Length = 140615 Score = 178 bits (90), Expect = 2e-41 Identities = 192/226 (84%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 63749 agatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggttgagtcct 63808 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||| Sbjct: 63809 cggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggacc 63868 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||||||| | || ||||||||||||||| | |||||||| ||||| || || ||||||| Sbjct: 63869 agcagcgtctcatctttgctggcaagcagcttgaggatggccgcaccctggccgactaca 63928 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 |||| ||||||||||| || || ||| | || |||||||||||||| Sbjct: 63929 acatccagaaggagtccaccctccaccttgtgctcaggctcagggg 63974 Score = 174 bits (88), Expect = 3e-40 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 64891 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggtcgagtcctcg 64950 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 64951 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggtatccccccggaccag 65010 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || ||||||||| |||||||||| ||||| | |||||||||||| Sbjct: 65011 cagcgcctcatcttcgccggcaagcagctggaggatggccgcaccttggctgactacaac 65070 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || |||||| |||| |||||||||||||| Sbjct: 65071 atccagaaggagtccacccttcacctggttctcaggctcagggg 65114 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 64207 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 64266 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || || |||||| Sbjct: 64267 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccagaccag 64326 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| ||||||||||||||| Sbjct: 64327 cagcgtctcatcttcgccggcaagcagctggaggatggccgcacccttgctgactacaac 64386 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 64387 atccagaaggagtccaccctccaccttgtgctcaggctcaggggaggta 64435 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||||||||||||| | Sbjct: 64435 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggtcgagtcctcg 64494 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 64495 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggcatccccccggaccag 64554 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| ||||||| || ||||| ||||| ||||||||| Sbjct: 64555 cagcgtctcatcttcgccggcaagcagctggaggacggccgcacccttgccgactacaac 64614 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || |||||||| || || || ||| | || || ||||||||||| |||| Sbjct: 64615 atccagaaggaatccaccctccaccttgtgcttaggctcaggggaggta 64663 Score = 168 bits (85), Expect = 2e-38 Identities = 193/229 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| || ||||||||| | Sbjct: 64663 atgcagatcttcgtcaagaccctgactggcaagaccatcacacttgaggtcgagtcctcg 64722 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| || |||||||| || ||||||||||| || || || ||||||||| Sbjct: 64723 gacacgatcgacaatgtgaaggccaagatccaggacaaggagggcatccccccggaccag 64782 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| ||||||| || ||||| ||||| ||||||||| Sbjct: 64783 cagcgtctcatcttcgctggcaagcagctggaggacggccgcacccttgccgactacaac 64842 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || |||||||||||||| |||| Sbjct: 64843 atccagaaggagtccaccctccaccttgtgctcaggctcaggggtggta 64891 Score = 159 bits (80), Expect = 2e-35 Identities = 188/224 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || |||||||||||||| ||||||||| Sbjct: 63979 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggtcgagtcgtct 64038 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 64039 gacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggaccag 64098 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 64099 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactacaac 64158 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | || |||||||||||||| Sbjct: 64159 atccagaaggagtctaccctccaccttgtgctcaggctcagggg 64202 Score = 133 bits (67), Expect = 1e-27 Identities = 163/195 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||| ||||| ||||| ||| Sbjct: 65118 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggttgagtcgtc 65177 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| || |||||||| ||||| || || ||||||||||| || || || |||||||| Sbjct: 65178 cgacactattgacaacgtgaaggcgaagatccaggacaaggagggcatccccccggacca 65237 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| |||||||| |||||| | |||||||| ||||| ||||| || ||||| Sbjct: 65238 gcagcgtctgatctttgctggtaagcagcttgaggatggccgcacccttgcggattacaa 65297 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 65298 catccagaaggagtc 65312
>gb|AF184280.1|AF184280 Oryza sativa polyubiquitin (RUBQ2) gene, complete cds Length = 4442 Score = 178 bits (90), Expect = 2e-41 Identities = 168/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 3698 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggttgagagctcg 3757 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 3758 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 3817 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| ||||| ||||||||| Sbjct: 3818 cagcgtctcatcttcgccggcaagcagctcgaggatggccgcacccttgccgactacaac 3877 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 3878 atccagaaggagtc 3891 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||| | || |||||||||||||| | ||||| |||||| | Sbjct: 3926 atgcagatcttcgtgaagaccttgactgggaagaccatcactttggaggttgagagctcc 3985 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| |||||||| || |||||| Sbjct: 3986 gacaccattgataatgtgaaggccaagatccaggacaaggaggggattcccccagaccag 4045 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| |||||||||||||||| || || ||||||||| Sbjct: 4046 cagcgtctgatcttcgctggcaagcagctggaggatggacgcaccctcgccgactacaac 4105 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 4106 atccagaaggagtc 4119 Score = 161 bits (81), Expect = 5e-36 Identities = 191/225 (84%), Gaps = 2/225 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || |||||||||||||||||||| || | | | Sbjct: 3242 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggtgga-atcttc 3300 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 3301 tgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccggacca 3360 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || ||||| ||||||||| | ||||| || | || |||||||||||||| Sbjct: 3361 gcagcgtctcatctttgccggcaagcagcttgaggacggcaggacccttgctgactacaa 3420 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| | |||||| | |||||||| Sbjct: 3421 catccagaaggagtcaacgcttcaccttgtcctccgtctcagggg 3465 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| || || || |||||||||||||||||||| ||| Sbjct: 3470 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggtggagtcttct 3529 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 3530 gataccatcgacaatgtcaaggccaagatccaggacaaggagggcattcccccggaccag 3589 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| | || ||||||||||||||| Sbjct: 3590 cagcgcctcatctttgctggcaagcagctggaggatggcaggacccttgctgactacaac 3649 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 3650 atccagaaggagtc 3663 Score = 125 bits (63), Expect = 2e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| | || || ||||| |||||||||||||| ||| | Sbjct: 2784 agatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggtggagtcct 2843 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||| || |||||||| || || || || ||||| || || || ||||||| Sbjct: 2844 ctgacaccatcgataatgtcaaggctaagatccaagataaggagggcatccccccggacc 2903 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||||||| | || || |||||||||||| |||||||||| | || ||||||||||||| Sbjct: 2904 agcagcgtctcatcttcgctggcaagcagctggaggatggcaggacccttgctgactaca 2963 Query: 320 acattcagaaggagtcgactcttcacttggtcctc 354 |||| |||||||||||||| |||||| | |||||| Sbjct: 2964 acatccagaaggagtcgacccttcaccttgtcctc 2998 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || ||||| |||||||| ||||| ||| Sbjct: 3014 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggtggagtcttct 3073 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||| || || || || || |||||| Sbjct: 3074 gacaccatcgacaacgtcaaggccaagatccaggacaaagagggcatccccccagaccag 3133 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| | || ||||||||||||||| Sbjct: 3134 cagcgtctcatcttcgccggcaagcagctggaggatggcaggacccttgctgactacaac 3193 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 3194 atccagaaggagtc 3207
>dbj|D16248.1|SOYUBI Glycine max Subi-1 gene for ubiquitin, complete cds Length = 4955 Score = 178 bits (90), Expect = 2e-41 Identities = 177/206 (85%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||||||||||||||||| || |||||||||||||| ||||| || ||| Sbjct: 3086 agatgcagatcttcgtcaagaccctcaccggaaagaccatcacccttgaggtggaaagct 3145 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||||||||||||||||||| || |||||||||||||| ||||| ||||||| Sbjct: 3146 ctgacaccatcgacaacgtcaaggccaagatccaggacaaggaaggaattcccccggacc 3205 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||| ||| | || ||||| || |||||| | ||||| || || || || || ||||||| Sbjct: 3206 agcaacgtctcatctttgccggaaagcagctcgaggacggccgtaccctcgccgactaca 3265 Query: 320 acattcagaaggagtcgactcttcac 345 |||| ||||||||||| || |||||| Sbjct: 3266 acatccagaaggagtcaacccttcac 3291 Score = 168 bits (85), Expect = 2e-38 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || ||||| || ||||| || ||||||||| | Sbjct: 3544 atgcagatcttcgttaagaccctcaccggcaagactataaccctagaagtcgagagctcc 3603 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||||||||| || || ||||||||||| || || || || |||||| Sbjct: 3604 gacaccatcgacaacgtcaaggctaagatccaggacaaggagggtatccccccagaccag 3663 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || ||||||||| | ||||| ||||| || ||||||||||||||| Sbjct: 3664 cagaggctgatcttcgccggcaagcagctcgaggacggacgtacccttgctgactacaac 3723 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| ||||| |||||||| Sbjct: 3724 atccagaaggagtcaactctccacttggt 3752 Score = 168 bits (85), Expect = 2e-38 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| ||||| ||||| || ||||||||||| |||||| | Sbjct: 3772 atgcagatcttcgtcaagacccttacgggtaagactattaccctcgaggtggagagctcc 3831 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| || ||||| || || |||||||||||||| || || ||||||||| Sbjct: 3832 gacaccattgacaatgtgaaggcgaagatccaggacaaggaaggaatcccaccggaccag 3891 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || ||||||||||| ||| | ||||||||| | || || |||||||||||| Sbjct: 3892 cagaggcttatttttgctggcaaacagctagaggatggaaggaccctcgctgactacaac 3951 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| ||||| |||||||| Sbjct: 3952 atccagaaggagtcaactctgcacttggt 3980 Score = 113 bits (57), Expect = 1e-21 Identities = 174/213 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| ||||| || || ||||| ||||| |||||||| ||| Sbjct: 3316 atgcagatcttcgtcaagactctcactggcaaaaccataaccctagaggtcgaaagctct 3375 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 3376 gacaccattgacaacgtcaaggccaagatccaggacaaggagggaatccccccagaccag 3435 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 || ||| | || || || || ||||| | ||||| || ||||| || || ||||||||| Sbjct: 3436 caacgtctcatcttcgccggaaagcaacttgaggacgggcgcaccctcgccgactacaac 3495 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || |||||||| || || |||||| | |||||| Sbjct: 3496 atccagaaggaatcaacccttcacctcgtcctc 3528
>gb|AF093505.1|AF093505 Saccharum hybrid cultivar H32-8560 polyubiquitin (ubi9) gene, complete cds Length = 5174 Score = 178 bits (90), Expect = 2e-41 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||||||||| || ||||| ||||| || ||||||||| Sbjct: 3917 atgcagattttcgtcaagaccctcactggcaagactatcacgcttgaggtcgagtcttct 3976 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 3977 gacacgatcgacaacgtgaaggccaagatccaggacaaggagggaatccccccggaccag 4036 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || |||||||||||| Sbjct: 4037 cagcgtytcattttcgctggcaagcagctcgaggatggccgcaccctcgctgactacaac 4096 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||||||||| ||| | || |||||||||||||| Sbjct: 4097 atccagaaggagtcgactctccaccttgtgctcaggctcagggg 4140 Score = 157 bits (79), Expect = 7e-35 Identities = 176/209 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||||||||| || |||||||||||||| ||||| ||| | Sbjct: 4601 atgcagatyttcgtcaagaccctcaccggcaagaccatcaccctggaggtggagtcctct 4660 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || ||||| || || ||||||||||| || || || ||||||||| Sbjct: 4661 gacaccatcgacaatgtgaaggcgaagatccaggacaaggagggcatccccccggaccag 4720 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| ||||| || || ||||||||| Sbjct: 4721 cagcgtctcatcttcgccggcaagcagctggaggatggccgcaccctggcagactacaac 4780 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| ||||| ||| |||| Sbjct: 4781 atccagaaggagtccactctccacctggt 4809 Score = 155 bits (78), Expect = 3e-34 Identities = 189/226 (83%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||| ||||| ||||||||||| || |||||||||||||| ||||| ||| | Sbjct: 3687 agatgcagattttcgttaagaccctcactggcaagaccatcacccttgaggttgagtcct 3746 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||| || ||||| |||||||| || || |||||||||||||| |||||||| || | Sbjct: 3747 cagacactattgacaatgtcaaggctaagatccaggacaaggaaggcattcctccagatc 3806 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | |||| ||||||||||||||| | |||||||| || || || |||||||||| Sbjct: 3807 agcagaggctgatytttgctggcaagcagctcgaggatggccgtaccctagctgactaca 3866 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 |||| ||||||||||| || || ||| |||| |||||||| ||||| Sbjct: 3867 acatccagaaggagtccaccctccacctggtgctcaggcttagggg 3912 Score = 143 bits (72), Expect = 1e-30 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||||||||| || |||||||||||||| ||||| ||| | Sbjct: 4373 atgcagattttcgtcaagaccctcaccggcaagaccatcaccctggaggtggagtcctct 4432 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| || ||||| || || ||||| ||||| || || || ||||||||| Sbjct: 4433 gacaccattgacaatgtgaaggcgaagatccaggataaggagggcatccccccggaccag 4492 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || ||||||||||||||| | |||||||| ||||| || || || |||||| Sbjct: 4493 cagcgtyttatctttgctggcaagcagcttgaggatggccgcaccctggcagantacaac 4552 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| || |||||| |||| Sbjct: 4553 atccagaaggagtccacccttcacctggt 4581 Score = 131 bits (66), Expect = 4e-27 Identities = 172/209 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || |||||||||||| | ||||| ||| | Sbjct: 4145 atgcagatcttcgtcaagaccctcactggcaagaccatcaccttggaggtggagtcctcg 4204 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| || ||||| || || ||||||||||| || || || ||||||||| Sbjct: 4205 gacaccattgacaatgtgaaggcgaagatccaggacaaggagggcatccccccggaccag 4264 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || |||||||| | |||||||| ||||| ||||| || |||||| Sbjct: 4265 cagcgtctcatyttcgccggcaagcarcttgaggatggccgcacccttgcggantacaac 4324 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||| ||||| || |||||| |||| Sbjct: 4325 atccagaargagtccacccttcacctggt 4353 Score = 56.0 bits (28), Expect = 2e-04 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||||||||||||| | ||||| |||||||| | ||||||||||||||| Sbjct: 3788 gaaggcattcctccagatcagcagaggctgatytttgctggcaagcagct 3837
>gb|DQ885479.1| Musa x paradisiaca ubiquitin-like mRNA, complete sequence Length = 725 Score = 176 bits (89), Expect = 8e-41 Identities = 179/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 272 atgcagatcttcgtcaagaccctcactggaaagaccatcaccctggaggttgagagctct 331 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| ||||| || || ||||||||||| || ||||| ||||||||| Sbjct: 332 gacacgatcgacaacgttaaggcaaagatccaggacaaggagggtattccaccggaccag 391 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || ||||||||||||||| | ||||| || ||||| || || || |||||| Sbjct: 392 cagaggcttatctttgctggcaagcagctcgaggacggtcgcaccctggccgattacaac 451 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| ||||||||| |||| Sbjct: 452 attcagaaggagtccactcttcacctggt 480 Score = 65.9 bits (33), Expect = 2e-07 Identities = 163/203 (80%), Gaps = 4/203 (1%) Strand = Plus / Plus Query: 172 aagaccatcaccct-cgaggtcgagagcagcgacaccatcgac-aacgtcaagg--ccaa 227 |||||||||||||| ||| |||||||| ||||| |||||| ||||| |||| |||| Sbjct: 70 aagaccatcacccttngagttcgagagctcggacacgatcgaccaacgttaagggcccaa 129 Query: 228 aattcaggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagca 287 || ||||||||||| || || ||||||||||| ||| | |||| || || |||||||| Sbjct: 130 gatacaggacaaggagggcatccctccggaccaacagaggctgatcttcgccggcaagca 189 Query: 288 gttggaggatggacgcacacttgctgactacaacattcagaaggagtcgactcttcactt 347 | | |||||||| ||||| | || ||||| |||||||||||||| || || ||||| | Sbjct: 190 gctcgaggatggccgcactttggccgactataacattcagaaggaatccacccttcatct 249 Query: 348 ggtcctcaggctcaggggcggta 370 ||| || || |||||||| |||| Sbjct: 250 ggtgctgagactcaggggaggta 272
>ref|XM_001102090.1| PREDICTED: Macaca mulatta similar to Ubiquitin-63E CG11624-PA, isoform A (LOC712934), mRNA Length = 1771 Score = 176 bits (89), Expect = 8e-41 Identities = 182/213 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 1461 gatgcagatcttcgtgaagaccctgactggcaagaccatcacccttgaggtggagcccag 1520 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||| || || |||||||| || || |||||||||||||| || ||||| ||||| Sbjct: 1521 cgacaccattgagaatgtcaaggcaaagatccaggacaaggaaggcatccctcctgacca 1580 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| || ||| |||| ||||||||||| || |||||||||| Sbjct: 1581 gcagaggttgatctttgctgggaaacagctggaagatggacgcaccctgtctgactacaa 1640 Query: 321 cattcagaaggagtcgactcttcacttggtcct 353 ||| ||||| ||||| ||||| ||||||||||| Sbjct: 1641 catccagaaagagtccactctgcacttggtcct 1673 Score = 172 bits (87), Expect = 1e-39 Identities = 168/195 (86%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| ||||||||||| || |||||||||||||||||||| ||| ||| Sbjct: 549 gatgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtggagcccag 608 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || |||||||||||||| |||||||| ||||| Sbjct: 609 tgacaccatcgagaatgtcaaggcaaagatccaggacaaggaaggcattcctcctgacca 668 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||| ||||| ||||| || |||||||||| Sbjct: 669 gcagaggttgatctttgccggaaagcagctggaagatgggcgcaccctgtctgactacaa 728 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 729 catccagaaagagtc 743 Score = 157 bits (79), Expect = 7e-35 Identities = 166/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||||||| ||| Sbjct: 321 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctcgaggtcgagcccag 380 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||| || || || || ||||||||||| || ||||| ||||| Sbjct: 381 tgacaccatcgagaacgtcaaagcaaagatccaagacaaggaaggcatccctcctgacca 440 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || || ||| |||| ||||||||||| || |||||||||| Sbjct: 441 gcagaggttgatctttgccgggaaacagctggaagatggacgcaccctgtctgactacaa 500 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 501 catccagaaagagtc 515 Score = 157 bits (79), Expect = 7e-35 Identities = 166/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| ||||||||||| || ||||||||||| |||||||| ||| ||| Sbjct: 1005 gatgcagatcttcgtgaagaccctcactggcaagaccatcactctcgaggtggagcccag 1064 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||| || || |||||||| || || ||||| |||||||| || ||||| ||||| Sbjct: 1065 cgacaccattgagaatgtcaaggcaaagatccaggataaggaaggcatccctcctgacca 1124 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| || ||| |||| ||||| ||||| || |||||||||| Sbjct: 1125 gcagaggttgatctttgctgggaaacagctggaagatgggcgcaccctgtctgactacaa 1184 Query: 321 cattcagaaggagtc 335 ||||||||| ||||| Sbjct: 1185 cattcagaaagagtc 1199 Score = 157 bits (79), Expect = 7e-35 Identities = 166/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| ||||||||||| || |||||||||||||| ||||| ||| ||| Sbjct: 1233 gatgcagatcttcgtgaagaccctcactggcaagaccatcacccttgaggtggagcccag 1292 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||| || || |||||||| || || |||||||||||||| || ||||| ||||| Sbjct: 1293 cgacaccattgagaatgtcaaggcaaagatccaggacaaggaaggcatccctcctgacca 1352 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| || ||| |||| ||||| ||||| || |||||||||| Sbjct: 1353 gcagaggttgatctttgctgggaaacagctggaagatgggcgcaccctgtctgactacaa 1412 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 1413 catccagaaagagtc 1427 Score = 141 bits (71), Expect = 4e-30 Identities = 164/195 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||| ||| ||| Sbjct: 777 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctcgaggtggagcccag 836 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||| || || || |||||||| || || ||||||||||| || || ||||| ||||| Sbjct: 837 tgacactattgaaaatgtcaaggcaaagatccaggacaaggagggcatccctcctgacca 896 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| |||||| |||| ||||| ||||| || |||||||||| Sbjct: 897 gcagaggttgatctttgctggaaagcagctggaagatgggcgcaccctgtctgactacaa 956 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 957 catccagaaagagtc 971 Score = 115 bits (58), Expect = 2e-22 Identities = 160/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| || || ||||||||||| || ||||| ||| ||| Sbjct: 94 atgcagatcttcgtgaagaccctgactggcaagaccatcactcttgaggttgagcccagt 153 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||||| || || || || |||||||| |||||||| |||||| Sbjct: 154 gacaccattgagaatgtcaaggcaaagatccaagataaggaaggcattcctcccgaccag 213 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| || |||||| |||| ||||| ||||| || ||||||||||| Sbjct: 214 cagaggctgatctttgccggaaagcagctggaagatgggcgcaccctgtctgactacaac 273 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 274 atccagaaagagtc 287
>gb|DQ216235.1| Taeniopygia guttata clone 0058P0048G02 ubiquitin C variant 1-like mRNA, complete sequence Length = 1305 Score = 176 bits (89), Expect = 8e-41 Identities = 164/189 (86%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||||||||||||||| ||||| |||||||||||||| || || ||| ||| Sbjct: 524 gatgcagatcttcgtcaagaccctgacgggcaagaccatcaccctggaagttgagcccag 583 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||||||||| || |||||||||||||| || ||||| || || Sbjct: 584 tgacaccatcgagaacgtcaaggccaagatccaggacaaggaaggtatccctccagatca 643 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| |||||||||| ||||| || | |||||||| Sbjct: 644 gcagaggctgatctttgctggcaagcagctggaggatgggcgcaccctgtccgactacaa 703 Query: 321 cattcagaa 329 ||||||||| Sbjct: 704 cattcagaa 712 Score = 167 bits (84), Expect = 7e-38 Identities = 165/192 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| || ||||| || || ||||||||||| |||||||| ||| ||| Sbjct: 296 gatgcagatcttcgtgaaaaccctgactggcaagaccatcactctcgaggtggagcccag 355 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || ||||||||||| || |||||||||||||| |||||||| ||||| Sbjct: 356 tgacaccatcgagaatgtcaaggccaagatccaggacaaggaaggtattcctcctgacca 415 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| |||| ||||| ||||| || |||||||||| Sbjct: 416 gcagaggctgatctttgctggcaagcagctggaagatgggcgcaccctgtctgactacaa 475 Query: 321 cattcagaagga 332 ||| |||||||| Sbjct: 476 catccagaagga 487 Score = 129 bits (65), Expect = 2e-26 Identities = 173/209 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 69 atgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggtggagcccagt 128 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| || ||||| || |||||| Sbjct: 129 gacaccattgaaaatgtgaaggccaagatccaggacaaggagggcattcccccagaccag 188 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||||||||| ||||| || | ||| ||||| Sbjct: 189 cagaggctgatctttgctggcaagcagctggaggatgggcgcaccctctccgacgacaac 248 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||| ||||| ||||| ||| |||| Sbjct: 249 atccagaaagagtcaactctccacctggt 277 Score = 117 bits (59), Expect = 6e-23 Identities = 158/191 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||| || || |||||||||||||| || || ||| |||| Sbjct: 754 atgcagatctttgtgaagaccctgactggcaagaccatcaccctggaagttgagcccagc 813 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| || ||||| || |||||| Sbjct: 814 gacaccattgaaaatgtgaaggccaagatccaggacaaggagggcattcccccagaccag 873 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||| ||| Sbjct: 874 cagaggctgatttttgctggcaagcagctggaagatgggcgcaccctctccgactataac 933 Query: 322 attcagaagga 332 || |||||||| Sbjct: 934 atccagaagga 944 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||| |||||||||| ||||| |||||||| | ||||||||||||||| Sbjct: 396 gaaggtattcctcctgaccagcagaggctgatctttgctggcaagcagct 445 Score = 48.1 bits (24), Expect = 0.047 Identities = 30/32 (93%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagct 518 ||||| |||||||||| ||||||||||||||| Sbjct: 871 cagcagaggctgatttttgctggcaagcagct 902
>gb|U84967.1|ATU84967 Arabidopsis thaliana ubiquitin (UBQ11) gene, complete cds Length = 912 Score = 176 bits (89), Expect = 8e-41 Identities = 182/213 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || ||||||||||| || || || |||||| | Sbjct: 685 atgcagatcttcgtcaagactttgaccggcaagaccatcactcttgaagttgagagctcc 744 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || ||||||||||||||||| ||||||||||||||| Sbjct: 745 gacaccattgacaacgtgaaggctaagattcaggacaaggaaggtattcctccggaccag 804 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || |||||||| Sbjct: 805 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaat 864 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || ||||||||||| |||||||||||||||||| Sbjct: 865 atccagaaggagtctactcttcacttggtcctc 897 Score = 145 bits (73), Expect = 3e-31 Identities = 175/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 457 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||| |||||||| || |||||||| ||| Sbjct: 517 gacaccattgacaacgtcaaggccaagatccaggataaggaaggtatccctccggatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| || |||||||||||||| || || | ||||| |||||| Sbjct: 577 cagaggttgatcttcgctggaaaacagttggaggatggtcgtaccttggctgattacaac 636 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||| ||||| Sbjct: 637 attcagaaggagtctacccttcatttggt 665 Score = 125 bits (63), Expect = 2e-25 Identities = 180/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 1 atgcagattttcgttaagactctcaccggaaagacaatcaccctcgaggtggaaagctct 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||||||| Sbjct: 61 gacaccatcgacaacgttaaggccaagatccaggataaggagggtattcctccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || || || ||| | |||||||| ||||| | ||||| ||||| Sbjct: 121 cagaggcttatcttcgccgggaaacagctagaggatggccgcacgttggctgattacaat 180 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || |||||||| || || || |||||||||||||||||| Sbjct: 181 atccagaaggaatccaccctccacttggtcctcaggctc 219 Score = 107 bits (54), Expect = 6e-20 Identities = 171/210 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||| ||||| ||||| ||||| || || || ||||| |||||| Sbjct: 229 atgcagattttcgtcaaaaccctaacgggaaagacgattactcttgaggtggagagctct 288 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||| ||||| || || ||||| || || |||||||| |||||| Sbjct: 289 gacaccattgacaacgtcaaagccaagatccaagacaaagagggtattcctccagaccag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||| | || ||||| | || | |||||||||||| Sbjct: 349 cagagattgatcttcgctggaaagcaacttgaagatggcagaactttggctgactacaac 408 Query: 322 attcagaaggagtcgactcttcacttggtc 351 ||||||| |||||| || |||||||||||| Sbjct: 409 attcagagggagtccacacttcacttggtc 438
>emb|CT985439.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 764 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || |||||||||||||| ||||| |||||| | Sbjct: 348 atgcagatcttcgtcaagaccctcaccggcaagaccatcaccctggaggtggagagctcc 407 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || |||||||||||||| |||||||| || ||||| ||||| || || |||||||||||| Sbjct: 408 gataccatcgacaacgtgaaggccaagatccaggataaggagggcatccctccggaccag 467 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || ||||||||| ||||||| || ||||| || || || |||||| Sbjct: 468 cagaggctgatcttcgccggcaagcagctggaggacggccgcaccctggcggattacaac 527 Query: 322 attcagaaggagtcgactcttcac 345 || |||||||||||||| |||||| Sbjct: 528 atccagaaggagtcgacccttcac 551 Score = 137 bits (69), Expect = 7e-29 Identities = 189/229 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| ||||||||||| || || |||||||| ||||||||||| |||||| | Sbjct: 120 atgcagatctttgtcaagaccctgaccggcaagaccattaccctcgaggttgagagctcc 179 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 180 gacaccattgacaacgtcaaggccaagatccaggacaaggagggcatcccaccagaccag 239 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || ||||||||| | ||||| || || || || || ||||||||| Sbjct: 240 cagaggctcatcttcgccggcaagcagctcgaggacggccgtaccctcgccgactacaac 299 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || || ||||||||||| |||| Sbjct: 300 atccagaaggagtccaccctccaccttgtgctgaggctcaggggaggta 348 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 253 ccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgct 312 |||||||||||| | |||| || ||||| |||||| | ||||| || || || || || Sbjct: 3 ccggaccagcagaggctgatcttcgctggaaagcagcttgaggacggccgtaccctcgcc 62 Query: 313 gactacaacattcagaaggagtc 335 ||||||||||| ||||||||||| Sbjct: 63 gactacaacatccagaaggagtc 85
>emb|CT983996.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 764 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || |||||||||||||| ||||| |||||| | Sbjct: 348 atgcagatcttcgtcaagaccctcaccggcaagaccatcaccctggaggtggagagctcc 407 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || |||||||||||||| |||||||| || ||||| ||||| || || |||||||||||| Sbjct: 408 gataccatcgacaacgtgaaggccaagatccaggataaggagggcatccctccggaccag 467 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || ||||||||| ||||||| || ||||| || || || |||||| Sbjct: 468 cagaggctgatcttcgccggcaagcagctggaggacggccgcaccctggcggattacaac 527 Query: 322 attcagaaggagtcgactcttcac 345 || |||||||||||||| |||||| Sbjct: 528 atccagaaggagtcgacccttcac 551 Score = 137 bits (69), Expect = 7e-29 Identities = 189/229 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| ||||||||||| || || |||||||| ||||||||||| |||||| | Sbjct: 120 atgcagatctttgtcaagaccctgaccggcaagaccattaccctcgaggttgagagctcc 179 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 180 gacaccattgacaacgtcaaggccaagatccaggacaaggagggcatcccaccagaccag 239 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || ||||||||| | ||||| || || || || || ||||||||| Sbjct: 240 cagaggctcatcttcgccggcaagcagctcgaggacggccgtaccctcgccgactacaac 299 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || || ||||||||||| |||| Sbjct: 300 atccagaaggagtccaccctccaccttgtgctgaggctcaggggaggta 348 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 253 ccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgct 312 |||||||||||| | |||| || ||||| |||||| | ||||| || || || || || Sbjct: 3 ccggaccagcagaggctgatcttcgctggaaagcagcttgaggacggccgtaccctcgcc 62 Query: 313 gactacaacattcagaaggagtc 335 ||||||||||| ||||||||||| Sbjct: 63 gactacaacatccagaaggagtc 85
>emb|CT983983.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 802 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || |||||||||||||| ||||| |||||| | Sbjct: 348 atgcagatcttcgtcaagaccctcaccggcaagaccatcaccctggaggtggagagctcc 407 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || |||||||||||||| |||||||| || ||||| ||||| || || |||||||||||| Sbjct: 408 gataccatcgacaacgtgaaggccaagatccaggataaggagggcatccctccggaccag 467 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || ||||||||| ||||||| || ||||| || || || |||||| Sbjct: 468 cagaggctgatcttcgccggcaagcagctggaggacggccgcaccctggcggattacaac 527 Query: 322 attcagaaggagtcgactcttcac 345 || |||||||||||||| |||||| Sbjct: 528 atccagaaggagtcgacccttcac 551 Score = 137 bits (69), Expect = 7e-29 Identities = 189/229 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| ||||||||||| || || |||||||| ||||||||||| |||||| | Sbjct: 120 atgcagatctttgtcaagaccctgaccggcaagaccattaccctcgaggttgagagctcc 179 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 180 gacaccattgacaacgtcaaggccaagatccaggacaaggagggcatcccaccagaccag 239 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || ||||||||| | ||||| || || || || || ||||||||| Sbjct: 240 cagaggctcatcttcgccggcaagcagctcgaggacggccgtaccctcgccgactacaac 299 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || || ||||||||||| |||| Sbjct: 300 atccagaaggagtccaccctccaccttgtgctgaggctcaggggaggta 348 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 253 ccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgct 312 |||||||||||| | |||| || ||||| |||||| | ||||| || || || || || Sbjct: 3 ccggaccagcagaggctgatcttcgctggaaagcagcttgaggacggccgtaccctcgcc 62 Query: 313 gactacaacattcagaaggagtc 335 ||||||||||| ||||||||||| Sbjct: 63 gactacaacatccagaaggagtc 85
>emb|CT983724.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 763 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || |||||||||||||| ||||| |||||| | Sbjct: 348 atgcagatcttcgtcaagaccctcaccggcaagaccatcaccctggaggtggagagctcc 407 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || |||||||||||||| |||||||| || ||||| ||||| || || |||||||||||| Sbjct: 408 gataccatcgacaacgtgaaggccaagatccaggataaggagggcatccctccggaccag 467 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || ||||||||| ||||||| || ||||| || || || |||||| Sbjct: 468 cagaggctgatcttcgccggcaagcagctggaggacggccgcaccctggcggattacaac 527 Query: 322 attcagaaggagtcgactcttcac 345 || |||||||||||||| |||||| Sbjct: 528 atccagaaggagtcgacccttcac 551 Score = 137 bits (69), Expect = 7e-29 Identities = 189/229 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| ||||||||||| || || |||||||| ||||||||||| |||||| | Sbjct: 120 atgcagatctttgtcaagaccctgaccggcaagaccattaccctcgaggttgagagctcc 179 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 180 gacaccattgacaacgtcaaggccaagatccaggacaaggagggcatcccaccagaccag 239 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || ||||||||| | ||||| || || || || || ||||||||| Sbjct: 240 cagaggctcatcttcgccggcaagcagctcgaggacggccgtaccctcgccgactacaac 299 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| | || || ||||||||||| |||| Sbjct: 300 atccagaaggagtccaccctccaccttgtgctgaggctcaggggaggta 348 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 253 ccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgct 312 |||||||||||| | |||| || ||||| |||||| | ||||| || || || || || Sbjct: 3 ccggaccagcagaggctgatcttcgctggaaagcagcttgaggacggccgtaccctcgcc 62 Query: 313 gactacaacattcagaaggagtc 335 ||||||||||| ||||||||||| Sbjct: 63 gactacaacatccagaaggagtc 85
>ref|NM_178970.2| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding (UBQ10) mRNA, complete cds Length = 1624 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1191 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1250 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||||||||||||| Sbjct: 1251 gacaccattgacaacgtcaaggccaagatccaggacaagga-ggtattcctccggaccag 1309 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1310 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1369 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1370 atccagaaggagtctactcttcacttggtcct 1401 Score = 137 bits (69), Expect = 7e-29 Identities = 183/221 (82%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 49 agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagct 108 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| | Sbjct: 109 ccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggatc 168 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | | || || || ||||||||| | |||||||| || || | ||||| |||| Sbjct: 169 agcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattaca 228 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctc 360 | || |||||||| || || || |||||||||||||||||| Sbjct: 229 atatccagaaggaatccaccctccacttggtcctcaggctc 269 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 963 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1022 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 1023 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 1082 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 1083 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 1142 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 1143 atccagaaggagtcgacccttcacttggt 1171 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 279 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 338 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 339 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 398 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 399 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 458 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 459 atccagaaggagtccacccttca 481 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 735 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 794 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 795 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 854 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 855 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 914 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 915 attcagaaggagtccacacttcacttggtc 944 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 678 gactacaacattcagaaggagtccacactccacttggtc 716
>ref|NM_202787.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding (UBQ10) mRNA, complete cds Length = 1203 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 770 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 829 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||||||||||||| Sbjct: 830 gacaccattgacaacgtcaaggccaagatccaggacaagga-ggtattcctccggaccag 888 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 889 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 948 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 949 atccagaaggagtctactcttcacttggtcct 980 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 83 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 142 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 143 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 202 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 203 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 262 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 263 aatatccagaaggaatccaccctccacttggtcctcaggctc 304 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 542 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 601 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 602 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 661 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 662 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 721 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 722 atccagaaggagtcgacccttcacttggt 750 Score = 123 bits (62), Expect = 1e-24 Identities = 173/210 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 314 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 373 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 374 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 433 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 434 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 493 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 494 attcagaaggagtccacacttcacttggtc 523
>ref|NM_178969.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding (UBQ10) mRNA, complete cds Length = 1431 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 998 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1057 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||||||||||||| Sbjct: 1058 gacaccattgacaacgtcaaggccaagatccaggacaagga-ggtattcctccggaccag 1116 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1117 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1176 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1177 atccagaaggagtctactcttcacttggtcct 1208 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 83 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 142 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 143 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 202 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 203 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 262 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 263 aatatccagaaggaatccaccctccacttggtcctcaggctc 304 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 770 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 829 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 830 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 889 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 890 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 949 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 950 atccagaaggagtcgacccttcacttggt 978 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 542 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 601 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 602 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 661 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 662 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 721 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 722 attcagaaggagtccacacttcacttggtc 751 Score = 91.7 bits (46), Expect = 3e-15 Identities = 169/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 314 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 373 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 374 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 433 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | || ||||||||| Sbjct: 434 cagagattgatcttcgccggaaaacaacttgaagatggcagaactttggccgactacaac 493 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || || ||||||||| Sbjct: 494 attcagaaggagtccacactccacttggtc 523
>ref|NM_116771.2| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding (UBQ10) mRNA, complete cds Length = 1431 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 998 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1057 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||||||||||||| Sbjct: 1058 gacaccattgacaacgtcaaggccaagatccaggacaagga-ggtattcctccggaccag 1116 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1117 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1176 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1177 atccagaaggagtctactcttcacttggtcct 1208 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 83 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 142 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 143 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 202 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 203 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 262 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 263 aatatccagaaggaatccaccctccacttggtcctcaggctc 304 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 770 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 829 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 830 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 889 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 890 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 949 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 950 atccagaaggagtcgacccttcacttggt 978 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 314 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 373 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 374 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 433 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 434 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 493 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 494 atccagaaggagtccacccttca 516 Score = 75.8 bits (38), Expect = 2e-10 Identities = 122/150 (81%) Strand = Plus / Plus Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 602 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 661 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 662 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 721 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 722 attcagaaggagtccacacttcacttggtc 751
>ref|NM_178968.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding (UBQ10) mRNA, complete cds Length = 1834 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1226 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1285 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||||||||||||| Sbjct: 1286 gacaccattgacaacgtcaaggccaagatccaggacaagga-ggtattcctccggaccag 1344 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1345 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1404 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1405 atccagaaggagtctactcttcacttggtcct 1436 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 83 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 142 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 143 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 202 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 203 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 262 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 263 aatatccagaaggaatccaccctccacttggtcctcaggctc 304 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 998 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1057 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 1058 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 1117 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 1118 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 1177 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 1178 atccagaaggagtcgacccttcacttggt 1206 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 314 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 373 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 374 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 433 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 434 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 493 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 494 atccagaaggagtccacccttca 516 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 770 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 829 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 830 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 889 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 890 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 949 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 950 attcagaaggagtccacacttcacttggtc 979 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 713 gactacaacattcagaaggagtccacactccacttggtc 751
>gb|BT016652.1| Zea mays clone Contig485 mRNA sequence Length = 1253 Score = 174 bits (88), Expect = 3e-40 Identities = 166/192 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| || || ||||| |||||||||||||| ||| Sbjct: 84 atgcagatcttcgtgaagaccctgactggcaagactatcaccctcgaggtggagtcttca 143 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 144 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatcccaccggaccag 203 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||||||||| || |||||||||||| |||||||||| ||||| ||||| || |||||| Sbjct: 204 cagcgtttgatcttcgctggcaagcagctggaggatggccgcacccttgcggattacaac 263 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 264 atccagaaggag 275 Score = 139 bits (70), Expect = 2e-29 Identities = 139/162 (85%) Strand = Plus / Plus Query: 172 aagaccatcaccctcgaggtcgagagcagcgacaccatcgacaacgtcaaggccaaaatt 231 |||||||||||| | ||||| |||||| |||||||| ||||| || |||||||| || Sbjct: 570 aagaccatcaccttggaggtggagagctctgacaccattgacaatgtgaaggccaagatc 629 Query: 232 caggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttg 291 ||||||||||| || ||||| || |||||||||||| |||| ||||||||||||||| || Sbjct: 630 caggacaaggagggcattcccccagaccagcagcgtctgatctttgctggcaagcagctg 689 Query: 292 gaggatggacgcacacttgctgactacaacattcagaaggag 333 |||||||| ||||| || || ||||||||||| ||||||||| Sbjct: 690 gaggatggtcgcaccctcgcggactacaacatccagaaggag 731 Score = 111 bits (56), Expect = 4e-21 Identities = 158/192 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||| || || || ||||| ||||| ||||| |||||| Sbjct: 768 atgcagatctttgtgaagaccctgactggaaaaaccataaccctggaggttgagagctcg 827 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || ||||| || || ||||||||||| || || || ||||||||| Sbjct: 828 gacaccatcgacaatgtgaaggcgaagatccaggacaaggagggcatccccccggaccag 887 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || || ||||| ||| |||||||||| ||||| | || ||||||||| Sbjct: 888 cagcgtctgatcttcgccggcaaacagctggaggatggccgcaccttagcagactacaac 947 Query: 322 attcagaaggag 333 || || |||||| Sbjct: 948 atccaaaaggag 959 Score = 103 bits (52), Expect = 9e-19 Identities = 157/192 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||| ||||| || ||||| |||||||| ||||| ||| Sbjct: 312 atgcagatctttgtgaagacactcactggcaagacaatcacccttgaggtggagtcttcg 371 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||| ||||| ||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 372 gataccattgacaatgtcaaggccaagatccaggacaaggagggcatcccaccggaccag 431 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || || ||||||||| |||||||||| ||||| || || ||||||||| Sbjct: 432 cagcgcctcatcttcgccggcaagcagctggaggatggccgcaccctggcggactacaac 491 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 492 atccagaaggag 503
>ref|XM_504128.1| Yarrowia lipolytica CLIB122, YALI0E18986g predicted mRNA Length = 1146 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| | Sbjct: 685 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttcc 744 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||| |||| ||||||||||||||||| ||||| ||||||||| Sbjct: 745 gacaccatcgacaatgtcaagtccaagattcaggacaaggaaggaattcccccggaccag 804 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| |||||||| |||||| | |||||||| || || ||| ||||||||||| Sbjct: 805 cagcgactgatttttgctggtaagcagctcgaggatggccgaactctttctgactacaac 864 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 865 attcagaaggagtccactct 884 Score = 151 bits (76), Expect = 4e-33 Identities = 169/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| | Sbjct: 229 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttcc 288 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||| |||| |||||||||||||| || ||||| ||||||||| Sbjct: 289 gacaccatcgacaatgtcaagtccaagattcaggacaaggagggaattcccccggaccag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || ||||| |||||| | |||||||| || || ||| | ||||||||| Sbjct: 349 cagcgactgattttcgctggtaagcagctcgaggatggtcgaactctttccgactacaac 408 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 409 attcagaaggagtccactct 428 Score = 151 bits (76), Expect = 4e-33 Identities = 169/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| | Sbjct: 457 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttcc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||| |||| |||||||||||||| || ||||| ||||||||| Sbjct: 517 gacaccatcgacaatgtcaagtccaagattcaggacaaggagggaattcccccggaccag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || ||||| |||||| | |||||||| || || ||| | ||||||||| Sbjct: 577 cagcgactgattttcgctggtaagcagctcgaggatggtcgaactctttccgactacaac 636 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 637 attcagaaggagtccactct 656 Score = 127 bits (64), Expect = 6e-26 Identities = 166/200 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| Sbjct: 1 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttct 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || || || |||||| |||| |||||||||||||| || ||||| ||||||||| Sbjct: 61 gacactattgataatgtcaagtccaagattcaggacaaggagggaattcccccggaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| |||||||| |||||| | |||||||| || || ||| | ||||||||| Sbjct: 121 cagcgactgatttttgctggtaagcagctcgaggatggtcgaactctttccgactacaac 180 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 181 attcagaaggagtccactct 200 Score = 113 bits (57), Expect = 1e-21 Identities = 167/201 (83%), Gaps = 2/201 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| || | | | Sbjct: 913 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttga-atcttc 971 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||| || || || |||||| |||| |||||||||||||| || ||||| |||||||| Sbjct: 972 tgacactattgataatgtcaagtccaagattcaggacaaggagggaattcccccggacca 1031 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||||| |||| |||||||| |||||| | |||||||| || || ||| | |||||||| Sbjct: 1032 gcagcgactgatttttgctggtaagcagcttgaggatggccgaactctttccgactacaa 1091 Query: 321 cattcagaaggagtcgactct 341 ||| ||||||||||| ||||| Sbjct: 1092 catccagaaggagtccactct 1112
>gb|BT000701.1| Arabidopsis thaliana clone RAFL08-11-A12 (R11186) putative polyubiquitin (UBQ10) (At4g05320) mRNA, complete cds Length = 1616 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1207 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1266 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||||||||||||| Sbjct: 1267 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggtattcctccggaccag 1326 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1327 -agcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1385 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1386 atccagaaggagtctactcttcacttggtcct 1417 Score = 139 bits (70), Expect = 2e-29 Identities = 184/222 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 64 aagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagc 123 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| Sbjct: 124 tccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggat 183 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | | || || || ||||||||| | |||||||| || || | ||||| ||| Sbjct: 184 cagcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattac 243 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctc 360 || || |||||||| || || || |||||||||||||||||| Sbjct: 244 aatatccagaaggaatccaccctccacttggtcctcaggctc 285 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 979 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1038 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 1039 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 1098 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 1099 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 1158 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 1159 atccagaaggagtcgacccttcacttggt 1187 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 295 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 354 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 355 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 414 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 415 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 474 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 475 atccagaaggagtccacccttca 497 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 810 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 811 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 870 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 871 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 930 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 931 attcagaaggagtccacacttcacttggtc 960 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 694 gactacaacattcagaaggagtccacactccacttggtc 732
>emb|CR734606.2|CNS0GTLP Tetraodon nigroviridis full-length cDNA Length = 810 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||| ||||| |||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaagaaggctttccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 60.0 bits (30), Expect = 1e-05 Identities = 57/66 (86%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 |||| ||||||||| |||| |||| ||||| |||||||| | ||||||||||||||||| Sbjct: 321 aggacaaagaaggctttccccctgatcagcagaggctgatctttgctggcaagcagcttg 380 Query: 521 cagatg 526 ||||| Sbjct: 381 aagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR704402.2|CNS0G6GU Tetraodon nigroviridis full-length cDNA Length = 784 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 457 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 636 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 637 atccagaaggagtc 650 Score = 99.6 bits (50), Expect = 1e-17 Identities = 159/194 (81%), Gaps = 1/194 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||| | ||| ||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaag-ggggcgtccccctgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 349 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 408 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 409 atccagaaagagtc 422 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 556 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 605 Score = 48.1 bits (24), Expect = 0.047 Identities = 36/40 (90%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 346 cagcagaggctgatctttgctggcaagcagcttgaagatg 385
>emb|CR704024.2|CNS0G66C Tetraodon nigroviridis full-length cDNA Length = 804 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 457 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 636 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 637 atccagaaggagtccactct 656 Score = 91.7 bits (46), Expect = 3e-15 Identities = 149/182 (81%), Gaps = 1/182 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || |||||||| || ||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcactcttgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||| || ||||||||| ||||||| |||||||| | || | ||| || || ||| Sbjct: 290 tacaccattgagaacgtcaagaccaaaatccaggacaaaggagcg-gtccccctgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 349 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 408 Query: 322 at 323 || Sbjct: 409 at 410 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 556 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 605
>emb|CR703845.2|CNS0G61D Tetraodon nigroviridis full-length cDNA Length = 809 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagattttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||| ||| ||||||||||| || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatctacgttaagaccctcactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||| ||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaagaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 67.9 bits (34), Expect = 5e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||||| Sbjct: 321 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttg 380 Query: 521 cagatg 526 ||||| Sbjct: 381 aagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR703290.2|CNS0G5LY Tetraodon nigroviridis full-length cDNA Length = 527 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 174 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 233 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 234 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 293 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 294 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 353 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 354 atccagaaggagtccactct 373 Score = 107 bits (54), Expect = 6e-20 Identities = 117/138 (84%) Strand = Plus / Plus Query: 198 cagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgga 257 |||||||||||| || ||||||||| ||||||| |||||||| ||||| ||||| || || Sbjct: 2 cagcgacaccattgagaacgtcaagaccaaaatccaggacaaagaaggcattccccctga 61 Query: 258 ccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgacta 317 |||||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||| Sbjct: 62 tcagcagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgacta 121 Query: 318 caacattcagaaggagtc 335 |||||| ||||||||||| Sbjct: 122 caacatccagaaggagtc 139 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 37 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 94 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 273 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 322
>emb|CR701645.2|CNS0G4C9 Tetraodon nigroviridis full-length cDNA Length = 787 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 410 atccagaaggagtccactct 429 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagt 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||| ||||||| |||||||| ||||| |||||||| || ||| Sbjct: 518 gacaccattgagaatgtcaagaccaaaatccaggacaaagaaggcattcctcctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | | || ||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagggggtggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 67.9 bits (34), Expect = 5e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| ||||||||||||||||||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattcctcctgatcagcagaggctgatctttgctggcaagcagct 606 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 378
>emb|CR698952.2|CNS0G29G Tetraodon nigroviridis full-length cDNA Length = 804 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatatttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 131 bits (66), Expect = 4e-27 Identities = 162/194 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 460 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 519 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || | | Sbjct: 520 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcgg 579 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 | | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 580 agggggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 639 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 640 atccagaaggagtc 653 Score = 115 bits (58), Expect = 2e-22 Identities = 97/110 (88%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcc 251 |||||||| || ||||| |||||||| || |||||||||||||| ||||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcc 339 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatatttgctggcaagcagcttgaagatg 158 Score = 46.1 bits (23), Expect = 0.19 Identities = 54/63 (85%), Gaps = 1/63 (1%) Strand = Plus / Plus Query: 274 tttgctggcaagcagttggaggatg-gacgcacacttgctgactacaacattcagaagga 332 ||||||||||||||| | || |||| | ||||| ||| | ||||||||||| |||||||| Sbjct: 362 tttgctggcaagcagcttgaagatgtgccgcaccctttccgactacaacatccagaagga 421 Query: 333 gtc 335 ||| Sbjct: 422 gtc 424
>emb|CR696928.2|CNS0G0P8 Tetraodon nigroviridis full-length cDNA Length = 809 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| |||||||| || ||| Sbjct: 62 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattcctcctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 67.9 bits (34), Expect = 5e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 |||||||||||||||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattcctcctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR694670.2|CNS0FYYI Tetraodon nigroviridis full-length cDNA Length = 810 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 461 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 520 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 521 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcag 580 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 581 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 640 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 641 atccagaaggagtc 654 Score = 149 bits (75), Expect = 2e-32 Identities = 166/195 (85%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc-ag 200 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| | || Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagccccag 289 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||| || ||||| |||||||| || |||||||||||||| ||||| || || || Sbjct: 290 cgacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatca 349 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 350 gcagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaa 409 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 410 catccagaaggagtc 424 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 330 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 387 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 552 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 609 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150
>emb|CR693873.3|CNS0FYCD Tetraodon nigroviridis full-length cDNA Length = 800 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 457 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 636 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 637 atccagaaggagtccactct 656 Score = 109 bits (55), Expect = 1e-20 Identities = 162/196 (82%), Gaps = 5/196 (2%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || |||||||| || ||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcactcttgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggat--tcctccggacc 259 |||||||| || ||||||||| ||||||| ||||||| ||||| | ||| || || | Sbjct: 290 gacaccattgagaacgtcaagaccaaaatccaggaca---aaggggtggtccccctgatc 346 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||| Sbjct: 347 agcagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactaca 406 Query: 320 acattcagaaggagtc 335 |||| ||||||||||| Sbjct: 407 acatccagaaggagtc 422 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 556 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 605
>emb|CR693750.2|CNS0FY8Y Tetraodon nigroviridis full-length cDNA Length = 807 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 151 bits (76), Expect = 4e-33 Identities = 169/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaat 637 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 638 atccagaaggagtccactct 657 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||| ||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaagaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 67.9 bits (34), Expect = 5e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||||| Sbjct: 321 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttg 380 Query: 521 cagatg 526 ||||| Sbjct: 381 aagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR680764.2|CNS0FO88 Tetraodon nigroviridis full-length cDNA Length = 810 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 115 bits (58), Expect = 2e-22 Identities = 160/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||| ||| | | ||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaagaaagcaatccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 56/66 (84%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 |||| |||||| ||| ||| |||| ||||| |||||||| | ||||||||||||||||| Sbjct: 321 aggacaaagaaagcaatccccctgatcagcagaggctgatctttgctggcaagcagcttg 380 Query: 521 cagatg 526 ||||| Sbjct: 381 aagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR678171.2|CNS0FM8F Tetraodon nigroviridis full-length cDNA Length = 815 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 123 bits (62), Expect = 1e-24 Identities = 169/202 (83%), Gaps = 2/202 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcg-aggtcgagagcag 200 ||||||||||||||||||||||| || || || ||||||||||||| |||| ||| ||| Sbjct: 460 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcggaggtggagcccag 519 Query: 201 cg-acaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 || ||||||| || ||||| |||||||| || |||||||||||||| ||||| || || | Sbjct: 520 cgcacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatc 579 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||| Sbjct: 580 agcagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactaca 639 Query: 320 acattcagaaggagtcgactct 341 | || ||||||||||| ||||| Sbjct: 640 atatccagaaggagtccactct 661 Score = 111 bits (56), Expect = 4e-21 Identities = 163/196 (83%), Gaps = 2/196 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaa-gggattcctccggacca 260 |||||||| || ||||| ||| ||||||| |||||||| ||| ||| |||| || || || Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaagaaggggtttccccctgatca 349 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacact-tgctgactaca 319 |||| | |||| ||||||||||||||| | || ||||| ||||| || | | ||||||| Sbjct: 350 gcagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccggactaca 409 Query: 320 acattcagaaggagtc 335 |||| ||||| ||||| Sbjct: 410 acatccagaaagagtc 425 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 561 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 610 Score = 48.1 bits (24), Expect = 0.047 Identities = 36/40 (90%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 348 cagcagaggctgatctttgctggcaagcagcttgaagatg 387
>emb|CR664330.2|CNS0FBKG Tetraodon nigroviridis full-length cDNA Length = 804 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 161 bits (81), Expect = 5e-36 Identities = 165/193 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagt 334 || ||||| |||| Sbjct: 410 atccagaaagagt 422 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR664212.2|CNS0FBH6 Tetraodon nigroviridis full-length cDNA Length = 809 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 457 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| ||| | ||||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctttccgactacaac 636 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 637 atccagaaggagtc 650 Score = 123 bits (62), Expect = 1e-24 Identities = 162/194 (83%), Gaps = 1/194 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||| ||||||| |||||||| ||| | ||||||| || ||| Sbjct: 290 gacaccattgagaatgtcaagaccaaaatccaggacaaagaa-gtcttcctcctgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 349 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 408 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 409 atccagaaagagtc 422 Score = 54.0 bits (27), Expect = 8e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 476 ttcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 335 ttcctcctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 385 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 556 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 605
>emb|CR662492.2|CNS0FA5E Tetraodon nigroviridis full-length cDNA Length = 752 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 639 atccagaaggagtccactct 658 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 133 bits (67), Expect = 1e-27 Identities = 164/195 (84%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || |||||||| || ||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcactcttgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatgg-acgcacacttgctgactacaa 320 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagctggaagatggcgcgcaccctgtccgactacaa 409 Query: 321 cattcagaaggagtc 335 || ||||||||||| Sbjct: 410 tatccagaaggagtc 424 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 378 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 607
>emb|CR657552.2|CNS0F6C6 Tetraodon nigroviridis full-length cDNA Length = 810 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 639 atccagaaggagtccactct 658 Score = 141 bits (71), Expect = 4e-30 Identities = 165/195 (84%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc-ag 200 |||||||||||||||||||||||||| || || |||||||| || ||||| ||| | || Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcactcttgaggtggagccccag 289 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||| || ||||||||| ||||||| |||||||| ||||| ||||| || || || Sbjct: 290 cgacaccattgagaacgtcaagaccaaaatccaggacaaagaaggcattccccctgatca 349 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 350 gcagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaa 409 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 410 catccagaaggagtc 424 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 322 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 379 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 607
>emb|CR648990.2|CNS0EZQC Tetraodon nigroviridis full-length cDNA Length = 755 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 638 atccagaaggagtccactct 657 Score = 159 bits (80), Expect = 2e-35 Identities = 170/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || |||||||| || ||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcactcttgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 378 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 606
>gb|S94466.1| polyubiquitin [maize, Genomic, 3439 nt] Length = 3439 Score = 174 bits (88), Expect = 3e-40 Identities = 166/192 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| ||||| || ||||| |||||||||||||| ||| | Sbjct: 1650 atgcagatcttcgtcaagactctcactggaaagactatcaccctcgaggtggagtcctct 1709 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || |||||||||||||| ||||| ||||||||| Sbjct: 1710 gacaccattgacaacgtcaaggccaagatccaggacaaggaaggcattcccccggaccag 1769 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || || |||||||||||| | ||||| || ||||||||||| ||||||||| Sbjct: 1770 cagcggctcatcttcgctggcaagcagctcgaggacgggcgcacacttgccgactacaac 1829 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 1830 atccagaaggag 1841 Score = 174 bits (88), Expect = 3e-40 Identities = 166/192 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || ||||| |||||||||||||| ||| Sbjct: 1878 atgcagatcttcgtcaagaccctcactggaaagactatcaccctcgaggtggagtcttct 1937 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || |||||||||||| Sbjct: 1938 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccctccggaccag 1997 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| | ||||| || ||||| || || ||||||||| Sbjct: 1998 cagcggctcatttttgctggcaagcagctcgaggacgggcgcacgctggccgactacaac 2057 Query: 322 attcagaaggag 333 |||||||||||| Sbjct: 2058 attcagaaggag 2069 Score = 143 bits (72), Expect = 1e-30 Identities = 162/192 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||| |||||||| ||||| ||| | Sbjct: 2334 atgcagatcttcgtgaagacacttactggcaagacgatcacccttgaggtggagtcctcg 2393 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 2394 gacaccatcgacaatgtcaaggccaagatccaggacaaggagggcattccaccggaccag 2453 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| || || ||||| || |||||| Sbjct: 2454 cagcggctcatctttgctggcaagcagctggaggatggccgtacccttgcagattacaac 2513 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 2514 atccagaaggag 2525 Score = 143 bits (72), Expect = 1e-30 Identities = 162/192 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||| |||||||| ||||| ||| | Sbjct: 2562 atgcagatcttcgtgaagactcttactggcaagacgatcacccttgaggtggagtcctca 2621 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 2622 gacaccattgacaacgtcaaggccaagatccaggacaaggagggcattccaccggaccag 2681 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || || ||||||||| |||||||||| ||||| | |||||||||||| Sbjct: 2682 cagcggctgatcttcgccggcaagcagctggaggatggtcgcaccttggctgactacaac 2741 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 2742 atccagaaggag 2753 Score = 135 bits (68), Expect = 3e-28 Identities = 161/192 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || || |||||||| ||||| ||||| |||||| | Sbjct: 3018 atgcagatctttgtgaagaccttgactggcaagaccataaccctggaggttgagagctcc 3077 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| ||||| || || |||||||| || || || || || |||||| Sbjct: 3078 gacaccatcgacaacgtgaaggcgaagatccaggacaaagagggcatccccccagaccag 3137 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || || ||||||||| |||||||||| ||||| || || ||||||||| Sbjct: 3138 cagcgtctgatcttcgccggcaagcagctggaggatggccgcaccctagcagactacaac 3197 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 3198 atccagaaggag 3209 Score = 127 bits (64), Expect = 6e-26 Identities = 160/192 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||| |||||||| ||||||||| Sbjct: 2106 atgcagatcttcgtgaagactctgactggcaagactatcacccttgaggtcgagtcttct 2165 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||| ||||| ||||||||||| || ||||||||||| || || |||||||||||| Sbjct: 2166 gataccattgacaatgtcaaggccaagatccaggacaaggagggcatccctccggaccag 2225 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||| ||||||||| | ||||| || ||||| ||||| ||||||||| Sbjct: 2226 cagcggctcatttttgccggcaagcagctcgaggacgggcgcacgcttgccgactacaac 2285 Query: 322 attcagaaggag 333 |||||||||||| Sbjct: 2286 attcagaaggag 2297 Score = 111 bits (56), Expect = 4e-21 Identities = 113/132 (85%) Strand = Plus / Plus Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||| || ||||| ||||| || ||||||||||| || ||||| ||||||||| Sbjct: 2850 gacacaatcgataatgtcaaagccaagatccaggacaaggagggcattccaccggaccag 2909 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| ||||||||||||||| |||||||||| || || || || ||||||||| Sbjct: 2910 cagcgcctgatctttgctggcaagcagctggaggatggccgtaccctcgccgactacaac 2969 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 2970 atccagaaggag 2981
>emb|AL161503.2|ATCHRIV15 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 15 Length = 199987 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 58152 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 58211 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||||||||||||| Sbjct: 58212 gacaccattgacaacgtcaaggccaagatccaggacaagga-ggtattcctccggaccag 58270 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 58271 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 58330 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 58331 atccagaaggagtctactcttcacttggtcct 58362 Score = 137 bits (69), Expect = 7e-29 Identities = 183/221 (82%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 57010 agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagct 57069 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| | Sbjct: 57070 ccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggatc 57129 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | | || || || ||||||||| | |||||||| || || | ||||| |||| Sbjct: 57130 agcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattaca 57189 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctc 360 | || |||||||| || || || |||||||||||||||||| Sbjct: 57190 atatccagaaggaatccaccctccacttggtcctcaggctc 57230 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 57924 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 57983 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 57984 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 58043 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 58044 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 58103 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 58104 atccagaaggagtcgacccttcacttggt 58132 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 57240 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 57299 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 57300 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 57359 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 57360 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 57419 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 57420 atccagaaggagtccacccttca 57442 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 57696 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 57755 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 57756 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 57815 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 57816 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 57875 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 57876 attcagaaggagtccacacttcacttggtc 57905 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 57639 gactacaacattcagaaggagtccacactccacttggtc 57677
>emb|AJ223328.1|NTAJ3328 Nicotiana tabacum TUQG2 gene, complete CDS Length = 2074 Score = 174 bits (88), Expect = 3e-40 Identities = 166/192 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||||||||||||||| || |||||||||||||||||||| ||| | Sbjct: 631 atgcaaatcttcgtcaagaccctcaccggcaagaccatcaccctcgaggttgagtcttcc 690 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| || ||| |||| |||||||||||||| || || ||||| |||||| Sbjct: 691 gataccatcgacaatgtgaagtccaagattcaggacaaggagggcatccctcctgaccag 750 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||||||||| ||||||||||||||| | |||||||| ||||| ||| |||| |||||| Sbjct: 751 cagcgtttgatctttgctggcaagcagctcgaggatggccgcaccctttctgattacaac 810 Query: 322 attcagaaggag 333 || ||||||||| Sbjct: 811 atccagaaggag 822 Score = 97.6 bits (49), Expect = 6e-17 Identities = 159/193 (82%), Gaps = 2/193 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || ||||||||||| | ||||||||| || | Sbjct: 1142 atgcagatcttcgtcaagacccttactggcaagaccatcactttggaggtcgagt-catc 1200 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||| || ||| |||| || ||||| ||||| || |||||||| ||||| Sbjct: 1201 agacaccatcgacaatgtgaagtccaagatccaggataaggagggtattcctcctgacca 1260 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || |||||||| |||||| | ||||| || || || || |||||||| Sbjct: 1261 gcagcgtcttatctttgctggtaagcagcttgaggacggccgtaccctgagcgactacaa 1320 Query: 321 cattcagaaggag 333 ||| ||||||||| Sbjct: 1321 catccagaaggag 1333 Score = 91.7 bits (46), Expect = 3e-15 Identities = 127/154 (82%) Strand = Plus / Plus Query: 152 tcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagcgacaccatcg 211 |||||||||||||||| || ||||||||||| || ||||||||| | ||| ||||||| Sbjct: 924 tcgtcaagaccctcaccggcaagaccatcactcttgaggtcgagtcctccgataccatcg 983 Query: 212 acaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccagcagcgtttga 271 |||| || ||| | || || ||||||||||| || || ||||| ||||||||||| ||| Sbjct: 984 acaatgttaagtcgaagatccaggacaaggagggcatccctcctgaccagcagcgcctga 1043 Query: 272 tatttgctggcaagcagttggaggatggacgcac 305 | || ||||| |||||| | |||||||| ||||| Sbjct: 1044 tcttcgctggtaagcagctcgaggatggccgcac 1077 Score = 75.8 bits (38), Expect = 2e-10 Identities = 77/90 (85%) Strand = Plus / Plus Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| ||||| |||||||||||| |||| |||||||| ||||| || || ||||| ||| Sbjct: 1427 agcgataccattgacaacgtcaagtccaagattcaggataaggagggtatccctcctgac 1486 Query: 259 cagcagcgtttgatatttgctggcaagcag 288 ||||||||| | || |||||||| |||||| Sbjct: 1487 cagcagcgtcttatctttgctggtaagcag 1516
>gb|AC158180.2| Selaginella moellendorffii chromosome JGIASXY-5A14, complete sequence Length = 36906 Score = 174 bits (88), Expect = 3e-40 Identities = 181/212 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| ||||||||||||||| | ||||||||||| ||||| |||||||| |||||| | Sbjct: 4632 atgcaaatcttcgtcaagaccttgacggggaagacgatcacgctcgaggtggagagctcc 4691 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || |||||||| ||| |||| || |||||||||||||| ||||||||||||||| Sbjct: 4692 gacacaattgacaacgtgaagaccaagatccaggacaaggaaggcattcctccggaccag 4751 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||||||||| ||||| ||||||||| | || ||||| || || || || ||||||||| Sbjct: 4752 cagcgtttgatctttgcgggcaagcagctagaagatggccggactctggccgactacaac 4811 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || |||||||| || || || || |||||||| Sbjct: 4812 atccagaaggaatccacgctccatttggtcct 4843 Score = 174 bits (88), Expect = 3e-40 Identities = 181/212 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| ||||||||||||||| | ||||||||||| ||||| |||||||| |||||| | Sbjct: 4860 atgcaaatcttcgtcaagaccttgacggggaagacgatcacgctcgaggtggagagctcc 4919 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || |||||||| ||| |||| || |||||||||||||| || || ||||||||| Sbjct: 4920 gacacaattgacaacgtgaagaccaagatccaggacaaggaaggtatccccccggaccag 4979 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||||||||| ||||| ||||||||| | || ||||| || || || || ||||||||| Sbjct: 4980 cagcgtttgatctttgcgggcaagcagctagaagatggccggactctggccgactacaac 5039 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || |||||||||||||| || || |||||||| Sbjct: 5040 atccagaaggagtcgacgctccatttggtcct 5071 Score = 159 bits (80), Expect = 2e-35 Identities = 179/212 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| || |||||||||||||| ||||||||||| || || |||||||| |||||| | Sbjct: 4404 atgcaaattttcgtcaagaccctaacggggaagacgattacgctcgaggtggagagctcc 4463 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| ||| |||| || |||||||||||||| || |||||||||||| Sbjct: 4464 gacacgatcgacaacgttaagaccaagatccaggacaaggaaggcatccctccggaccag 4523 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| ||||| ||||||||| | || ||||| || || ||||| ||||||||| Sbjct: 4524 cagcgattgatctttgccggcaagcagctagaagatggccggactcttgccgactacaac 4583 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || || ||||| || || || || |||||||| Sbjct: 4584 atccaaaaggaatctacgctccatttggtcct 4615 Score = 153 bits (77), Expect = 1e-33 Identities = 176/209 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| || ||||||||||||||||| |||||||| |||||| | ||||| |||||| Sbjct: 5088 atgcaaattttcgtcaagaccctcacagggaagacgatcaccttggaggtggagagctcg 5147 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| ||||||||||| ||| |||| || |||||||||||||| || || ||||||||| Sbjct: 5148 gacacgatcgacaacgtgaagaccaagatccaggacaaggaaggcatccccccggaccag 5207 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| || || ||||||||| | ||||| || ||||| ||||| ||||||||| Sbjct: 5208 cagcgattgatcttcgcaggcaagcagcttgaggacggccgcactcttgcggactacaac 5267 Query: 322 attcagaaggagtcgactcttcacttggt 350 || || |||||||| || |||||| |||| Sbjct: 5268 atccaaaaggagtctacgcttcacctggt 5296 Score = 139 bits (70), Expect = 2e-29 Identities = 166/198 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || ||||| ||||| || ||||| ||||| ||||||||||||||| Sbjct: 4175 gatgcagatctttgtgaagactctcaccggcaagacgatcacgctcgaggtcgagagctc 4234 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||| ||||| || || ||| | || || ||||| ||||| || |||||||||||||| Sbjct: 4235 cgacacgatcgataatgttaagtcgaagatccaggataaggagggaattcctccggacca 4294 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||||| ||||| ||||| ||||||||| | ||||| || ||||| || || || ||||| Sbjct: 4295 gcagcgattgatctttgccggcaagcagctcgaggaggggcgcacgctcgcggattacaa 4354 Query: 321 cattcagaaggagtcgac 338 ||| |||||||||||||| Sbjct: 4355 catccagaaggagtcgac 4372 Score = 129 bits (65), Expect = 2e-26 Identities = 164/197 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| ||||| || ||||| |||||| | ||||| |||||| | Sbjct: 5316 atgcaaatcttcgtgaagactctcactggcaagacgatcaccttggaggtagagagctcc 5375 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || |||||||| ||| |||| || ||||||||||| || ||||| ||||||||| Sbjct: 5376 gacacgattgacaacgttaagaccaagatccaggacaaggagggcattccaccggaccag 5435 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || |||||||||||| | |||||||| || || |||||||| |||||| Sbjct: 5436 cagaggctcatcttcgctggcaagcagctcgaggatggccggactcttgctgattacaac 5495 Query: 322 attcagaaggagtcgac 338 || |||||||||||||| Sbjct: 5496 atccagaaggagtcgac 5512
>gb|DQ320121.1| Binary vector pBINPLUS/ARS, complete sequence Length = 12460 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 |||||||||||||||||| |||||| | ||||||||||| |||||||| ||||| ||| Sbjct: 7711 gaagatgcagatcttcgtgaagaccttaacggggaagacgatcaccctagaggttgagtc 7770 Query: 198 cagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgga 257 ||||||||||||||| ||||| ||||| || |||||||||||||||||||| || || Sbjct: 7771 ttccgacaccatcgacaatgtcaaagccaagatccaggacaaggaagggattcccccaga 7830 Query: 258 ccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgacta 317 ||||||||||||||| || || || |||||| | |||||||| || || ||||| ||||| Sbjct: 7831 ccagcagcgtttgattttcgccggaaagcagcttgaggatggtcgtactcttgccgacta 7890 Query: 318 caacattcagaaggagtcgactct 341 |||||| ||||||||||| ||||| Sbjct: 7891 caacatccagaaggagtcaactct 7914
>gb|AF148448.1|AF148448 Sporobolus stapfianus polyubiquitin mRNA, complete cds Length = 1423 Score = 174 bits (88), Expect = 3e-40 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || ||||||||||| || ||||| ||| | Sbjct: 294 atgcagatcttcgtgaagaccctcaccggcaagaccatcacgcttgaggtggagtcctcg 353 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 354 gacaccatcgacaacgtgaaggccaagatccaggacaaggagggcattcccccggaccag 413 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||| || || || ||||||||||||||| Sbjct: 414 cagcgtctcatcttcgctgggaagcagcttgaggacggccgtacccttgctgactacaac 473 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| ||||||| ||||||||||| Sbjct: 474 atccagaaggagtccaccctccacctggtcctgaggctcagggg 517 Score = 174 bits (88), Expect = 3e-40 Identities = 190/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || ||||||||||| || ||||| ||| | Sbjct: 522 atgcagatcttcgtgaagaccctcaccggcaagaccatcacgcttgaggtggagtcctcg 581 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || |||||||||||||| || |||||||||||| Sbjct: 582 gacaccatcgacaacgtgaaggccaagatccaggacaaggaaggcatccctccggaccag 641 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||| || || || |||||||| |||||| Sbjct: 642 cagcgtctcatcttcgctgggaagcagcttgaggacggccgtacccttgctgattacaac 701 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | ||||||||||||||||| Sbjct: 702 atccagaaggagtccaccctccaccttgtcctcaggctcagggg 745 Score = 167 bits (84), Expect = 7e-38 Identities = 189/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||||||||| || |||||||||||||| ||||| ||| | Sbjct: 750 atgcagatctttgtgaagaccctcaccggcaagaccatcacccttgaggtggagtcctcg 809 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 810 gacaccatcgacaacgtgaaggccaagatccaggacaaggagggcatccccccggaccag 869 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || |||||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 870 cagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctcgccgactacaac 929 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | ||||| ||||||||||| Sbjct: 930 atccagaaggagtccaccctccacctcgtcctgaggctcagggg 973 Score = 165 bits (83), Expect = 3e-37 Identities = 191/227 (84%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 63 aagatgcagatcttcgtaaagaccctcaccggcaagaccatcaccctcgaggttgagtcc 122 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 || ||||| |||||||||||||| || || ||||||||||| || || || |||||| Sbjct: 123 tcggataccattgacaacgtcaaggcaaagatccaggacaaggagggaatccccccggac 182 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || ||||| |||||| | ||||| || || || |||||||| ||| Sbjct: 183 cagcagcgtctcatcttcgctgggaagcagcttgaggacggccgtacccttgctgattac 242 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| ||||||||||| || || ||| | ||||||||||||||||| Sbjct: 243 aacatccagaaggagtccaccctccaccttgtcctcaggctcagggg 289 Score = 149 bits (75), Expect = 2e-32 Identities = 167/195 (85%), Gaps = 2/195 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| || |||||||||||||| || |||||||||||||| ||||| ||| || | Sbjct: 978 atgcagatttttgtcaagaccctcactggcaagaccatcaccctggaggtggagt-catc 1036 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||| || ||||| || || ||||||||||| || || || |||||||| Sbjct: 1037 tgacaccatcgacaatgttaaggcaaagatccaggacaaggagggcatcccgccggacca 1096 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| |||| ||||||||||||||| |||||||||| ||||| || || || ||||| Sbjct: 1097 gcagcgtctgatctttgctggcaagcagctggaggatggccgcaccctggcggattacaa 1156 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 1157 catccagaaggagtc 1171
>gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana clone C17L7, Chromosome IV, complete sequence Length = 183147 Score = 174 bits (88), Expect = 3e-40 Identities = 182/212 (85%), Gaps = 1/212 (0%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| | || || |||||||||||||| || || || ||| | Sbjct: 1395 atgcagatcttcgtcaagactttgaccggaaagaccatcacccttgaagtggaaagctcc 1336 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || ||||||||||||||| Sbjct: 1335 gacaccattgacaacgtcaaggccaagatccaggacaagga-ggtattcctccggaccag 1277 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 1276 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 1217 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || ||||||||||| ||||||||||||||||| Sbjct: 1216 atccagaaggagtctactcttcacttggtcct 1185 Score = 161 bits (81), Expect = 5e-36 Identities = 180/213 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| | || || ||||||||||| || || || |||||| | Sbjct: 132590 atgcagatcttcgtaaagactttgaccggaaagaccatcactcttgaagttgagagctcc 132649 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||| || || |||||||||||||| ||||||||||||||| Sbjct: 132650 gacaccattgataacgtgaaggctaagatccaggacaaggaaggcattcctccggaccag 132709 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 132710 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 132769 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || ||||||||||| |||||||||||||||||| Sbjct: 132770 atccagaaggagtctactcttcacttggtcctc 132802 Score = 145 bits (73), Expect = 3e-31 Identities = 184/221 (83%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||||| ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 132132 agatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggtggaaagct 132191 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| | Sbjct: 132192 ctgacaccatcgacaacgttaaggccaagatccaggataaggaaggtattcctccggatc 132251 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | | || || || || ||||||||||||||||| ||||| | || || |||| Sbjct: 132252 agcagaggcttatcttcgccggaaagcagttggaggatggccgcacgttggcggattaca 132311 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctc 360 | || |||||||| || || || |||||||| ||||||||| Sbjct: 132312 atatccagaaggaatccaccctccacttggttctcaggctc 132352 Score = 137 bits (69), Expect = 7e-29 Identities = 174/209 (83%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| | ||||| |||||| Sbjct: 1623 atgcagatcttcgtgaagactctcaccggaaagactatcactttggaggtagagagctct 1564 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||| Sbjct: 1563 gacaccattgacaacgtgaaggccaagatccaggataaggaaggaatccctccggaccag 1504 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || || || ||||||||||| || || | || || |||||| Sbjct: 1503 cagaggttgatctttgccggaaaacaattggaggatggtcgtactttggcggattacaac 1444 Query: 322 attcagaaggagtcgactcttcacttggt 350 || |||||||||||||| ||||||||||| Sbjct: 1443 atccagaaggagtcgacccttcacttggt 1415 Score = 137 bits (69), Expect = 7e-29 Identities = 183/221 (82%) Strand = Plus / Minus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 2537 agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggtggaaagct 2478 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||||||||||| |||||||| || ||||| ||||| || ||||||||||| | Sbjct: 2477 ccgacaccatcgacaacgttaaggccaagatccaggataaggagggcattcctccggatc 2418 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | | || || || ||||||||| | |||||||| || || | ||||| |||| Sbjct: 2417 agcagaggcttattttcgccggcaagcagctagaggatggccgtacgttggctgattaca 2358 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctc 360 | || |||||||| || || || |||||||||||||||||| Sbjct: 2357 atatccagaaggaatccaccctccacttggtcctcaggctc 2317 Score = 125 bits (63), Expect = 2e-25 Identities = 168/203 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| ||||| Sbjct: 2307 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagttct 2248 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || ||||| || || ||||||||||||||| Sbjct: 2247 gacaccatcgacaacgtcaaggccaagatccaagacaaagagggtattcctccggaccag 2188 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || ||||||||||||||||| | || |||||||||||||| Sbjct: 2187 cagaggctgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaat 2128 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 2127 atccagaaggagtccacccttca 2105 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||||||||| | ||||| ||||| Sbjct: 1851 atgcagatcttcgtgaagactctcaccggaaagaccatcactttggaggtggagagttct 1792 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| || |||||||| || || || || ||||||||| Sbjct: 1791 gacaccattgataacgtgaaagccaagatccaggacaaagagggtatcccaccggaccag 1732 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||| | || |||||| | || | |||||||||||| Sbjct: 1731 cagagattgatcttcgccggaaagcaacttgaagatggaagaactttggctgactacaac 1672 Query: 322 attcagaaggagtcgactcttcacttggtc 351 |||||||||||||| || |||||||||||| Sbjct: 1671 attcagaaggagtccacacttcacttggtc 1642 Score = 85.7 bits (43), Expect = 2e-13 Identities = 103/123 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| || ||||| ||||| ||||| || || || ||||| |||||| Sbjct: 132362 atgcagattttcgttaaaaccctaacgggaaagacgattactcttgaggtggagagctct 132421 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || || || ||||| || ||||||||||||||| Sbjct: 132422 gacaccattgacaacgtcaaggccaagatccaagataaggagggtattcctccggaccag 132481 Query: 262 cag 264 ||| Sbjct: 132482 cag 132484 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 313 gactacaacattcagaaggagtcgactcttcacttggtc 351 ||||||||||||||||||||||| || || ||||||||| Sbjct: 1908 gactacaacattcagaaggagtccacactccacttggtc 1870
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 174 bits (88), Expect = 3e-40 Identities = 172/200 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| | Sbjct: 2265347 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttcc 2265406 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||| |||| ||||||||||||||||| ||||| ||||||||| Sbjct: 2265407 gacaccatcgacaatgtcaagtccaagattcaggacaaggaaggaattcccccggaccag 2265466 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| |||||||| |||||| | |||||||| || || ||| ||||||||||| Sbjct: 2265467 cagcgactgatttttgctggtaagcagctcgaggatggccgaactctttctgactacaac 2265526 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 2265527 attcagaaggagtccactct 2265546 Score = 153 bits (77), Expect = 1e-33 Identities = 125/141 (88%) Strand = Plus / Plus Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||| |||| |||||||||||||| || |||||||||||||| Sbjct: 2264494 cgacaccatcgacaacgtcaagtccaagattcaggacaaggagggaattcctccggacca 2264553 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||||| |||| |||||||| |||||| | |||||||| || || || |||||||||| Sbjct: 2264554 gcagcgactgatttttgctggtaagcagctcgaggatggtcgaaccctgtctgactacaa 2264613 Query: 321 cattcagaaggagtcgactct 341 ||||||||||||||| ||||| Sbjct: 2264614 cattcagaaggagtccactct 2264634 Score = 151 bits (76), Expect = 4e-33 Identities = 169/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| | Sbjct: 2264891 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttcc 2264950 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||| |||| |||||||||||||| || ||||| ||||||||| Sbjct: 2264951 gacaccatcgacaatgtcaagtccaagattcaggacaaggagggaattcccccggaccag 2265010 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || ||||| |||||| | |||||||| || || ||| | ||||||||| Sbjct: 2265011 cagcgactgattttcgctggtaagcagctcgaggatggtcgaactctttccgactacaac 2265070 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 2265071 attcagaaggagtccactct 2265090 Score = 151 bits (76), Expect = 4e-33 Identities = 169/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| | Sbjct: 2265119 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttcc 2265178 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| |||||| |||| |||||||||||||| || ||||| ||||||||| Sbjct: 2265179 gacaccatcgacaatgtcaagtccaagattcaggacaaggagggaattcccccggaccag 2265238 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| || ||||| |||||| | |||||||| || || ||| | ||||||||| Sbjct: 2265239 cagcgactgattttcgctggtaagcagctcgaggatggtcgaactctttccgactacaac 2265298 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 2265299 attcagaaggagtccactct 2265318 Score = 127 bits (64), Expect = 6e-26 Identities = 166/200 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| ||| Sbjct: 2264663 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttgagtcttct 2264722 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || || || |||||| |||| |||||||||||||| || ||||| ||||||||| Sbjct: 2264723 gacactattgataatgtcaagtccaagattcaggacaaggagggaattcccccggaccag 2264782 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| |||||||| |||||| | |||||||| || || ||| | ||||||||| Sbjct: 2264783 cagcgactgatttttgctggtaagcagctcgaggatggtcgaactctttccgactacaac 2264842 Query: 322 attcagaaggagtcgactct 341 |||||||||||||| ||||| Sbjct: 2264843 attcagaaggagtccactct 2264862 Score = 113 bits (57), Expect = 1e-21 Identities = 167/201 (83%), Gaps = 2/201 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||||||||| || || || ||||||||||| |||||||| || | | | Sbjct: 2265575 atgcagattttcgtcaagactctgactggaaagaccatcactctcgaggttga-atcttc 2265633 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||| || || || |||||| |||| |||||||||||||| || ||||| |||||||| Sbjct: 2265634 tgacactattgataatgtcaagtccaagattcaggacaaggagggaattcccccggacca 2265693 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||||| |||| |||||||| |||||| | |||||||| || || ||| | |||||||| Sbjct: 2265694 gcagcgactgatttttgctggtaagcagcttgaggatggccgaactctttccgactacaa 2265753 Query: 321 cattcagaaggagtcgactct 341 ||| ||||||||||| ||||| Sbjct: 2265754 catccagaaggagtccactct 2265774 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggt 191 |||||||| ||||||||||| || || || ||||||||||| || ||||| Sbjct: 2264336 atgcagattttcgtcaagacgctgaccggtaagaccatcacgcttgaggt 2264385
>gb|L22576.1|POTUBI3A Solanum tuberosum ubiquitin/ribosomal fusion protein (ubi3) gene, complete cds Length = 1567 Score = 174 bits (88), Expect = 3e-40 Identities = 175/204 (85%) Strand = Plus / Plus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 |||||||||||||||||| |||||| | ||||||||||| |||||||| ||||| ||| Sbjct: 917 gaagatgcagatcttcgtgaagaccttaacggggaagacgatcaccctagaggttgagtc 976 Query: 198 cagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgga 257 ||||||||||||||| ||||| ||||| || |||||||||||||||||||| || || Sbjct: 977 ttccgacaccatcgacaatgtcaaagccaagatccaggacaaggaagggattcccccaga 1036 Query: 258 ccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgacta 317 ||||||||||||||| || || || |||||| | |||||||| || || ||||| ||||| Sbjct: 1037 ccagcagcgtttgattttcgccggaaagcagcttgaggatggtcgtactcttgccgacta 1096 Query: 318 caacattcagaaggagtcgactct 341 |||||| ||||||||||| ||||| Sbjct: 1097 caacatccagaaggagtcaactct 1120
>gb|DQ244967.1| Zea mays clone 11964 mRNA sequence Length = 673 Score = 172 bits (87), Expect = 1e-39 Identities = 177/207 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 89 aagatgcagatcttcgtgaagaccctgacgggaaagaccatcaccctcgaggtcgagagc 148 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| || |||||||| ||||||||||| || |||||||||||||| || || |||||| Sbjct: 149 agcgatacaatcgacaatgtcaaggccaagatccaggacaaggaaggtatcccgccggac 208 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || || |||||| | || || || ||||| | || |||||| Sbjct: 209 cagcagcgactaatcttcgcggggaagcagctcgaagacggccgcaccttggccgactac 268 Query: 319 aacattcagaaggagtcgactcttcac 345 ||||| ||||||||||| || |||||| Sbjct: 269 aacatccagaaggagtccacccttcac 295
>gb|AY372537.1| Cucumis sativus ubiquitin extension protein mRNA, complete cds Length = 675 Score = 172 bits (87), Expect = 1e-39 Identities = 165/191 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || ||||| ||||| ||||||||||| ||||| ||||||||| | Sbjct: 17 atgcagatcttcgtgaaaaccctaacgggtaagaccatcactctcgaagtcgagagctcc 76 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| |||||||| || || |||||||||||||| || |||||||||||| Sbjct: 77 gataccatcgacaatgtcaaggcaaagatccaggacaaggaaggaatccctccggaccag 136 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||||||||| || || || |||||| | ||||| || || ||||| || ||||||||| Sbjct: 137 cagcgtttgattttcgccggaaagcagcttgaggacggccgaacactagccgactacaac 196 Query: 322 attcagaagga 332 ||||||||||| Sbjct: 197 attcagaagga 207
>dbj|D28123.1|SOYSUBI3 Glycine max SUBI-3 gene for ubiquitin, complete cds Length = 2170 Score = 172 bits (87), Expect = 1e-39 Identities = 183/215 (85%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 |||||||||||||||||||||||||||| || |||||||||||||| ||||| || ||| Sbjct: 918 agatgcagatcttcgtcaagaccctcaccggcaagaccatcacccttgaggtggaaagct 977 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||||||||||||||||||| || |||||||||||||| || || ||||||| Sbjct: 978 ctgacaccatcgacaacgtcaaggccaagatccaggacaaggaaggaatccccccggacc 1037 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||| ||| | || || || || ||||| | ||||| || || || ||||||||||||| Sbjct: 1038 agcaacgtctcattttcgccggaaagcaacttgaggacggccgtacccttgctgactaca 1097 Query: 320 acattcagaaggagtcgactcttcacttggtcctc 354 |||||||||||||| ||||||||| | |||||| Sbjct: 1098 acattcagaaggagagtactcttcacctcgtcctc 1132 Score = 168 bits (85), Expect = 2e-38 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || ||||| || ||||| || ||||| ||| | Sbjct: 1376 atgcagatcttcgttaagaccctcaccggcaagactattaccctagaagtcgaaagctcc 1435 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||||||||| || |||||||||||||| || || || || |||||| Sbjct: 1436 gacaccatcgacaacgtcaaggctaagattcaggacaaggagggaatccccccagaccag 1495 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || || |||||| | ||||| |||||||| ||||||||||||||| Sbjct: 1496 cagaggctgatcttcgccgggaagcagctcgaggacggacgcacccttgctgactacaac 1555 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| ||||| |||||||| Sbjct: 1556 atccagaaggagtcaactctccacttggt 1584 Score = 153 bits (77), Expect = 1e-33 Identities = 179/213 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| || ||||| ||||| || ||||||||||| |||||| Sbjct: 1604 atgcagattttcgtgaagactcttacgggtaagactattaccctcgaggtggagagctct 1663 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| || |||||||| ||||||||||||||||| || || ||||||||| Sbjct: 1664 gacaccattgacaatgtgaaggccaagattcaggacaaggaaggcatcccaccggaccag 1723 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | ||||||||| | || || |||||||||||| Sbjct: 1724 cagaggctgatttttgctggcaagcagctcgaggatggaaggaccctcgctgactacaac 1783 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || |||||||| || || |||||| | |||||| Sbjct: 1784 atccagaaggaatcaacccttcaccttgtcctc 1816 Score = 129 bits (65), Expect = 2e-26 Identities = 176/213 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || |||||||| ||||| ||||| || ||| | Sbjct: 1148 atgcagatcttcgttaagacactcaccggcaagaccataaccctagaggttgaaagctcc 1207 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| |||||||||||||| || ||||||||||| || || || ||||||||| Sbjct: 1208 gacaccatcgataacgtcaaggccaagatccaggacaaggagggtatccccccggaccag 1267 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 || ||| | || || || || |||||| | ||||| || ||||| || || ||||||||| Sbjct: 1268 caacgtctcatcttcgccggaaagcagctcgaggacggccgcaccctcgccgactacaac 1327 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || |||||||| || || |||||| | |||||| Sbjct: 1328 atccagaaggaatcaacccttcacctcgtcctc 1360 Score = 48.1 bits (24), Expect = 0.047 Identities = 30/32 (93%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagct 518 ||||| |||||||||| ||||||||||||||| Sbjct: 1721 cagcagaggctgatttttgctggcaagcagct 1752
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7 Length = 29644043 Score = 172 bits (87), Expect = 1e-39 Identities = 102/107 (95%) Strand = Plus / Minus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| Sbjct: 18081713 aagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtcgagagc 18081654 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||| ||||||||||| || |||||||||||||| Sbjct: 18081653 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagg 18081607 Score = 63.9 bits (32), Expect = 8e-07 Identities = 80/96 (83%) Strand = Plus / Minus Query: 243 agggattcctccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacg 302 |||||| || |||||||||||||| |||| || || || |||||| ||||||| || || Sbjct: 18081412 agggatcccgccggaccagcagcggctgatcttcgccgggaagcagctggaggacggccg 18081353 Query: 303 cacacttgctgactacaacattcagaaggagtcgac 338 || || || ||||||||||| |||||||||||||| Sbjct: 18081352 gacgctggccgactacaacatccagaaggagtcgac 18081317 Score = 56.0 bits (28), Expect = 2e-04 Identities = 55/64 (85%) Strand = Plus / Plus Query: 177 catcaccctcgaggtcgagagcagcgacaccatcgacaacgtcaaggccaaaattcagga 236 |||||| || ||||||||| ||||||||||||||| | ||||||||| ||| || || || Sbjct: 18301453 catcacgctggaggtcgagggcagcgacaccatcggcgacgtcaaggtcaagatccacga 18301512 Query: 237 caag 240 |||| Sbjct: 18301513 caag 18301516
>gb|AY086967.1| Arabidopsis thaliana clone 3001 mRNA, complete sequence Length = 929 Score = 172 bits (87), Expect = 1e-39 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| ||||| || ||||| |||||| Sbjct: 295 atgcagatcttcgttaagactctcacsggaaagackatcactcttgaggtagagagctct 354 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||| |||||||| || |||||||||||| Sbjct: 355 gacaccattgacaacgtcaaggccaagatccaggataaggaaggtatccctccggaccag 414 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || |||||||||||||| || || | ||||| |||||| Sbjct: 415 cagaggttgatcttcgccggtaaacagttggaggatggtcgtaccttggctgattacaac 474 Query: 322 attcagaaggagtcgactcttcacttggt 350 ||||||||||||||||| ||||||||||| Sbjct: 475 attcagaaggagtcgacccttcacttggt 503 Score = 161 bits (81), Expect = 5e-36 Identities = 180/213 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| | || || ||||| ||||| || || || |||||| | Sbjct: 523 atgcagatcttcgttaagactttgaccggmaagactatcactcttgaagtggagagctcc 582 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| |||||||| || |||||||||||||| || |||||||||||| Sbjct: 583 gacaccattgacaacgtgaaggccaagatccaggacaaggaaggtatccctccggaccag 642 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || ||||||||| Sbjct: 643 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacaac 702 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || ||||||||||| |||||||||||||||||| Sbjct: 703 atccagaaggagtctactcttcacttggtcctc 735 Score = 123 bits (62), Expect = 1e-24 Identities = 110/126 (87%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 64 aagatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggtggaaagc 123 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| Sbjct: 124 tctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggat 183 Query: 259 cagcag 264 |||||| Sbjct: 184 cagcag 189
>dbj|AP005190.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0477A12 Length = 138141 Score = 172 bits (87), Expect = 1e-39 Identities = 102/107 (95%) Strand = Plus / Minus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| Sbjct: 17019 aagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtcgagagc 16960 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||| ||||||||||| || |||||||||||||| Sbjct: 16959 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagg 16913 Score = 63.9 bits (32), Expect = 8e-07 Identities = 80/96 (83%) Strand = Plus / Minus Query: 243 agggattcctccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacg 302 |||||| || |||||||||||||| |||| || || || |||||| ||||||| || || Sbjct: 16718 agggatcccgccggaccagcagcggctgatcttcgccgggaagcagctggaggacggccg 16659 Query: 303 cacacttgctgactacaacattcagaaggagtcgac 338 || || || ||||||||||| |||||||||||||| Sbjct: 16658 gacgctggccgactacaacatccagaaggagtcgac 16623
>dbj|AP005515.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0064M11 Length = 164263 Score = 172 bits (87), Expect = 1e-39 Identities = 102/107 (95%) Strand = Plus / Minus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| Sbjct: 159872 aagatgcagatcttcgtgaagaccctgacggggaagaccatcaccctcgaggtcgagagc 159813 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||| ||||||||||| || |||||||||||||| Sbjct: 159812 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagg 159766 Score = 63.9 bits (32), Expect = 8e-07 Identities = 80/96 (83%) Strand = Plus / Minus Query: 243 agggattcctccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacg 302 |||||| || |||||||||||||| |||| || || || |||||| ||||||| || || Sbjct: 159571 agggatcccgccggaccagcagcggctgatcttcgccgggaagcagctggaggacggccg 159512 Query: 303 cacacttgctgactacaacattcagaaggagtcgac 338 || || || ||||||||||| |||||||||||||| Sbjct: 159511 gacgctggccgactacaacatccagaaggagtcgac 159476
>gb|AY104762.1| Zea mays PCO089719 mRNA sequence Length = 721 Score = 172 bits (87), Expect = 1e-39 Identities = 177/207 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 103 aagatgcagatcttcgtgaagaccctgacgggaaagaccatcaccctcgaggtcgagagc 162 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||| || |||||||| ||||||||||| || |||||||||||||| || || |||||| Sbjct: 163 agcgatacaatcgacaatgtcaaggccaagatccaggacaaggaaggtatcccgccggac 222 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || || |||||| | || || || ||||| | || |||||| Sbjct: 223 cagcagcgactaatcttcgcggggaagcagctcgaagacggccgcaccttggccgactac 282 Query: 319 aacattcagaaggagtcgactcttcac 345 ||||| ||||||||||| || |||||| Sbjct: 283 aacatccagaaggagtccacccttcac 309
>gb|AY785814.1| Oryza sativa (indica cultivar-group) polyubiquitin (RUBQ1) gene, promoter region and partial cds Length = 1773 Score = 170 bits (86), Expect = 5e-39 Identities = 191/226 (84%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||||||||| || |||||||||||||||||||| ||| | Sbjct: 1535 agatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggttgagtcct 1594 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||| ||||| ||||||||||| || ||||||||||| || || || ||||||| Sbjct: 1595 cggacaccattgacaatgtcaaggccaagatccaggacaaggagggcatccccccggacc 1654 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||||||| | || || |||||||||||| | |||||||| ||||| || || ||||||| Sbjct: 1655 agcagcgtctcatcttcgctggcaagcagcttgaggatggccgcaccctggccgactaca 1714 Query: 320 acattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 |||| ||||||||||| || || ||| | || |||||||||||||| Sbjct: 1715 acatccagaaggagtccaccctccaccttgtgctcaggctcagggg 1760
>emb|CT828447.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN026I10, full insert sequence Length = 1642 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 995 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggttgagagctcg 1054 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 1055 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 1114 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 1115 cagcgtctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactacaac 1174 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1175 atccagaaggagtc 1188 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||| | || |||||||||||||| | ||||| |||||| | Sbjct: 1223 atgcagatcttcgtgaagaccttgactgggaagaccatcactttggaggttgagagctcc 1282 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| |||||||| || |||||| Sbjct: 1283 gacaccattgataatgtgaaggccaagatccaggacaaggaggggattcccccagaccag 1342 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| |||||||||||||||| || || ||||||||| Sbjct: 1343 cagcgtctgatcttcgctggcaagcagctggaggatggacgcaccctcgccgactacaac 1402 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1403 atccagaaggagtc 1416 Score = 161 bits (81), Expect = 5e-36 Identities = 191/225 (84%), Gaps = 2/225 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || |||||||||||||||||||| || | | | Sbjct: 539 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggtgga-atcttc 597 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 598 tgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccggacca 657 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || ||||| ||||||||| | ||||| || | || |||||||||||||| Sbjct: 658 gcagcgtctcatctttgccggcaagcagcttgaggacggcaggacccttgctgactacaa 717 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| | |||||| | |||||||| Sbjct: 718 catccagaaggagtcaacgcttcaccttgtcctccgtctcagggg 762 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| || || || |||||||||||||||||||| ||| Sbjct: 767 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggtggagtcttct 826 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 827 gataccatcgacaatgtcaaggccaagatccaggacaaggagggcattcccccggaccag 886 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| | || ||||||||||||||| Sbjct: 887 cagcgcctcatctttgctggcaagcagctggaggatggcaggacccttgctgactacaac 946 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 947 atccagaaggagtc 960 Score = 127 bits (64), Expect = 6e-26 Identities = 178/216 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| | || || ||||| |||||||||||||| ||| | Sbjct: 80 aagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggtggagtcc 139 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||| || |||||||| || || || || ||||| || || || |||||| Sbjct: 140 tctgacaccatcgataatgtcaaggctaagatccaagataaggagggcatccccccggac 199 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || |||||||||||| |||||||||| | || |||||||||||| Sbjct: 200 cagcagcgtctcatcttcgctggcaagcagctggaggatggcaggacccttgctgactac 259 Query: 319 aacattcagaaggagtcgactcttcacttggtcctc 354 ||||| |||||||||||||| |||||| | |||||| Sbjct: 260 aacatccagaaggagtcgacccttcaccttgtcctc 295 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || ||||| |||||||| ||||| ||| Sbjct: 311 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggtggagtcttct 370 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||| || || || || || |||||| Sbjct: 371 gacaccatcgacaacgtcaaggccaagatccaggacaaagagggcatccccccagaccag 430 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| | || ||||||||||||||| Sbjct: 431 cagcgtctcatcttcgccggcaagcagctggaggatggcaggacccttgctgactacaac 490 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 491 atccagaaggagtc 504
>ref|NM_001052515.1| Oryza sativa (japonica cultivar-group) Os02g0161900 (Os02g0161900) mRNA, complete cds Length = 1641 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 994 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggttgagagctcg 1053 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 1054 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 1113 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 1114 cagcgtctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactacaac 1173 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1174 atccagaaggagtc 1187 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||| | || |||||||||||||| | ||||| |||||| | Sbjct: 1222 atgcagatcttcgtgaagaccttgactgggaagaccatcactttggaggttgagagctcc 1281 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| |||||||| || |||||| Sbjct: 1282 gacaccattgataatgtgaaggccaagatccaggacaaggaggggattcccccagaccag 1341 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| |||||||||||||||| || || ||||||||| Sbjct: 1342 cagcgtctgatcttcgctggcaagcagctggaggatggacgcaccctcgccgactacaac 1401 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1402 atccagaaggagtc 1415 Score = 161 bits (81), Expect = 5e-36 Identities = 191/225 (84%), Gaps = 2/225 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || |||||||||||||||||||| || | | | Sbjct: 538 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggtgga-atcttc 596 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 597 tgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccggacca 656 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || ||||| ||||||||| | ||||| || | || |||||||||||||| Sbjct: 657 gcagcgtctcatctttgccggcaagcagcttgaggacggcaggacccttgctgactacaa 716 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| | |||||| | |||||||| Sbjct: 717 catccagaaggagtcaacgcttcaccttgtcctccgtctcagggg 761 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| || || || |||||||||||||||||||| ||| Sbjct: 766 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggtggagtcttct 825 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 826 gataccatcgacaatgtcaaggccaagatccaggacaaggagggcattcccccggaccag 885 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| | || ||||||||||||||| Sbjct: 886 cagcgcctcatctttgctggcaagcagctggaggatggcaggacccttgctgactacaac 945 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 946 atccagaaggagtc 959 Score = 127 bits (64), Expect = 6e-26 Identities = 178/216 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| | || || ||||| |||||||||||||| ||| | Sbjct: 79 aagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggtggagtcc 138 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||| || |||||||| || || || || ||||| || || || |||||| Sbjct: 139 tctgacaccatcgataatgtcaaggctaagatccaagataaggagggcatccccccggac 198 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || |||||||||||| |||||||||| | || |||||||||||| Sbjct: 199 cagcagcgtctcatcttcgctggcaagcagctggaggatggcaggacccttgctgactac 258 Query: 319 aacattcagaaggagtcgactcttcacttggtcctc 354 ||||| |||||||||||||| |||||| | |||||| Sbjct: 259 aacatccagaaggagtcgacccttcaccttgtcctc 294 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || ||||| |||||||| ||||| ||| Sbjct: 310 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggtggagtcttct 369 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||| || || || || || |||||| Sbjct: 370 gacaccatcgacaacgtcaaggccaagatccaggacaaagagggcatccccccagaccag 429 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| | || ||||||||||||||| Sbjct: 430 cagcgtctcatcttcgccggcaagcagctggaggatggcaggacccttgctgactacaac 489 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 490 atccagaaggagtc 503
>emb|CR732158.2|CNS0GRVN Tetraodon nigroviridis full-length cDNA Length = 800 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 182 atccagaaagagtc 195 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 | ||||||||||| Sbjct: 638 acccagaaggagtc 651 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 614
>emb|CR731610.3|CNS0GRGF Tetraodon nigroviridis full-length cDNA Length = 681 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR729943.2|CNS0GQ65 Tetraodon nigroviridis full-length cDNA Length = 805 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 231 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 290 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| |||||||||||||| ||||| || || ||| Sbjct: 291 gacaccattgagaacgtgaaggccaaaatccaggacaaggaaggcattccccctgatcag 350 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 351 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 410 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 411 atccagaaggagtc 424 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 639 atccagaaggagtc 652 Score = 149 bits (75), Expect = 2e-32 Identities = 166/195 (85%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggatt-cctccggacca 260 |||||||| || ||||| |||||||| || |||||||||||||| ||| || || || || Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccctgatca 121 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 122 gcagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaa 181 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 182 catccagaaggagtc 196 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 330 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 387 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 607 Score = 48.1 bits (24), Expect = 0.047 Identities = 36/40 (90%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 120 cagcagaggctgatctttgctggcaagcagcttgaagatg 159
>emb|CR729662.2|CNS0GPYC Tetraodon nigroviridis full-length cDNA Length = 796 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || |||||||||||||| || |||||||||||||| ||| |||| || ||| Sbjct: 290 gacaccattgagaacgtcaaggccaagatccaggacaaggaaggcattactcctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gataccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 182 atccagaaagagtc 195 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||| |||||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattactcctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 614
>emb|CR728722.3|CNS0GP88 Tetraodon nigroviridis full-length cDNA Length = 881 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 529 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 588 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 589 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 648 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 649 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 708 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 709 atccagaaggagtc 722 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 72 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 131 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 132 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 191 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 192 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 251 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 252 atccagaaggagtc 265 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 300 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 359 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| |||||||||||||| ||| | || || ||| Sbjct: 360 gacaccattgagaacgtgaaggccaaaatccaggacaaggaaggcattgcccctgatcag 419 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 420 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 479 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 480 atccagaaggagtc 493 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 171 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 228 Score = 52.0 bits (26), Expect = 0.003 Identities = 50/58 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||| | |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 399 gaaggcattgcccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 456 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 628 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 677
>emb|CR728585.2|CNS0GP4F Tetraodon nigroviridis full-length cDNA Length = 754 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 531 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 590 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 591 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 650 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 651 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 710 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 711 atccagaaggagtc 724 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 76 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 135 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 136 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 195 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 196 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 255 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 256 atccagaaggagtc 269 Score = 155 bits (78), Expect = 3e-34 Identities = 166/194 (85%), Gaps = 1/194 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 304 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 363 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 364 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcc-cctgatcag 422 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 423 caggggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 482 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 483 atccagaaggagtc 496 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 175 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 232 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 630 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 679 Score = 44.1 bits (22), Expect = 0.73 Identities = 50/58 (86%), Gaps = 1/58 (1%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| ||||||| | ||||||||||||||||| ||||| Sbjct: 403 gaaggcattcc-cctgatcagcaggggctgatctttgctggcaagcagcttgaagatg 459
>emb|CR728104.2|CNS0GOR2 Tetraodon nigroviridis full-length cDNA Length = 814 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaat 181 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 182 atccagaaagagtc 195 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 614
>emb|CR727894.2|CNS0GOL8 Tetraodon nigroviridis full-length cDNA Length = 763 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 540 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 599 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 600 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 659 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 660 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 719 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 720 atccagaaggagtc 733 Score = 133 bits (67), Expect = 1e-27 Identities = 151/179 (84%) Strand = Plus / Plus Query: 157 aagaccctcacggggaagaccatcaccctcgaggtcgagagcagcgacaccatcgacaac 216 ||||||||||| || || ||||||||||||||||| ||| |||||||||||| || ||| Sbjct: 93 aagaccctcactggcaaaaccatcaccctcgaggtggagcccagcgacaccattgagaac 152 Query: 217 gtcaaggccaaaattcaggacaaggaagggattcctccggaccagcagcgtttgatattt 276 || |||||||| || |||||||||||||| ||||| || || |||||| | |||| ||| Sbjct: 153 gtgaaggccaagatccaggacaaggaaggcattccccctgatcagcagaggctgatcttt 212 Query: 277 gctggcaagcagttggaggatggacgcacacttgctgactacaacattcagaaggagtc 335 |||||||||||| | || ||||| ||||| || | ||||||||||| ||||||||||| Sbjct: 213 gctggcaagcagcttgaagatggccgcaccctgtccgactacaacatccagaaggagtc 271 Score = 107 bits (54), Expect = 6e-20 Identities = 97/110 (88%), Gaps = 1/110 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 306 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 365 Query: 202 gacacc-atcgacaacgtcaaggccaaaattcaggacaaggaagggattc 250 |||||| || || ||||| |||||||| || |||||||||||||| |||| Sbjct: 366 gacaccaattgagaacgtgaaggccaagatccaggacaaggaaggcattc 415 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 177 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 234 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 639 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 688
>emb|CR727267.2|CNS0GO3T Tetraodon nigroviridis full-length cDNA Length = 855 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 528 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 587 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 588 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 647 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 648 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 707 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 708 atccagaaggagtc 721 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 300 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 359 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 360 cacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 419 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 420 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 479 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 480 atccagaaggagtc 493 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 72 atgcagatcttcgtaaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 131 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 132 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 191 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| | | ||||||||| Sbjct: 192 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccccgtccgactacaac 251 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 252 atccagaaggagtc 265 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 171 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 228 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 399 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 456 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 627 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 676
>emb|CR725933.2|CNS0GN2R Tetraodon nigroviridis full-length cDNA Length = 778 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 639 atccagaaggagtc 652 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 231 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 290 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 291 gacaccattgagaacgtgaagaccaaaatccaggacaaggaaggcattccccctgatcag 350 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 351 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 410 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 411 atccagaaggagtc 424 Score = 149 bits (75), Expect = 2e-32 Identities = 166/195 (85%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggatt-cctccggacca 260 |||||||| || ||||| |||||||| || |||||||||||||| ||| || || || || Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccctgatca 121 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 122 gcagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaa 181 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 182 catccagaaggagtc 196 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 330 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 387 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 607 Score = 48.1 bits (24), Expect = 0.047 Identities = 36/40 (90%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 120 cagcagaggctgatctttgctggcaagcagcttgaagatg 159
>emb|CR725134.1|CNS0GMGK Tetraodon nigroviridis full-length cDNA Length = 870 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 297 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 356 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| |||||||||||||| ||||| || || ||| Sbjct: 357 gacaccattgagaacgtgaaggccaaaatccaggacaaggaaggcattccccctgatcag 416 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 417 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 476 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 477 atccagaaggagtc 490 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 525 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 584 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 585 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 644 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 645 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 704 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 705 atccagaaggagtc 718 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 69 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 128 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 129 cacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 188 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 189 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 248 Query: 322 attcagaaggagtc 335 || ||| ||||||| Sbjct: 249 atccaggaggagtc 262 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 168 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 225 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 396 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 453 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 624 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 673
>emb|CR703179.2|CNS0G5IV Tetraodon nigroviridis full-length cDNA Length = 796 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 378
>emb|CR701051.2|CNS0G3VR Tetraodon nigroviridis full-length cDNA Length = 811 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 639 atccagaaggagtc 652 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 607
>emb|CR687506.2|CNS0FTFI Tetraodon nigroviridis full-length cDNA Length = 803 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||| ||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtcaagaccaaaatccaggacaaagaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 145 bits (73), Expect = 3e-31 Identities = 163/193 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| |||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcgttccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| | | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagctggaagatggccgcaccatgtccgactacaac 409 Query: 322 attcagaaggagt 334 || |||||||||| Sbjct: 410 atccagaaggagt 422 Score = 133 bits (67), Expect = 1e-27 Identities = 164/195 (84%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||| ||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctgactggcaaaaccataaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagc-agttggaggatggacgcacacttgctgactacaa 320 ||| | |||| ||||||||||||| || |||| ||||| ||||| || | |||||||| Sbjct: 578 cagaggctgatctttgctggcaagcaagctggaagatggccgcaccctgtccgactacaa 637 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 638 catccagaaggagtc 652 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 93 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 54.0 bits (27), Expect = 8e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagca 515 |||| |||||||||||||| |||| ||||| |||||||| | |||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagca 603 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||||| |||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 329 gaaggcgttccccctgatcagcagaggctgatctttgctggcaagcagct 378
>emb|CR683554.2|CNS0FQDQ Tetraodon nigroviridis full-length cDNA Length = 778 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 444 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 503 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 504 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 563 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 564 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 623 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 624 atccagaaggagtc 637 Score = 121 bits (61), Expect = 4e-24 Identities = 136/161 (84%) Strand = Plus / Plus Query: 175 accatcaccctcgaggtcgagagcagcgacaccatcgacaacgtcaaggccaaaattcag 234 ||||||||||||||||| ||| |||||||||||| || ||||| ||||||||||| ||| Sbjct: 249 accatcaccctcgaggtggagcccagcgacaccattgagaacgtgaaggccaaaatccag 308 Query: 235 gacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttggag 294 ||||||||||| ||||| || || |||||| | |||| ||||||||||||||| | || Sbjct: 309 gacaaggaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaa 368 Query: 295 gatggacgcacacttgctgactacaacattcagaaggagtc 335 ||||| ||||| || | ||||||||||| ||||| ||||| Sbjct: 369 gatggccgcaccctgtccgactacaacatccagaaagagtc 409 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 315 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 372 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 543 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 592
>emb|CR682871.2|CNS0FPUR Tetraodon nigroviridis full-length cDNA Length = 805 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||| ||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtcaagaccaaaatccaggacaaagaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 121 bits (61), Expect = 4e-24 Identities = 168/201 (83%), Gaps = 2/201 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctgactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||| ||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaagg-aggcattccccctgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcag-ttggaggatggacgcacacttgctgactacaa 320 ||| | |||| ||||||||||||||| ||| || ||| ||||| || | |||||||| Sbjct: 349 cagaggctgatctttgctggcaagcagcttgaagagtggccgcaccctgtccgactacaa 408 Query: 321 cattcagaaggagtcgactct 341 ||| ||||| ||||| ||||| Sbjct: 409 catccagaaagagtccactct 429 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 471 aggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 ||||||||| |||| ||||| |||||||| | ||||||||||||||||| Sbjct: 330 aggcattccccctgatcagcagaggctgatctttgctggcaagcagcttg 379
>emb|CR680956.2|CNS0FODK Tetraodon nigroviridis full-length cDNA Length = 622 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 286 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 345 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 346 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 405 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 406 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 465 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 466 atccagaaggagtc 479 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 58 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 117 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 118 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 177 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 178 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 237 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 238 atccagaaggagtc 251 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 157 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 214 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 385 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 434
>emb|CR680862.2|CNS0FOAY Tetraodon nigroviridis full-length cDNA Length = 803 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| |||||||| || ||| Sbjct: 62 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattcctcctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 182 atccagaaagagtc 195 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | |||||| || Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacgac 637 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 638 atccagaaagagtc 651 Score = 67.9 bits (34), Expect = 5e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 |||||||||||||||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattcctcctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR680188.2|CNS0FNS8 Tetraodon nigroviridis full-length cDNA Length = 657 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 304 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 363 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 364 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 423 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 424 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 483 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 484 atccagaaggagtc 497 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 76 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 135 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 136 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 195 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 196 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 255 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 256 atccagaaggagtc 269 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 175 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 232 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 403 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 452
>emb|CR674380.2|CNS0FJBM Tetraodon nigroviridis full-length cDNA Length = 810 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| |||||||| || ||| Sbjct: 290 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattcctcctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 67.9 bits (34), Expect = 5e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 |||||||||||||||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattcctcctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR668404.2|CNS0FEPM Tetraodon nigroviridis full-length cDNA Length = 887 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 78 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 137 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 138 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 197 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 198 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctctccgactacaac 257 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 258 atccagaaggagtc 271 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 306 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 365 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||| ||||| ||||| || || ||| Sbjct: 366 gacaccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcag 425 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 426 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 485 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 486 atccagaaggagtc 499 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 534 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 593 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 594 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 653 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 654 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaat 713 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 714 atccagaaggagtc 727 Score = 67.9 bits (34), Expect = 5e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||||| Sbjct: 397 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttg 456 Query: 521 cagatg 526 ||||| Sbjct: 457 aagatg 462 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 633 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 690 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 177 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 226
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2 Length = 35954743 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||| | || |||||||||||||| | ||||| |||||| | Sbjct: 3340875 atgcagatcttcgtgaagaccttgactgggaagaccatcactttggaggttgagagctcc 3340816 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| |||||||| || |||||| Sbjct: 3340815 gacaccattgataatgtgaaggccaagatccaggacaaggaggggattcccccagaccag 3340756 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| |||||||||||||||| || || ||||||||| Sbjct: 3340755 cagcgtctgatcttcgctggcaagcagctggaggatggacgcaccctcgccgactacaac 3340696 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 3340695 atccagaaggagtc 3340682 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 3341103 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggttgagagctcg 3341044 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 3341043 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 3340984 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 3340983 cagcgtctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactacaac 3340924 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 3340923 atccagaaggagtc 3340910 Score = 161 bits (81), Expect = 5e-36 Identities = 191/225 (84%), Gaps = 2/225 (0%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || |||||||||||||||||||| || | | | Sbjct: 3341559 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggtgga-atcttc 3341501 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 3341500 tgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccggacca 3341441 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || ||||| ||||||||| | ||||| || | || |||||||||||||| Sbjct: 3341440 gcagcgtctcatctttgccggcaagcagcttgaggacggcaggacccttgctgactacaa 3341381 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| | |||||| | |||||||| Sbjct: 3341380 catccagaaggagtcaacgcttcaccttgtcctccgtctcagggg 3341336 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| || || || |||||||||||||||||||| ||| Sbjct: 3341331 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggtggagtcttct 3341272 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 3341271 gataccatcgacaatgtcaaggccaagatccaggacaaggagggcattcccccggaccag 3341212 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| | || ||||||||||||||| Sbjct: 3341211 cagcgcctcatctttgctggcaagcagctggaggatggcaggacccttgctgactacaac 3341152 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 3341151 atccagaaggagtc 3341138 Score = 125 bits (63), Expect = 2e-25 Identities = 177/215 (82%) Strand = Plus / Minus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| | || || ||||| |||||||||||||| ||| | Sbjct: 3342017 agatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggtggagtcct 3341958 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||| || |||||||| || || || || ||||| || || || ||||||| Sbjct: 3341957 ctgacaccatcgataatgtcaaggctaagatccaagataaggagggcatccccccggacc 3341898 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||||||| | || || |||||||||||| |||||||||| | || ||||||||||||| Sbjct: 3341897 agcagcgtctcatcttcgctggcaagcagctggaggatggcaggacccttgctgactaca 3341838 Query: 320 acattcagaaggagtcgactcttcacttggtcctc 354 |||| |||||||||||||| |||||| | |||||| Sbjct: 3341837 acatccagaaggagtcgacccttcaccttgtcctc 3341803 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || ||||| |||||||| ||||| ||| Sbjct: 3341787 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggtggagtcttct 3341728 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||| || || || || || |||||| Sbjct: 3341727 gacaccatcgacaacgtcaaggccaagatccaggacaaagagggcatccccccagaccag 3341668 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| | || ||||||||||||||| Sbjct: 3341667 cagcgtctcatcttcgccggcaagcagctggaggatggcaggacccttgctgactacaac 3341608 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 3341607 atccagaaggagtc 3341594
>emb|CR857299.1| Pongo pygmaeus mRNA; cDNA DKFZp469J2422 (from clone DKFZp469J2422) Length = 554 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||||||||| || ||||||||||| ||||||||| ||| Sbjct: 65 atgcagatctttgtgaagaccctcacgggcaaaaccatcacccttgaggtcgagcccagt 124 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || ||||| ||||||||||| |||||||| || || || || |||||| Sbjct: 125 gacaccattgagaatgtcaaagccaaaattcaagacaaggagggtatcccgcctgaccag 184 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||||||||||||||| ||| |||||||||| ||||| || ||||||||||| Sbjct: 185 cagcgtctgatatttgctggcaaacagctggaggatggccgcactctctctgactacaac 244 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 245 atccagaaagagtc 258
>dbj|AP004126.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ9003_G05 Length = 141860 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||| | || |||||||||||||| | ||||| |||||| | Sbjct: 89735 atgcagatcttcgtgaagaccttgactgggaagaccatcactttggaggttgagagctcc 89676 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| |||||||| || |||||| Sbjct: 89675 gacaccattgataatgtgaaggccaagatccaggacaaggaggggattcccccagaccag 89616 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| |||||||||||||||| || || ||||||||| Sbjct: 89615 cagcgtctgatcttcgctggcaagcagctggaggatggacgcaccctcgccgactacaac 89556 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 89555 atccagaaggagtc 89542 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 89963 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggttgagagctcg 89904 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 89903 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 89844 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 89843 cagcgtctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactacaac 89784 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 89783 atccagaaggagtc 89770 Score = 161 bits (81), Expect = 5e-36 Identities = 191/225 (84%), Gaps = 2/225 (0%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || |||||||||||||||||||| || | | | Sbjct: 90419 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggtgga-atcttc 90361 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 90360 tgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccggacca 90301 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || ||||| ||||||||| | ||||| || | || |||||||||||||| Sbjct: 90300 gcagcgtctcatctttgccggcaagcagcttgaggacggcaggacccttgctgactacaa 90241 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| | |||||| | |||||||| Sbjct: 90240 catccagaaggagtcaacgcttcaccttgtcctccgtctcagggg 90196 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| || || || |||||||||||||||||||| ||| Sbjct: 90191 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggtggagtcttct 90132 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 90131 gataccatcgacaatgtcaaggccaagatccaggacaaggagggcattcccccggaccag 90072 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| | || ||||||||||||||| Sbjct: 90071 cagcgcctcatctttgctggcaagcagctggaggatggcaggacccttgctgactacaac 90012 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 90011 atccagaaggagtc 89998 Score = 125 bits (63), Expect = 2e-25 Identities = 177/215 (82%) Strand = Plus / Minus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| | || || ||||| |||||||||||||| ||| | Sbjct: 90877 agatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggtggagtcct 90818 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||| || |||||||| || || || || ||||| || || || ||||||| Sbjct: 90817 ctgacaccatcgataatgtcaaggctaagatccaagataaggagggcatccccccggacc 90758 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||||||| | || || |||||||||||| |||||||||| | || ||||||||||||| Sbjct: 90757 agcagcgtctcatcttcgctggcaagcagctggaggatggcaggacccttgctgactaca 90698 Query: 320 acattcagaaggagtcgactcttcacttggtcctc 354 |||| |||||||||||||| |||||| | |||||| Sbjct: 90697 acatccagaaggagtcgacccttcaccttgtcctc 90663 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || ||||| |||||||| ||||| ||| Sbjct: 90647 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggtggagtcttct 90588 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||| || || || || || |||||| Sbjct: 90587 gacaccatcgacaacgtcaaggccaagatccaggacaaagagggcatccccccagaccag 90528 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| | || ||||||||||||||| Sbjct: 90527 cagcgtctcatcttcgccggcaagcagctggaggatggcaggacccttgctgactacaac 90468 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 90467 atccagaaggagtc 90454
>dbj|AK101547.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048M20, full insert sequence Length = 1642 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 995 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggttgagagctcg 1054 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 1055 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 1114 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 1115 cagcgtctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactacaac 1174 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1175 atccagaaggagtc 1188 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||| | || |||||||||||||| | ||||| |||||| | Sbjct: 1223 atgcagatcttcgtgaagaccttgactgggaagaccatcactttggaggttgagagctcc 1282 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| |||||||| || |||||| Sbjct: 1283 gacaccattgataatgtgaaggccaagatccaggacaaggaggggattcccccagaccag 1342 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| |||||||||||||||| || || ||||||||| Sbjct: 1343 cagcgtctgatcttcgctggcaagcagctggaggatggacgcaccctcgccgactacaac 1402 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1403 atccagaaggagtc 1416 Score = 161 bits (81), Expect = 5e-36 Identities = 191/225 (84%), Gaps = 2/225 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || |||||||||||||||||||| || | | | Sbjct: 539 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggtgga-atcttc 597 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 598 tgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccggacca 657 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || ||||| ||||||||| | ||||| || | || |||||||||||||| Sbjct: 658 gcagcgtctcatctttgccggcaagcagcttgaggacggcaggacccttgctgactacaa 717 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| | |||||| | |||||||| Sbjct: 718 catccagaaggagtcaacgcttcaccttgtcctccgtctcagggg 762 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| || || || |||||||||||||||||||| ||| Sbjct: 767 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggtggagtcttct 826 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 827 gataccatcgacaatgtcaaggccaagatccaggacaaggagggcattcccccggaccag 886 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| | || ||||||||||||||| Sbjct: 887 cagcgcctcatctttgctggcaagcagctggaggatggcaggacccttgctgactacaac 946 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 947 atccagaaggagtc 960 Score = 127 bits (64), Expect = 6e-26 Identities = 178/216 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| | || || ||||| |||||||||||||| ||| | Sbjct: 80 aagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggtggagtcc 139 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||| || |||||||| || || || || ||||| || || || |||||| Sbjct: 140 tctgacaccatcgataatgtcaaggctaagatccaagataaggagggcatccccccggac 199 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || |||||||||||| |||||||||| | || |||||||||||| Sbjct: 200 cagcagcgtctcatcttcgctggcaagcagctggaggatggcaggacccttgctgactac 259 Query: 319 aacattcagaaggagtcgactcttcacttggtcctc 354 ||||| |||||||||||||| |||||| | |||||| Sbjct: 260 aacatccagaaggagtcgacccttcaccttgtcctc 295 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || ||||| |||||||| ||||| ||| Sbjct: 311 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggtggagtcttct 370 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||| || || || || || |||||| Sbjct: 371 gacaccatcgacaacgtcaaggccaagatccaggacaaagagggcatccccccagaccag 430 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| | || ||||||||||||||| Sbjct: 431 cagcgtctcatcttcgccggcaagcagctggaggatggcaggacccttgctgactacaac 490 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 491 atccagaaggagtc 504
>dbj|AK061956.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F08, full insert sequence Length = 1640 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||||||||| || |||||||||||||| ||||| |||||| Sbjct: 992 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggttgagagctcg 1051 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 1052 gacaccatcgacaacgtcaaggccaagatccaggacaaggagggcatccccccagaccag 1111 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| | |||||||| ||||| || || ||||||||| Sbjct: 1112 cagcgtctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactacaac 1171 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1172 atccagaaggagtc 1185 Score = 170 bits (86), Expect = 5e-39 Identities = 167/194 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||| | || |||||||||||||| | ||||| |||||| | Sbjct: 1220 atgcagatcttcgtgaagaccttgactgggaagaccatcactttggaggttgagagctcc 1279 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || ||||||||||| |||||||| || |||||| Sbjct: 1280 gacaccattgataatgtgaaggccaagatccaggacaaggaggggattcccccagaccag 1339 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| |||||||||||||||| || || ||||||||| Sbjct: 1340 cagcgtctgatcttcgctggcaagcagctggaggatggacgcaccctcgccgactacaac 1399 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1400 atccagaaggagtc 1413 Score = 161 bits (81), Expect = 5e-36 Identities = 191/225 (84%), Gaps = 2/225 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || |||||||||||||||||||| || | | | Sbjct: 536 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggtgga-atcttc 594 Query: 202 -gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||||||||||||||||||||| || ||||||||||| || ||||| |||||||| Sbjct: 595 tgacaccatcgacaacgtcaaggccaagatccaggacaaggagggcattcccccggacca 654 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 ||||||| | || ||||| ||||||||| | ||||| || | || |||||||||||||| Sbjct: 655 gcagcgtctcatctttgccggcaagcagcttgaggacggcaggacccttgctgactacaa 714 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || |||||| | |||||| | |||||||| Sbjct: 715 catccagaaggagtcaacgcttcaccttgtcctccgtctcagggg 759 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| |||||||| ||||| || || || |||||||||||||||||||| ||| Sbjct: 764 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggtggagtcttct 823 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 || ||||||||||| ||||||||||| || ||||||||||| || ||||| ||||||||| Sbjct: 824 gataccatcgacaatgtcaaggccaagatccaggacaaggagggcattcccccggaccag 883 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||||||||||||| |||||||||| | || ||||||||||||||| Sbjct: 884 cagcgcctcatctttgctggcaagcagctggaggatggcaggacccttgctgactacaac 943 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 944 atccagaaggagtc 957 Score = 127 bits (64), Expect = 6e-26 Identities = 178/216 (82%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| | || || ||||| |||||||||||||| ||| | Sbjct: 77 aagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggtggagtcc 136 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||| || |||||||| || || || || ||||| || || || |||||| Sbjct: 137 tctgacaccatcgataatgtcaaggctaagatccaagataaggagggcatccccccggac 196 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| | || || |||||||||||| |||||||||| | || |||||||||||| Sbjct: 197 cagcagcgtctcatcttcgctggcaagcagctggaggatggcaggacccttgctgactac 256 Query: 319 aacattcagaaggagtcgactcttcacttggtcctc 354 ||||| |||||||||||||| |||||| | |||||| Sbjct: 257 aacatccagaaggagtcgacccttcaccttgtcctc 292 Score = 115 bits (58), Expect = 2e-22 Identities = 160/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| || || || ||||| |||||||| ||||| ||| Sbjct: 308 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggtggagtcttct 367 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || |||||||| || || | || || |||||| Sbjct: 368 gacaccatcgacaacgtcaaggccaagatccaggacaaagagggcacccccccagaccag 427 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || || ||||||||| |||||||||| | || ||||||||||||||| Sbjct: 428 cagcgtctcatcttcgccggcaagcagctggaggatggcaggacccttgctgactacaac 487 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 488 atccagaaggagtc 501
>emb|CT828894.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA021E13, full insert sequence Length = 708 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 65 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 124 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 125 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 184 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 185 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 244 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 245 aacatccagaaggagtc 261
>emb|CT833131.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA120M05, full insert sequence Length = 733 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 69 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 128 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 129 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 188 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 189 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 248 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 249 aacatccagaaggagtc 265
>emb|CT833130.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA333Z56, full insert sequence Length = 801 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 68 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 127 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 128 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 187 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 188 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 247 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 248 aacatccagaaggagtc 264
>emb|CT833129.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA041O16, full insert sequence Length = 724 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 68 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 127 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 128 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 187 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 188 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 247 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 248 aacatccagaaggagtc 264
>ref|NM_001061255.1| Oryza sativa (japonica cultivar-group) Os05g0160200 (Os05g0160200) mRNA, partial cds Length = 735 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 68 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 127 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 128 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 187 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 188 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 247 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 248 aacatccagaaggagtc 264
>ref|XM_001118431.1| PREDICTED: Macaca mulatta similar to ubiquitin A-52 residue ribosomal protein fusion product 1 (LOC722263), mRNA Length = 537 Score = 168 bits (85), Expect = 2e-38 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||||||||| || ||||||||||||||||||||| ||| Sbjct: 41 atgcagatctttgtgaagaccctcacgggcaaaaccatcaccctcgaggtcgagcccagt 100 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || |||||||| ||||||||||| |||||||| || || || || |||||| Sbjct: 101 gacaccattgagaacgtcaaagccaaaattcaagacaaggagggtatcccacctgaccag 160 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||||||||| ||||| ||| |||| ||||| ||||| || | ||||||||| Sbjct: 161 cagcgtctgatatttgccggcaaacagctggaagatggccgcactctctcagactacaac 220 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||| ||||| ||||| ||| |||| Sbjct: 221 atccagaaagagtccactctgcacctggt 249
>gb|AC119288.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017J22, complete sequence Length = 177153 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 104496 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 104555 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 104556 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 104615 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 104616 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 104675 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 104676 aacatccagaaggagtc 104692
>gb|AC137614.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0034O12, complete sequence Length = 156263 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 40645 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 40704 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 40705 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 40764 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 40765 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 40824 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 40825 aacatccagaaggagtc 40841
>gb|AY478418.1| Clusia minor polyubiquitin (Ubq1) mRNA, partial cds Length = 750 Score = 168 bits (85), Expect = 2e-38 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||||||||| || ||||| |||||| | ||||| |||||| | Sbjct: 87 atgcagatctttgttaagaccctcactggcaagactatcaccttggaggtggagagctcc 146 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || |||||||||||||| || || ||||||||||| |||||||| ||||||||| Sbjct: 147 gacacaattgacaacgtcaaggctaagatccaggacaaggaggggattcccccggaccag 206 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | ||||| |||||||||||| |||||||||| || || || |||||||| ||| Sbjct: 207 cagaggctcatattcgctggcaagcagctggaggatggccgtacgctggctgactataac 266 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || || |||||||| Sbjct: 267 attcagaaggagtccaccctccacttggt 295 Score = 143 bits (72), Expect = 1e-30 Identities = 177/212 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||| || || |||||||||||||| ||||| |||||| Sbjct: 315 atgcagatctttgtgaagacccttactggaaagaccatcacccttgaggttgagagctcg 374 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| |||||||| || || || || ||||| || ||||| ||||||||| Sbjct: 375 gacaccattgacaatgtcaaggctaagatccaagataaggagggcattcccccggaccag 434 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||||||||||||| | |||||||| || || ||||| ||||||||| Sbjct: 435 cagaggttgatctttgctggcaagcagcttgaggatgggcgtactcttgcagactacaac 494 Query: 322 attcagaaggagtcgactcttcacttggtcct 353 || |||||||| || || || || |||||||| Sbjct: 495 atccagaaggaatccaccctccatttggtcct 526 Score = 54.0 bits (27), Expect = 8e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 307 cttgctgactacaacattcagaaggagtcgactcttcacttggtcctcagg 357 |||||||| |||||||| ||||||||||| || || |||||||| |||||| Sbjct: 24 cttgctgattacaacatccagaaggagtccaccctccacttggtgctcagg 74
>gb|AC104276.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1231_F08, complete sequence Length = 118049 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 42296 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 42355 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 42356 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 42415 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 42416 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 42475 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 42476 aacatccagaaggagtc 42492
>emb|CR704196.2|CNS0G6B4 Tetraodon nigroviridis full-length cDNA Length = 805 Score = 168 bits (85), Expect = 2e-38 Identities = 166/193 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 231 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 290 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 291 gacaccattgagaatgtcaagaccaaaatccaggacaaggaaggcattccccctgatcag 350 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 351 cagaggatgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaac 410 Query: 322 attcagaaggagt 334 || ||||| |||| Sbjct: 411 atccagaaagagt 423 Score = 131 bits (66), Expect = 4e-27 Identities = 162/194 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||| || || ||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggtaaaaccataactcttgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 638 atccagaaagagtc 651 Score = 109 bits (55), Expect = 1e-20 Identities = 163/195 (83%), Gaps = 3/195 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||| ||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gaca-cattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 120 Query: 262 cagcgtttgat-atttgctg-gcaagcagttggaggatggacgcacacttgctgactaca 319 || | |||| ||||||| |||||||| |||| ||||| ||||| || | ||||||| Sbjct: 121 aagaggctgatcttttgctgtgcaagcagctggaagatggccgcaccctgtccgactaca 180 Query: 320 acattcagaaggagt 334 |||| ||||| |||| Sbjct: 181 acatccagaaagagt 195 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| ||| |||| | ||||||||||||||| Sbjct: 330 gaaggcattccccctgatcagcagaggatgatctttgctggcaagcagct 379
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5 Length = 29737217 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 3475014 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 3475073 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 3475074 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 3475133 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 3475134 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 3475193 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 3475194 aacatccagaaggagtc 3475210 Score = 95.6 bits (48), Expect = 2e-16 Identities = 63/68 (92%) Strand = Plus / Minus Query: 178 atcaccctcgaggtcgagagcagcgacaccatcgacaacgtcaaggccaaaattcaggac 237 |||||||| ||||||||||||||||||||||| ||||||||||||||||| || || ||| Sbjct: 22312114 atcaccctggaggtcgagagcagcgacaccatagacaacgtcaaggccaagatccaagac 22312055 Query: 238 aaggaagg 245 |||||||| Sbjct: 22312054 aaggaagg 22312047 Score = 91.7 bits (46), Expect = 3e-15 Identities = 112/134 (83%) Strand = Plus / Minus Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || ||||| ||||||||||| |||||||||||||| || ||||| || |||||| Sbjct: 8545450 gacacgattgacaatgtcaaggccaagattcaggacaaggagggtattccacctgaccag 8545391 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| | || ||||| |||||||| | ||||| |||||||| || || || |||||| Sbjct: 8545390 cagcgcctcatctttgcgggcaagcaacttgaggacggacgcaccctcgcagattacaac 8545331 Query: 322 attcagaaggagtc 335 |||||||| ||||| Sbjct: 8545330 attcagaaagagtc 8545317 Score = 83.8 bits (42), Expect = 9e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| || |||||||| || || || |||||||||||||| || ||||| ||||| ||| Sbjct: 8544763 gacacaattgacaacgtgaaagcaaagattcaggacaaggagggcattcccccggatcag 8544704 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| |||| ||||||||||||||| | |||||||| ||||| | || | |||||| Sbjct: 8544703 cagcgactgatctttgctggcaagcagctcgaggatggccgcaccttagcaggttacaac 8544644 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 8544643 atccagaaggagtc 8544630 Score = 83.8 bits (42), Expect = 9e-13 Identities = 120/146 (82%) Strand = Plus / Minus Query: 220 aaggccaaaattcaggacaaggaagggattcctccggaccagcagcgtttgatatttgct 279 ||||| || ||| |||||||||| || || || |||||||||||||| | || || || Sbjct: 8544973 aaggcgaagatttaggacaaggagggcatccccccggaccagcagcgcctcatcttcgcc 8544914 Query: 280 ggcaagcagttggaggatggacgcacacttgctgactacaacattcagaaggagtcgact 339 ||||||||| | |||| |||||||| || ||||||||||| || ||||||||||| || Sbjct: 8544913 ggcaagcagctcaaggacggacgcaccctggctgactacaatatccagaaggagtctacc 8544854 Query: 340 cttcacttggtcctcaggctcagggg 365 |||||| | || |||||||||||||| Sbjct: 8544853 cttcacctagtgctcaggctcagggg 8544828 Score = 61.9 bits (31), Expect = 3e-06 Identities = 77/91 (84%), Gaps = 1/91 (1%) Strand = Plus / Minus Query: 256 gaccagcagcgt-ttgatatttgctggcaagcagttggaggatggacgcacacttgctga 314 |||||||||||| || || ||||||||||||||| | |||||||| || || | || || Sbjct: 8545166 gaccagcagcgtctttatctttgctggcaagcagcttgaggatggtcggaccttggcgga 8545107 Query: 315 ctacaacattcagaaggagtcgactcttcac 345 |||||||||| |||| ||||| ||||||||| Sbjct: 8545106 ctacaacatttagaaagagtccactcttcac 8545076 Score = 52.0 bits (26), Expect = 0.003 Identities = 35/38 (92%) Strand = Plus / Minus Query: 313 gactacaacattcagaaggagtcgactcttcacttggt 350 ||||||||||| |||||||||||||| |||||| |||| Sbjct: 22310803 gactacaacatccagaaggagtcgacgcttcacctggt 22310766
>emb|X56511.1|TBCALUBG T. brucei genes for calmodulin, EFH5 and ubiquitin Length = 3896 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || |||||||| || || ||||| | || ||||| ||| |||| Sbjct: 2695 atgcagatcttcgtgaaaaccctcactggtaaaaccattgctcttgaggttgaggccagc 2754 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| |||||||||||||| || || |||||||| ||| Sbjct: 2755 gacaccattgagaacgtaaaggccaagattcaggacaaggagggtatccctccggatcag 2814 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| ||||| || |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 2815 cagcggttgatttttgccgggaagcagttggaggagggtcgcacgcttgcggactacaac 2874 Query: 322 attcagaaggagtcgac 338 ||||||||||||||||| Sbjct: 2875 attcagaaggagtcgac 2891 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || |||||||| || || ||||| | || ||||| ||| |||| Sbjct: 3384 atgcagatcttcgtgaaaaccctcactggcaaaaccattgctcttgaggttgaggccagc 3443 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| |||||||||||||| || || |||||||| ||| Sbjct: 3444 gacaccattgagaacgtaaaggccaagattcaggacaaggagggtatccctccggatcag 3503 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| ||||| || |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 3504 cagcggttgatttttgccgggaagcagttggaggagggtcgcacgcttgcagactacaac 3563 Query: 322 attcagaaggagtcgac 338 ||||||||||||||||| Sbjct: 3564 attcagaaggagtcgac 3580
>emb|X54642.1|TBUBEP522 T. brucei mRNA for a ubiquitin-EP52 fusion protein Length = 474 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || |||||||| || || ||||| | || ||||| ||| |||| Sbjct: 16 atgcagatcttcgtgaaaaccctcactggcaaaaccattgctcttgaggttgaggccagc 75 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| |||||||||||||| || || |||||||| ||| Sbjct: 76 gacaccattgagaacgtaaaggccaagattcaggacaaggagggtatccctccggatcag 135 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| ||||| || |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 136 cagcggttgatttttgccgggaagcagttggaggagggtcgcacgcttgcagactacaac 195 Query: 322 attcagaaggagtcgac 338 ||||||||||||||||| Sbjct: 196 attcagaaggagtcgac 212
>emb|X54641.1|TBUBEP52 T. brucei mRNA for a ubiquitin-EP52 fusion protein Length = 498 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || |||||||| || || ||||| | || ||||| ||| |||| Sbjct: 10 atgcagatcttcgtgaaaaccctcactggtaaaaccattgctcttgaggttgaggccagc 69 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| |||||||||||||| || || |||||||| ||| Sbjct: 70 gacaccattgagaacgtaaaggccaagattcaggacaaggagggtatccctccggatcag 129 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||| ||||| ||||| || |||||||||||||| || ||||| ||||| ||||||||| Sbjct: 130 cagcggttgatttttgccgggaagcagttggaggagggtcgcacgcttgcggactacaac 189 Query: 322 attcagaaggagtcgac 338 ||||||||||||||||| Sbjct: 190 attcagaaggagtcgac 206
>dbj|AP006629.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT10B11, TM0008, complete sequence Length = 116223 Score = 168 bits (85), Expect = 2e-38 Identities = 184/217 (84%) Strand = Plus / Minus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 |||||||||||||||||| || ||||| ||||||||||| |||||||||||||| ||| Sbjct: 80346 gaagatgcagatcttcgtgaaaaccctaacggggaagacgatcaccctcgaggtggagtc 80287 Query: 198 cagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgga 257 |||||| |||||||||||||||||||| || || |||||||| || || || ||||| Sbjct: 80286 atccgacacaatcgacaacgtcaaggccaagatccaagacaaggagggaatcccaccgga 80227 Query: 258 ccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgacta 317 |||||||||| | || || || || |||||| |||| || || ||||||||||||||||| Sbjct: 80226 ccagcagcgtctcatcttcgccgggaagcagctggaagacggccgcacacttgctgacta 80167 Query: 318 caacattcagaaggagtcgactcttcacttggtcctc 354 |||||| ||||||||||| ||||| ||| | |||||| Sbjct: 80166 caacatccagaaggagtccactctccaccttgtcctc 80130
>dbj|AB089615.1| Gorilla gorilla UbC gene for polyubiquitin C, complete cds Length = 1830 Score = 168 bits (85), Expect = 2e-38 Identities = 181/213 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||| ||| ||| Sbjct: 1596 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctcgaggtggagcccag 1655 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || || ||||||||||| || ||||| ||||| Sbjct: 1656 tgacaccatcgagaatgtcaaggcaaagatccaagacaaggaaggcatccctcctgacca 1715 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | || || |||||||| || ||| |||| ||||||||||| || |||||||||| Sbjct: 1716 gcagaggttaatctttgctgggaaacagctggaagatggacgcaccctgtctgactacaa 1775 Query: 321 cattcagaaggagtcgactcttcacttggtcct 353 ||| ||||| ||||| ||||| ||||||||||| Sbjct: 1776 catccagaaagagtccactctgcacttggtcct 1808 Score = 165 bits (83), Expect = 3e-37 Identities = 167/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||||||| ||| Sbjct: 228 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggtcgagcccag 287 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||| || || || || ||||||||||| || ||||| ||||| Sbjct: 288 tgacaccatcgagaacgtcaaagcaaagatccaagacaaggaaggcatccctcctgacca 347 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||||||||| ||||| || |||||||||| Sbjct: 348 gcagaggttgatctttgccggaaagcagctggaggatgggcgcaccctgtctgactacaa 407 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 408 catccagaaagagtc 422 Score = 165 bits (83), Expect = 3e-37 Identities = 167/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||||||| ||| Sbjct: 456 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggtcgagcccag 515 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||| || || || || ||||||||||| || ||||| ||||| Sbjct: 516 tgacaccatcgagaacgtcaaagcaaagatccaagacaaggaaggcatccctcctgacca 575 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||||||||| ||||| || |||||||||| Sbjct: 576 gcagaggttgatctttgccggaaagcagctggaggatgggcgcaccctgtctgactacaa 635 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 636 catccagaaagagtc 650 Score = 165 bits (83), Expect = 3e-37 Identities = 167/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||||||| ||| Sbjct: 684 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggtcgagcccag 743 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||| || || || || ||||||||||| || ||||| ||||| Sbjct: 744 tgacaccatcgagaacgtcaaagcaaagatccaagacaaggaaggcatccctcctgacca 803 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| |||||| |||| ||||| ||||| || |||||||||| Sbjct: 804 gcagaggttgatctttgctggaaagcagctggaagatgggcgcaccctgtctgactacaa 863 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 864 catccagaaagagtc 878 Score = 165 bits (83), Expect = 3e-37 Identities = 167/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||||||| ||| Sbjct: 912 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggtcgagcccag 971 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||| || || || || ||||||||||| || ||||| ||||| Sbjct: 972 tgacaccatcgagaacgtcaaagcaaagatccaagacaaggaaggcatccctcctgacca 1031 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| |||||||| |||||| |||| ||||| ||||| || |||||||||| Sbjct: 1032 gcagaggttgatctttgctggaaagcagctggaagatgggcgcaccctgtctgactacaa 1091 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 1092 catccagaaagagtc 1106 Score = 165 bits (83), Expect = 3e-37 Identities = 167/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||||||||| ||| ||| Sbjct: 1368 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggtggagcccag 1427 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| ||||||||||| || || || ||||||||||| || ||||| ||||| Sbjct: 1428 tgacaccatcgagaacgtcaaggcaaagatccaagacaaggaaggcatccctcctgacca 1487 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||| ||||||||||| || |||||||||| Sbjct: 1488 gcagaggttgatctttgccggaaagcagctggaagatggacgcaccctgtctgactacaa 1547 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 1548 catccagaaagagtc 1562 Score = 157 bits (79), Expect = 7e-35 Identities = 166/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||| ||||||||| ||| Sbjct: 1140 gatgcagatcttcgtgaagaccctgactggtaagaccatcacccttgaggtcgagcccag 1199 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || || ||||||||||| || ||||| ||||| Sbjct: 1200 tgacaccatcgagaatgtcaaggcaaagatccaagacaaggaaggcatccctcctgacca 1259 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| || |||||| |||||||||| ||||| || |||||||||| Sbjct: 1260 gcagaggttgatctttgccggaaagcagctggaggatgggcgcaccctgtctgactacaa 1319 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 1320 catccagaaagagtc 1334 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || |||||||||||||||||||||||| ||| Sbjct: 1 atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggtcgagcccagt 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| || |||||||| || || || || |||||||| || ||||| |||||| Sbjct: 61 gacaccatcgagaatgtcaaggcaaagatccaagataaggaaggcatccctcctgaccag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| |||||||| || ||| |||| ||||| ||||| || |||| |||||| Sbjct: 121 cagaggctgatctttgctggaaaacagctggaagatgggcgcaccctgtctgattacaac 180 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 181 atccagaaagagtc 194
>dbj|AK119731.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-158-A01, full insert sequence Length = 735 Score = 168 bits (85), Expect = 2e-38 Identities = 169/197 (85%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 68 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 127 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||||||||| || |||||| Sbjct: 128 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggaagggatccccccggac 187 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 188 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 247 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 248 aacatccagaaggagtc 264
>dbj|D63782.1|CRUPUQ Cricetulus sp. gene for polyubiquitin, complete cds Length = 8730 Score = 168 bits (85), Expect = 2e-38 Identities = 190/225 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || |||||||| || || |||||||||||||| ||||||||| ||| Sbjct: 7197 gatgcagatctttgtaaagaccctgacaggcaagaccatcaccctggaggtcgagcccag 7256 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || ||||||||||| || || || || ||||| Sbjct: 7257 tgacaccatcgagaatgtcaaggcaaagatccaggacaaggagggcatcccccctgacca 7316 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| ||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 7317 gcagaggttgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaa 7376 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || || ||| ||||||||||||||||||| Sbjct: 7377 catccagaaggagtccaccctgcacctggtcctcaggctcagggg 7421 Score = 153 bits (77), Expect = 1e-33 Identities = 188/225 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || |||||||| || ||||| ||||||||||| ||||||||| ||| Sbjct: 6285 gatgcagatctttgtgaagaccctgacagggaaaaccatcaccctggaggtcgagcccag 6344 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || ||||||||||| || || || || ||||| Sbjct: 6345 tgacaccatcgagaatgtcaaggcaaagatccaggacaaggagggcatcccccctgacca 6404 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| ||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 6405 gcagaggttgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaa 6464 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || || ||| |||||||| | |||||||| Sbjct: 6465 catccagaaggagtctaccctgcacctggtcctccgcctcagggg 6509 Score = 153 bits (77), Expect = 1e-33 Identities = 188/225 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || |||||||| || || |||||||||||||| ||||||||| ||| Sbjct: 6513 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggtcgagcccag 6572 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || ||||||||||| || || || || ||||| Sbjct: 6573 tgacaccatcgagaatgtcaaggcaaagatccaggacaaggagggcatcccccctgacca 6632 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| ||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 6633 gcagaggttgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaa 6692 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || || ||| |||||||| | |||||||| Sbjct: 6693 catccagaaggagtctaccctgcacctggtcctccgcctcagggg 6737 Score = 153 bits (77), Expect = 1e-33 Identities = 188/225 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || |||||||| || || |||||||||||||| ||||||||| ||| Sbjct: 6969 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggtcgagcccag 7028 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || ||||||||||| || || || || ||||| Sbjct: 7029 tgacaccatcgagaatgtcaaggcaaagatccaggacaaggagggcatcccccctgacca 7088 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| ||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 7089 gcagaggttgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaa 7148 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || || ||| |||||||| | |||||||| Sbjct: 7149 catccagaaggagtccaccctgcacctggtcctccgcctcagggg 7193 Score = 145 bits (73), Expect = 3e-31 Identities = 187/225 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 6741 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggttgagcccag 6800 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || ||||||||||| || || || || ||||| Sbjct: 6801 tgacaccatcgagaatgtcaaggcaaagatccaggacaaggagggcatcccccctgacca 6860 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| ||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 6861 gcagaggttgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaa 6920 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || || ||| |||||||| | |||||||| Sbjct: 6921 catccagaaggagtccaccctgcacctggtcctccgcctcagggg 6965 Score = 145 bits (73), Expect = 3e-31 Identities = 187/225 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || || ||||| || || |||||||||||||| ||||||||| ||| Sbjct: 7425 gatgcagatctttgtgaaaaccctgacaggcaagaccatcaccctggaggtcgagcccag 7484 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || ||||||||||| || || || || ||||| Sbjct: 7485 tgacaccatcgagaatgtcaaggcaaagatccaggacaaggagggcatcccccctgacca 7544 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| ||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 7545 gcagaggttgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaa 7604 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || || ||| |||||||| | |||||||| Sbjct: 7605 catccagaaggagtccaccctgcacctggtcctccgcctcagggg 7649 Score = 143 bits (72), Expect = 1e-30 Identities = 186/224 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||| || || |||||||||||||| ||||||||| ||| Sbjct: 6058 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggtcgagcccagt 6117 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| || |||||||| || || ||||||||||| || || || || |||||| Sbjct: 6118 gacaccatcgagaatgtcaaggcaaagatccaggacaaggagggcatcccccctgaccag 6177 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| ||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 6178 cagaggctgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaac 6237 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| |||||||| | |||||||| Sbjct: 6238 atccagaaggagtctaccctgcacctggtcctccgcctcagggg 6281 Score = 137 bits (69), Expect = 7e-29 Identities = 186/225 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || |||||||| || || |||||||| ||||| ||||||||| ||| Sbjct: 7653 gatgcagatctttgtaaagaccctgacaggcaagaccataaccctggaggtcgagcccag 7712 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || |||||||| || || ||||||||| | || || || || ||||| Sbjct: 7713 tgacaccatcgagaatgtcaaggcaaagatccaggacaagcagggcatcccccctgacca 7772 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | ||||| ||||| ||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 7773 gcagaggttgatctttgccggcaagcagctggaagatggccgcaccctgtccgactacaa 7832 Query: 321 cattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||| ||||||||||| || || ||| |||||||| | |||||||| Sbjct: 7833 catccagaaggagtctaccctgcacctggtcctccgcctcagggg 7877 Score = 54.0 bits (27), Expect = 8e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggt 191 |||||||||||| || |||||||| || || |||||||||||||| ||||| Sbjct: 7881 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 7931
>gb|U84969.1|ATU84969 Arabidopsis thaliana ubiquitin (UBQ11) gene, complete cds Length = 1140 Score = 168 bits (85), Expect = 2e-38 Identities = 181/213 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| | || || ||||||||||| || || || |||||| | Sbjct: 913 atgcagatcttcgttaagactttgaccggaaagaccatcactcttgaagttgagagctcc 972 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||||||||| || || |||||||||||||| ||||||||||||||| Sbjct: 973 gacaccattgacaacgtcaaggctaagatccaggacaaggaaggcattcctccggaccag 1032 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| |||||| | ||||||||||| || | || |||||| || Sbjct: 1033 cagcgtctcatcttcgctggaaagcagcttgaggatggacgtactttggccgactacgac 1092 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || ||||||||||| |||||||||||||||||| Sbjct: 1093 atccagaaggagtctactcttcacttggtcctc 1125 Score = 161 bits (81), Expect = 5e-36 Identities = 177/209 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || |||||||||||| | ||||| ||||| Sbjct: 685 atgcagatcttcgtgaagactctcaccggaaagaccatcaccttggaggtggagagttca 744 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||| |||||||| || |||||||||||| Sbjct: 745 gacaccattgacaacgtcaaggccaagatccaggataaggaaggtatccctccggaccag 804 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || |||||||||||||| || || | || || |||||| Sbjct: 805 cagaggttgatcttcgccggaaaacagttggaggatggtcgtactttggcggattacaac 864 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| |||||||||||||| Sbjct: 865 attcagaaggagtctactcttcacttggt 893 Score = 141 bits (71), Expect = 4e-30 Identities = 182/219 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 1 atgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggtggaaagctct 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| ||| Sbjct: 61 gacaccatcgacaacgttaaggccaagatccaggataaggaaggtattcctccggatcag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || || ||||||||||||||||| ||||| | || || ||||| Sbjct: 121 cagaggcttatcttcgccggaaagcagttggaggatggccgcacgttggcggattacaat 180 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || |||||||| || || || |||||||| ||||||||| Sbjct: 181 atccagaaggaatccaccctccacttggttctcaggctc 219 Score = 133 bits (67), Expect = 1e-27 Identities = 169/203 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| || || || ||||| ||||| ||||| || || || ||||| |||||| Sbjct: 229 atgcagatttttgttaaaaccctaacgggaaagacgattactcttgaggtggagagctct 288 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || || || ||||| || ||||||||||||||| Sbjct: 289 gacaccattgacaacgtcaaggccaagatccaagataaggagggtattcctccggaccag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || ||||||||||||||||| | || ||||||||||||||| Sbjct: 349 cagtggttgatcttcgccggaaagcagttggaggatggcagaactcttgctgactacaac 408 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 409 atccagaaggagtcaacacttca 431 Score = 67.9 bits (34), Expect = 5e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 310 gctgactacaacattcagaaggagtcgactcttcacttggtc 351 |||||||||||||||||||||||||| || |||||||||||| Sbjct: 625 gctgactacaacattcagaaggagtcaacacttcacttggtc 666
>gb|AY748809.1| Stauracon pallidus polyubiquitin (UBQ) gene, partial cds Length = 291 Score = 168 bits (85), Expect = 2e-38 Identities = 178/209 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| ||||| || ||||||||||| |||||||||||| | Sbjct: 1 atgcagatcttcgtcaagacgctcaccggcaagaccatcactctcgaggtcgaggcttcc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||| |||| || |||||||||||||| || ||||||||||||||||| || ||||| ||| Sbjct: 61 gactccattgagaacgtcaaggccaagatccaggacaaggaagggatccccccggatcag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||||||||||| || || ||||||||| | ||||| || ||||| || | ||||||||| Sbjct: 121 cagcgtttgatcttcgccggcaagcagctcgaggacggccgcaccctctcagactacaac 180 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||||||||| |||||||| ||||| Sbjct: 181 atccagaaggagtccactcttcatttggt 209 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||||||||||||||||||| ||||| || ||||||||||| || | ||||||| Sbjct: 229 atgcagatcttcgtcaagacgctcaccggcaagaccatcactcttgtggtcgag 282
>emb|CT981209.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 759 Score = 167 bits (84), Expect = 7e-38 Identities = 174/204 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || |||||||||||||| ||||| |||||| Sbjct: 348 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctggaggtggagagctct 407 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||||||||| |||||||| || ||||||||||| || || || ||||||||| Sbjct: 408 gacaccatcgacaacgtgaaggccaagatccaggacaaggagggcatccccccggaccag 467 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| || || ||||||||| ||||||| || ||||| || || || |||||| Sbjct: 468 cagaggctgatcttcgccggcaagcagctggaggacggccgcaccctggcggattacaac 527 Query: 322 attcagaaggagtcgactcttcac 345 || |||||||||||||| |||||| Sbjct: 528 atccagaaggagtcgacccttcac 551 Score = 143 bits (72), Expect = 1e-30 Identities = 186/224 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| ||||||||||| || || |||||||| ||||||||||| |||||| | Sbjct: 120 atgcagatctttgtcaagaccctgaccggcaagaccattaccctcgaggttgagagctcc 179 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||||||||||||||| || ||||||||||| || || || || |||||| Sbjct: 180 gacaccattgacaacgtcaaggccaagatccaggacaaggagggcatcccaccagaccag 239 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | | || || || ||||||||| | ||||| || ||||| ||||| || |||||| Sbjct: 240 cagaggctcatcttcgccggcaagcagctcgaggacggccgcacccttgccgattacaac 299 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| || || ||| | || || ||||||||||| Sbjct: 300 atccagaaggagtccaccctccaccttgtgctgaggctcagggg 343 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 253 ccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgct 312 |||||||||||| | |||| || ||||| |||||| | ||||| || || || || || Sbjct: 3 ccggaccagcagtggctgatcttcgctggaaagcagcttgaggacggccgtaccctcgcc 62 Query: 313 gactacaacattcagaaggagtc 335 ||||||||||| ||||||||||| Sbjct: 63 gactacaacatccagaaggagtc 85
>gb|DQ216248.1| Taeniopygia guttata clone 0058P0029E05 ubiquitin C variant 8-like mRNA, complete sequence Length = 1378 Score = 167 bits (84), Expect = 7e-38 Identities = 165/192 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||||||||||||||| || || |||||||||||||| || | ||| ||| Sbjct: 524 gatgcagatcttcgtcaagaccctgaccggcaagaccatcaccctggaacttgagcccag 583 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||||||||| || |||||||||||||| ||||| || ||||| Sbjct: 584 tgacaccatcgagaacgtcaaggccaagatccaggacaaggaaggcattccccccgacca 643 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| |||| ||||| ||||| || |||||||||| Sbjct: 644 gcagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaa 703 Query: 321 cattcagaagga 332 ||| |||||||| Sbjct: 704 catccagaagga 715 Score = 155 bits (78), Expect = 3e-34 Identities = 177/210 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||| || || ||| ||| Sbjct: 980 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaagttgagcccag 1039 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || ||||||||||| || |||||||||||||| || ||||| ||||| Sbjct: 1040 tgacaccatcgagaatgtcaaggccaagatccaggacaaggaaggtatccctcctgacca 1099 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| || |||||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 1100 gcagaggctgattttcgctggcaagcagctggaagatgggcgcaccctctccgactacaa 1159 Query: 321 cattcagaaggagtcgactcttcacttggt 350 ||| ||||||||||| ||||| ||| |||| Sbjct: 1160 catccagaaggagtcaactctgcacctggt 1189 Score = 145 bits (73), Expect = 3e-31 Identities = 175/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 69 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggtggagcccagt 128 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || ||||||||||| || ||||||||||| || ||||| || |||||| Sbjct: 129 gacaccattgaaaatgtcaaggccaagatccaggacaaggagggcattcccccagaccag 188 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||||||||| ||||| || | ||||||||| Sbjct: 189 cagaggctgatctttgctggcaagcagctggaggatgggcgcaccctctccgactacaac 248 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||| ||||| ||||| ||| |||| Sbjct: 249 atccagaaagagtcaactctccacctggt 277 Score = 119 bits (60), Expect = 2e-23 Identities = 159/192 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||||||||||||||| || || ||||||||||| || ||||| ||| ||| Sbjct: 752 gatgcagatcttcgtcaagaccctgaccggcaagaccatcactcttgaggtggagcccag 811 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||| || || || |||||||| || |||||||||||||| ||||| || ||||| Sbjct: 812 tgacaccattgaaaatgtgaaggccaagatccaggacaaggaaggcattccaccagacca 871 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| || ||||| |||||| |||||||||| || || | | |||||||| Sbjct: 872 gcagaggctgattttcgctggtaagcagctggaggatggtcgtactttgtccgactacaa 931 Query: 321 cattcagaagga 332 ||| |||||||| Sbjct: 932 catccagaagga 943 Score = 103 bits (52), Expect = 9e-19 Identities = 130/156 (83%) Strand = Plus / Plus Query: 177 catcaccctcgaggtcgagagcagcgacaccatcgacaacgtcaaggccaaaattcagga 236 ||||||||| ||||| ||| ||| ||||||||||| || ||||||||||| || ||||| Sbjct: 332 catcacccttgaggtggagcccagtgacaccatcgagaatgtcaaggccaagatccagga 391 Query: 237 caaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttggagga 296 ||||||||| |||||||| ||| ||||| | |||| |||||||| |||||| |||| || Sbjct: 392 caaggaaggtattcctcctgacaagcagaggctgatctttgctggtaagcagctggaaga 451 Query: 297 tggacgcacacttgctgactacaacattcagaagga 332 ||| ||||| || | |||||||| || |||||||| Sbjct: 452 tgggcgcaccctgtcagactacaatatccagaagga 487 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 624 gaaggcattccccccgaccagcagaggctgatctttgctggcaagcagct 673 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||| || ||||||| ||||| |||||||||| |||||||||||||| Sbjct: 1080 gaaggtatccctcctgaccagcagaggctgattttcgctggcaagcagct 1129
>gb|DQ103694.1| Ictalurus punctatus polyubiquitin mRNA, partial cds Length = 576 Score = 167 bits (84), Expect = 7e-38 Identities = 189/224 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| || ||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 25 atgcagatcttcgtgaaaaccctgaccggcaagaccatcacccttgaggttgagcccagt 84 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||||||||||| |||||||| ||||| ||||| || |||||| Sbjct: 85 gacaccattgagaatgtcaaggccaaaatccaggacaaagaaggcattcccccagaccag 144 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 145 cagaggctgatctttgctggcaagcagctggaagatggtcgcaccctgtctgactacaac 204 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || ||||||||||| ||||| ||| |||| ||| | |||||||| Sbjct: 205 atccagaaggagtccactctccacctggttctccgcctcagggg 248 Score = 52.0 bits (26), Expect = 0.003 Identities = 50/58 (86%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 116 aggacaaagaaggcattcccccagaccagcagaggctgatctttgctggcaagcagct 173
>emb|CR658596.2|CNS0F756 Tetraodon nigroviridis full-length cDNA Length = 796 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 159 bits (80), Expect = 2e-35 Identities = 170/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaat 637 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 638 atccagaaggagtccactct 657 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR731309.2|CNS0GR82 Tetraodon nigroviridis full-length cDNA Length = 805 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||| ||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcggatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctgactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR704595.2|CNS0G6M7 Tetraodon nigroviridis full-length cDNA Length = 808 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 639 atccagaaggagtccactct 658 Score = 153 bits (77), Expect = 1e-33 Identities = 171/201 (85%), Gaps = 1/201 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggatt-cctccggacca 260 |||||||| || |||| |||||||| || |||||||||||||| ||| || || || || Sbjct: 62 gacaccattgaggacgtgaaggccaagatccaggacaaggaaggcattcccccctgatca 121 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 122 gcagaggatgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaa 181 Query: 321 cattcagaaggagtcgactct 341 ||| ||||||||||| ||||| Sbjct: 182 catccagaaggagtccactct 202 Score = 111 bits (56), Expect = 4e-21 Identities = 137/164 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || |||||||| || ||||| ||| |||| Sbjct: 231 atgcagatcttcgtcaagacccttactggcaaaaccatcactcttgaggtggagcccagc 290 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||| || ||||||||||||||||| |||||||| ||||| |||| || || ||| Sbjct: 291 aacaccattgagaacgtcaaggccaaaatccaggacaaagaaggttttccccctgatcag 350 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcac 305 ||| | |||| ||||||||||||||| ||| ||||| ||||| Sbjct: 351 cagaggctgatctttgctggcaagcagccggaagatggccgcac 394 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 607 Score = 42.1 bits (21), Expect = 2.9 Identities = 48/57 (84%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagc 517 |||| |||||||| |||| |||| ||||| |||||||| | |||||||||||||| Sbjct: 322 aggacaaagaaggttttccccctgatcagcagaggctgatctttgctggcaagcagc 378
>emb|CR701924.3|CNS0G4K0 Tetraodon nigroviridis full-length cDNA Length = 767 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||| ||| ||||| Sbjct: 182 atccagaaggggtccactct 201 Score = 139 bits (70), Expect = 2e-29 Identities = 160/190 (84%) Strand = Plus / Plus Query: 146 agatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagcgaca 205 ||||||||||||||||||| || || || |||||||||| |||||| ||| |||||||| Sbjct: 462 agatcttcgtcaagaccctgactggcaaaaccatcacccacgaggtggagcccagcgaca 521 Query: 206 ccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccagcagc 265 |||| || ||||| |||||||| || |||||||| ||||| ||||| || || |||||| Sbjct: 522 ccattgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcagcaga 581 Query: 266 gtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaacattc 325 | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||||| | Sbjct: 582 ggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaacatcc 641 Query: 326 agaaggagtc 335 |||||||||| Sbjct: 642 agaaggagtc 651 Score = 135 bits (68), Expect = 3e-28 Identities = 158/188 (84%) Strand = Plus / Plus Query: 148 atcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagcgacacc 207 ||||||||||||||||| || || || ||||| ||||||||||| ||| |||||||||| Sbjct: 236 atcttcgtcaagaccctaactggcaaaaccattaccctcgaggtggagcccagcgacacc 295 Query: 208 atcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccagcagcgt 267 || || ||||| |||||||| || |||||||||||||| ||||| || || |||||| | Sbjct: 296 attgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcagcagagg 355 Query: 268 ttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaacattcag 327 |||| ||||||||||||||| | || ||||| ||||| || | ||||||||||| ||| Sbjct: 356 ctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaacatccag 415 Query: 328 aaggagtc 335 |||||||| Sbjct: 416 aaggagtc 423 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR700205.2|CNS0G389 Tetraodon nigroviridis full-length cDNA Length = 803 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtagagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || |||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgaggacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctctctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 131 bits (66), Expect = 4e-27 Identities = 162/194 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || |||||||| || ||||| ||| ||| Sbjct: 457 atgcagatcttcgtcaagacccttactggcaaaaccatcactcttgaggtggagcccagt 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 636 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 637 atccagaaggagtc 650 Score = 107 bits (54), Expect = 6e-20 Identities = 160/194 (82%), Gaps = 1/194 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || |||||||| || ||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcactcttgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||| ||||||| |||||||| |||| || ||| || || ||| Sbjct: 290 gacaccattgagaatgtcaagaccaaaatccaggacaaagaagcga-tccccctgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 349 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaat 408 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 409 atccagaaagagtc 422 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 556 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 613 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 48.1 bits (24), Expect = 0.047 Identities = 36/40 (90%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 346 cagcagaggctgatctttgctggcaagcagcttgaagatg 385
>emb|CR699785.2|CNS0G2WL Tetraodon nigroviridis full-length cDNA Length = 800 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 457 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 636 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 637 atccagaaggagtccactct 656 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 229 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 288 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 289 gacaccattgagaacgtgaagaccaaaatccaggacaaggaaggcattccccctgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 349 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 408 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 409 atccagaaggagtc 422 Score = 79.8 bits (40), Expect = 1e-11 Identities = 160/200 (80%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| || |||||||| ||||| || || || ||||| ||||||||||| ||| |||| Sbjct: 2 atgcatattttcgtcaaaaccctaactggcaaaaccataaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||| || ||| | |||||||| || |||||||||| || || || || || ||| Sbjct: 62 aacaccattgagaacttgaaggccaagatccaggacaaggggggcatcccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| |||| || ||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgttgtcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 328 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 385 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 556 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 605
>emb|CR695975.2|CNS0FZYR Tetraodon nigroviridis full-length cDNA Length = 791 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 463 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 522 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 523 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 582 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 583 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 642 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 643 atccagaaggagtccactct 662 Score = 135 bits (68), Expect = 3e-28 Identities = 166/196 (84%), Gaps = 2/196 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggatt-cctccggacca 260 |||||||| || ||||| |||||||| || |||||||||||||| ||| || || || || Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccctgatca 121 Query: 261 gcagcgtttgat-atttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 |||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||| Sbjct: 122 gcagaggctgatcttttgctggcaagcagctggaagatggccgcaccctgtccgactaca 181 Query: 320 acattcagaaggagtc 335 | || ||||||||||| Sbjct: 182 atatccagaaggagtc 197 Score = 133 bits (67), Expect = 1e-27 Identities = 164/195 (84%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || |||||||| || ||||| ||| |||| Sbjct: 232 atgcagatcttcgtcaagacccttactggcaaaaccatcactcttgaggtggagcccagc 291 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||| ||||| ||||| || || ||| Sbjct: 292 gacaccattgagaacgtcaagaccaaaatccaggacaaagaaggcattccccctgatcag 351 Query: 262 cagcgtttgatatttgctggcaagcagttggagga-tggacgcacacttgctgactacaa 320 ||| | |||| ||||||||||||||| |||| || ||| ||||| || | |||||||| Sbjct: 352 cagaggctgatctttgctggcaagcagctggaagagtggccgcaccctgtccgactacaa 411 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 412 catccagaaggagtc 426 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 323 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 380 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 562 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 611
>emb|CR695995.3|CNS0FZZB Tetraodon nigroviridis full-length cDNA Length = 810 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 638 atccagaaggagtccactct 657 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || |||||||| || ||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcactcttgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaaaatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR689082.2|CNS0FUNA Tetraodon nigroviridis full-length cDNA Length = 652 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 300 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 359 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 360 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 419 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 420 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 479 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 480 atccagaaggagtccactct 499 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 72 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 131 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 132 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 191 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 192 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaat 251 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 252 atccagaaagagtc 265 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 171 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 228 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 399 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 448
>emb|CR685100.2|CNS0FRKO Tetraodon nigroviridis full-length cDNA Length = 793 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 143 bits (72), Expect = 1e-30 Identities = 168/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||| ||||||||||| ||| |||| Sbjct: 457 atgcagatcttcgtcaagaccctaactggcaaaaccataaccctcgaggtggagcccagc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaat 636 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 637 atccagaaggagtccactct 656 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaa 239 |||||||| || ||||| ||| ||||||| |||||||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaa 327 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 556 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 605 Score = 48.1 bits (24), Expect = 0.047 Identities = 36/40 (90%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 346 cagcagaggctgatctttgctggcaagcagcttgaagatg 385
>emb|CR684205.3|CNS0FQVT Tetraodon nigroviridis full-length cDNA Length = 811 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtcaagaccaaaatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 157 bits (79), Expect = 7e-35 Identities = 166/195 (85%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 229 gatgcagatcttcgtcaagaccctgactggcaaaaccatcaccctcgaggtggagcccag 288 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||| || ||||| |||||||| || |||||||||||||| ||||| || || || Sbjct: 289 cgacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatca 348 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 349 gcagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaa 408 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 409 catccagaaggagtc 423 Score = 141 bits (71), Expect = 4e-30 Identities = 158/187 (84%) Strand = Plus / Plus Query: 149 tcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagcgacacca 208 |||||||||||||||| || || || ||||||||||||||||| ||| ||||||||||| Sbjct: 465 tcttcgtcaagaccctgactggcaaaaccatcaccctcgaggtggagcccagcgacacca 524 Query: 209 tcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccagcagcgtt 268 | || ||||| |||||||| || |||||||| ||||| ||||| || || |||||| | Sbjct: 525 ttgagaacgtgaaggccaagatccaggacaaagaaggcattccccctgatcagcagaggc 584 Query: 269 tgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaacattcaga 328 |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||||| |||| Sbjct: 585 tgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaacatccaga 644 Query: 329 aggagtc 335 ||||||| Sbjct: 645 aggagtc 651 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 549 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR682459.2|CNS0FPJB Tetraodon nigroviridis full-length cDNA Length = 810 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 639 atccagaaggagtccactct 658 Score = 161 bits (81), Expect = 5e-36 Identities = 172/201 (85%), Gaps = 1/201 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggatt-cctccggacca 260 |||||||| || ||||| |||||||| || |||||||||||||| ||| || || || || Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccctgatca 121 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 122 gcagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaa 181 Query: 321 cattcagaaggagtcgactct 341 ||| ||||||||||| ||||| Sbjct: 182 catccagaaggagtccactct 202 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || |||||||| || ||||| ||| |||| Sbjct: 231 atgcagatcttcgtcaagacccttactggcaaaaccatcactcttgaggtggagcccagc 290 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||| ||||||| |||||||| ||||| |||| || || ||| Sbjct: 291 gacaccattgagaacgtcaagaccaaaatccaggacaaagaaggtgttccccctgatcag 350 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 351 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 410 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 411 atccagaaggagtc 424 Score = 44.1 bits (22), Expect = 0.73 Identities = 49/58 (84%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||| |||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 322 aggacaaagaaggtgttccccctgatcagcagaggctgatctttgctggcaagcagct 379 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| || | ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagct 607
>emb|CR679244.3|CNS0FN20 Tetraodon nigroviridis full-length cDNA Length = 802 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 460 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 519 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 520 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 579 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 580 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 639 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 640 atccagaaggagtc 653 Score = 111 bits (56), Expect = 4e-21 Identities = 163/196 (83%), Gaps = 2/196 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggac-aaggaagggattcctccggacca 260 |||||||| || || |||||| ||||||| |||||| ||||| ||| ||||||| || || Sbjct: 290 gacaccattgagaatgtcaagaccaaaatccaggacaaaggagggggttcctcctgatca 349 Query: 261 gcagcgtttgatatttgct-ggcaagcagttggaggatggacgcacacttgctgactaca 319 |||| | |||| |||||| ||||||||| | || ||||| ||||| || | ||||||| Sbjct: 350 gcagaggctgatctttgctgggcaagcagcttgaagatggccgcaccctgtccgactaca 409 Query: 320 acattcagaaggagtc 335 |||| ||||| ||||| Sbjct: 410 acatccagaaagagtc 425 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 559 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 608
>emb|CR673899.2|CNS0FIY9 Tetraodon nigroviridis full-length cDNA Length = 808 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 459 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 518 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 519 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 578 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 579 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 638 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 639 atccagaaggagtccactct 658 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaatgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctctccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 157 bits (79), Expect = 7e-35 Identities = 167/195 (85%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtc-gagagcag 200 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtgtgagcccag 289 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||| || ||||||||| ||||||| |||||||| ||||| ||||| || || || Sbjct: 290 cgacaccattgagaacgtcaagaccaaaatccaggacaaagaaggcattccccctgatca 349 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| ||||||||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 350 gcagaggctgatctttgctggcaagcagctggaagatggccgcaccctctccgactacaa 409 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 410 catccagaaggagtc 424 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 |||| |||||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 322 aggacaaagaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 379 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 558 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 607
>emb|CR666655.3|CNS0FDD1 Tetraodon nigroviridis full-length cDNA Length = 796 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 143 bits (72), Expect = 1e-30 Identities = 168/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || | |||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccgggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaat 637 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 638 atccagaaggagtccactct 657 Score = 137 bits (69), Expect = 7e-29 Identities = 162/193 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| |||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaat 409 Query: 322 attcagaaggagt 334 || |||||||||| Sbjct: 410 atccagaaggagt 422 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR665839.2|CNS0FCQD Tetraodon nigroviridis full-length cDNA Length = 810 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || |||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaaa 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 131 bits (66), Expect = 4e-27 Identities = 162/194 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagaccctaactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||| ||||||| |||||||| ||||| |||||||| || ||| Sbjct: 290 gacaccattgagaatgtcaagaccaaaatccaggacaaagaaggcattcctcctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||| | Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacacc 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 75.8 bits (38), Expect = 2e-10 Identities = 59/66 (89%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 |||| ||||||||||||||||||| ||||| |||||||| | ||||||||||||||||| Sbjct: 321 aggacaaagaaggcattcctcctgatcagcagaggctgatctttgctggcaagcagcttg 380 Query: 521 cagatg 526 ||||| Sbjct: 381 aagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR664322.2|CNS0FBK8 Tetraodon nigroviridis full-length cDNA Length = 787 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 444 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 503 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 504 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattcccccagatcag 563 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 564 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 623 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 624 atccagaaggagtccactct 643 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 216 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 275 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 276 tacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 335 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 336 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 395 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 396 atccagaaggagtc 409 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 315 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 372 Score = 52.0 bits (26), Expect = 0.003 Identities = 50/58 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| || | ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 543 gaaggcattcccccagatcagcagaggctgatctttgctggcaagcagcttgaagatg 600
>emb|CR663066.2|CNS0FALC Tetraodon nigroviridis full-length cDNA Length = 672 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 410 atccagaaggagtccactct 429 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 182 atccagaaagagtc 195 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaat 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 614 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 378
>emb|CR661192.2|CNS0F95A Tetraodon nigroviridis full-length cDNA Length = 754 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||| |||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaaaaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR657528.2|CNS0F6BI Tetraodon nigroviridis full-length cDNA Length = 744 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 638 atccagaaggagtccactct 657 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || |||||||| || ||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcactcttgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||||||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatatttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 143 bits (72), Expect = 1e-30 Identities = 141/164 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcac 305 ||| | |||| ||||||||||||||| | || ||||| ||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcac 165 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatatttgctggcaagcagct 378 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR647468.2|CNS0EYK2 Tetraodon nigroviridis full-length cDNA Length = 787 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||| | || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattacccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||| ||||||| |||||||| ||||| || || || || ||| Sbjct: 290 gacaccattgagaatgtcaagaccaaaatccaggacaaagaaggcatcccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 410 atccagaaagagtc 423 Score = 60.0 bits (30), Expect = 1e-05 Identities = 57/66 (86%) Strand = Plus / Plus Query: 461 aggagaaagaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttg 520 |||| ||||||||||| || |||| ||||| |||||||| | ||||||||||||||||| Sbjct: 321 aggacaaagaaggcatcccccctgatcagcagaggctgatctttgctggcaagcagcttg 380 Query: 521 cagatg 526 ||||| Sbjct: 381 aagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||| | |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattacccctgatcagcagaggctgatctttgctggcaagcagct 150
>emb|CR636218.2|CNS0EPVK Tetraodon nigroviridis full-length cDNA Length = 683 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||||||||| ||||| Sbjct: 182 atccagaaggagtccactct 201 Score = 105 bits (53), Expect = 2e-19 Identities = 109/125 (87%), Gaps = 2/125 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaaga-ccatcaccctcg-aggtcgagagca 199 |||||||||||||||||||||||||| || |||| |||||||||||| |||| ||| || Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaagaaccatcaccctcgcaggtggagccca 289 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||||| || ||||| |||||||| || |||||||||||||| ||||| || || | Sbjct: 290 gcgacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatc 349 Query: 260 agcag 264 ||||| Sbjct: 350 agcag 354 Score = 83.8 bits (42), Expect = 9e-13 Identities = 163/202 (80%), Gaps = 1/202 (0%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||| |||||||||||||||||| || || || ||||| || ||||| ||| ||| Sbjct: 458 gatgcagaacttcgtcaagaccctcactggcaaaacaatcactcttgaggtggagcccag 517 Query: 201 cgacacca-tcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 |||||||| | || ||||| |||||||| || |||||||||||||| ||| | || || | Sbjct: 518 cgacaccatttgagaacgtgaaggccaagatccaggacaaggaaggcattgcccctgatc 577 Query: 260 agcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactaca 319 ||||| | |||| |||| |||| ||| | || ||||| ||||| || | ||||||| Sbjct: 578 agcagaggctgatctttgactgcaaacagcttgaagatggccgcaccctgtccgactaca 637 Query: 320 acattcagaaggagtcgactct 341 |||| ||||||||||| ||||| Sbjct: 638 acatccagaaggagtccactct 659 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150
>emb|CR634439.2|CNS0EOI5 Tetraodon nigroviridis full-length cDNA Length = 810 Score = 167 bits (84), Expect = 7e-38 Identities = 171/200 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||| |||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagaacttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtctgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctagaagatggccgcaccctgtccgactacaac 637 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 638 atccagaaggagtc 651 Score = 93.7 bits (47), Expect = 9e-16 Identities = 160/195 (82%), Gaps = 2/195 (1%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| ||| Sbjct: 230 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagt 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || |||||| ||||||| |||||||| ||| | |||||| || ||| Sbjct: 290 gacaccattgagaatgtcaagaccaaaatccaggacaaagaa-aaaatcctcctgatcag 348 Query: 262 c-agcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 | || | |||| ||||||||||||||| | || ||||| ||||| || | |||||||| Sbjct: 349 caagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaa 408 Query: 321 cattcagaaggagtc 335 ||| ||||| ||||| Sbjct: 409 catccagaaagagtc 423 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 150 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606 Score = 46.1 bits (23), Expect = 0.19 Identities = 45/51 (88%), Gaps = 1/51 (1%) Strand = Plus / Plus Query: 477 tcctcctgtgcagcaa-aggctgatttatgctggcaagcagcttgcagatg 526 |||||||| |||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 336 tcctcctgatcagcaagaggctgatctttgctggcaagcagcttgaagatg 386
>emb|Z24738.1|BRUBIRBPA B.rapa ubiquitin and ribosomal protein mRNA, complete CDS's Length = 587 Score = 167 bits (84), Expect = 7e-38 Identities = 195/232 (84%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||| ||||| ||||| || ||||| |||||||||||||||||||| |||||| Sbjct: 83 aagatgcagatattcgtgaagacgctgacgggcaagaccatcaccctcgaggtggagagc 142 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 || |||||||||||||| ||||||||||| || |||||||| |||||||| |||||||| Sbjct: 143 agtgacaccatcgacaatgtcaaggccaagatccaggacaaagaagggatccctccggat 202 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| ||||| || || ||| | || ||||| || || | ||||||||| Sbjct: 203 cagcagaggttgatctttgccggtaaacagcttgaagatggtcgtaccttggctgactac 262 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 ||||| || || ||||||||||| || | ||||| ||||| ||||| |||| Sbjct: 263 aacatccaaaaagagtcgactctgcatcttgtcctgaggcttaggggaggta 314
>emb|X58253.1|LEUBI3 Tomato ubi3 gene for ubiquitin Length = 2374 Score = 167 bits (84), Expect = 7e-38 Identities = 174/204 (85%) Strand = Plus / Plus Query: 138 gaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagag 197 |||||||||||||||||| || ||||| ||||||||||| |||||||| ||||| ||| Sbjct: 1384 gaagatgcagatcttcgtgaaaaccctaacggggaagacgatcaccctagaggttgagtc 1443 Query: 198 cagcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccgga 257 ||||||||||||||| || || ||||| || |||||||||||||||||||| || || Sbjct: 1444 ttccgacaccatcgacaatgtgaaagccaagatccaggacaaggaagggattcccccaga 1503 Query: 258 ccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgacta 317 ||||||||||||||| || || || |||||| | |||||||| || || ||||| ||||| Sbjct: 1504 ccagcagcgtttgattttcgccggaaagcagcttgaggatggtcgtactcttgccgacta 1563 Query: 318 caacattcagaaggagtcgactct 341 |||||| ||||||||||| ||||| Sbjct: 1564 caacatccagaaggagtccactct 1587
>gb|L21898.1|BRRUBIRIPL Brassica rapa ubiquitin/ribosomal protein mRNA, complete cds Length = 578 Score = 167 bits (84), Expect = 7e-38 Identities = 195/232 (84%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||| ||||| ||||| || ||||| |||||||||||||||||||| |||||| Sbjct: 83 aagatgcagatattcgtgaagacgctgacgggcaagaccatcaccctcgaggtggagagc 142 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 || |||||||||||||| ||||||||||| || |||||||| |||||||| |||||||| Sbjct: 143 agtgacaccatcgacaatgtcaaggccaagatccaggacaaagaagggatccctccggat 202 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||| | ||||| ||||| || || ||| | || ||||| || || | ||||||||| Sbjct: 203 cagcagaggttgatctttgccggtaaacagcttgaagatggtcgtaccttggctgactac 262 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 ||||| || || ||||||||||| || | ||||| ||||| ||||| |||| Sbjct: 263 aacatccaaaaagagtcgactctgcatcttgtcctgaggcttaggggaggta 314
>ref|NM_001077804.1| Danio rerio zgc:153686 (zgc:153686), mRNA gb|BC127395.1| Danio rerio zgc:153686, mRNA (cDNA clone MGC:153686 IMAGE:8108232), complete cds Length = 1800 Score = 165 bits (83), Expect = 3e-37 Identities = 191/227 (84%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| || || || |||||||||||||||||||||||| | Sbjct: 76 aagatgcagatctttgtgaagacgctgactggtaagaccatcaccctcgaggtcgagccc 135 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||| || || |||||||| |||||||| || ||||| || |||||||| ||| Sbjct: 136 agcgacaccattgagaatgtcaaggctaaaattcaagataaggagggcattcctcctgac 195 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||||||| |||| || ||||| || ||||| |||||||||||||| || | |||||| Sbjct: 196 cagcagcgtctgatcttcgctggaaaacagttagaggatggacgcaccctgtccgactac 255 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| ||||| ||||| || || ||| |||| ||| | |||||||| Sbjct: 256 aacatccagaaagagtccaccctccacctggtgctccgcctcagggg 302 Score = 145 bits (73), Expect = 3e-31 Identities = 190/229 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||||||||| | ||||||||| |||| Sbjct: 763 atgcagatcttcgtgaagacgctgactggcaagaccatcactttggaggtcgagcccagc 822 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||||| |||||||| || ||||| || || || || |||||| Sbjct: 823 gacaccattgagaacgtcaaggctaaaattcaagataaggagggcatcccacctgaccag 882 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| ||||| ||||||||| | || ||||||||||| || ||||||| ||| Sbjct: 883 cagcgtctgatctttgccggcaagcagcttgaagatggacgcaccctgtctgactataac 942 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| |||| ||| | |||||||| |||| Sbjct: 943 atccagaaggagtccaccctccacctggtgctctgcctcaggggtggta 991 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| || || || ||||||||||| |||||||| || ||| Sbjct: 1447 atgcagatcttcgtcaagacgctgactggcaagaccatcacactcgaggtggaaccaagc 1506 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||||||||| ||||| ||||| || || || || |||||| Sbjct: 1507 gacaccattgagaacgtgaaggccaaaatccaggataaggagggcatcccacctgaccag 1566 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| | || ||||||||||| || | ||||||||| Sbjct: 1567 cagcgtctgatcttcgctggcaagcagcttgaagatggacgcactctgtccgactacaac 1626 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1627 atccagaaggagtc 1640 Score = 131 bits (66), Expect = 4e-27 Identities = 162/194 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||| || || || ||||||||||| || ||||| || ||| Sbjct: 307 atgcagatctttgtgaagacgctgactggcaagaccatcactctagaggtggaaccaagc 366 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||||||||| |||||||| || ||||| || || || || |||||| Sbjct: 367 gacaccattgagaacgtcaaggctaaaattcaagataaggagggcatcccacctgaccag 426 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| ||||||||||||||| | || ||||||||||| || | ||||||||| Sbjct: 427 cagcgtctgatctttgctggcaagcagcttgaagatggacgcaccctgtccgactacaac 486 Query: 322 attcagaaggagtc 335 |||||||||||||| Sbjct: 487 attcagaaggagtc 500 Score = 129 bits (65), Expect = 2e-26 Identities = 188/229 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||| | || || ||||||||||| || ||||| || || Sbjct: 1219 atgcagatcttcgtcaagaccttaactggcaagaccatcactcttgaggtagaaccaagt 1278 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||||| ||||| ||||||||||| || || || || |||||| Sbjct: 1279 gacaccattgagaacgtgaaggcaaaaatccaggacaaggagggcatcccacctgaccag 1338 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| || |||||||||||| | || ||||||||||| || | ||||||||| Sbjct: 1339 cagcgtctgattttcgctggcaagcagcttgaagatggacgcaccctgtccgactacaac 1398 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcaggggcggta 370 || ||||||||||| || || ||| |||| ||| | |||||||| |||| Sbjct: 1399 atccagaaggagtccaccctccacctggtgctccgcctcaggggtggta 1447 Score = 107 bits (54), Expect = 6e-20 Identities = 159/194 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||| || || || || |||||||| || ||||||||| ||| Sbjct: 535 atgcagatcttcgtcaagactctgacaggaaaaaccatcactcttgaggtcgagcccagt 594 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| ||||| || ||||| || || || || |||||| Sbjct: 595 gacaccattgagaacgtgaaagccaagattcaagataaggagggcatcccacctgaccag 654 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| ||||||||||| ||| | || ||||| ||||| || | ||||||||| Sbjct: 655 cagcgtctgatctttgctggcaaacagcttgaagatgggcgcaccctgtccgactacaac 714 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 715 atccagaaagagtc 728 Score = 107 bits (54), Expect = 6e-20 Identities = 159/194 (81%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||||||||| || ||||||||| |||| Sbjct: 991 atgcagatcttcgtgaagacgctgactggtaagaccatcactcttgaggtcgagcccagc 1050 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| || ||||| ||||| || ||||| || || || || |||||| Sbjct: 1051 gacaccattgagaacgtgaaagccaagattcaagataaggagggcatcccacctgaccag 1110 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||| ||||| ||||||||| | || ||||| ||||| || | ||||| ||| Sbjct: 1111 cagcgtctgatctttgccggcaagcagcttgaagatgggcgcaccctgtcagactataac 1170 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 1171 atccagaaagagtc 1184
>emb|CU179894.1| Medicago truncatula chromosome 5 clone mth4-21m22, COMPLETE SEQUENCE Length = 208413 Score = 165 bits (83), Expect = 3e-37 Identities = 218/263 (82%) Strand = Plus / Plus Query: 233 aggacaaggaagggattcctccggaccagcagcgtttgatatttgctggcaagcagttgg 292 ||||||| ||||| || ||||| |||||||| | ||||| ||||| || ||||| ||| Sbjct: 162240 aggacaaagaaggtatccctcctgaccagcaaaggttgatttttgcgggtaagcaactgg 162299 Query: 293 aggatggacgcacacttgctgactacaacattcagaaggagtcgactcttcacttggtcc 352 | |||||||| || |||||||| |||||||| || ||||| || || ||||||||||| | Sbjct: 162300 aagatggacgtactcttgctgattacaacatacaaaaggaatcaacacttcacttggtac 162359 Query: 353 tcaggctcaggggcggtacgatgatcaaagtcaagactctcactgggaaggagattgaaa 412 |||||||||| || || || ||||| |||||||||||| | || || || |||||||||| Sbjct: 162360 tcaggctcagaggaggaaccatgattaaagtcaagactttgaccggtaaagagattgaaa 162419 Query: 413 ttgacattgagcccaccgacacgattgacaggatcaaggagcgtgttgaggagaaagaag 472 ||||||||||||| || || || ||||| | |||||||| |||||||| || ||||| | Sbjct: 162420 ttgacattgagcctactgatactattgatcgtatcaaggaacgtgttgaagaaaaagagg 162479 Query: 473 gcattcctcctgtgcagcaaagg 495 | ||||| ||||||||||||||| Sbjct: 162480 gtattccacctgtgcagcaaagg 162502 Score = 111 bits (56), Expect = 4e-21 Identities = 83/92 (90%) Strand = Plus / Plus Query: 136 gagaagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgag 195 |||||||||||||||||||| ||||| | || || ||||| |||||||||||||| ||| Sbjct: 162039 gagaagatgcagatcttcgtgaagactttgaccggaaagactatcaccctcgaggttgag 162098 Query: 196 agcagcgacaccatcgacaacgtcaaggccaa 227 ||||||||||| |||||||||||||||||||| Sbjct: 162099 agcagcgacacaatcgacaacgtcaaggccaa 162130 Score = 48.1 bits (24), Expect = 0.047 Identities = 57/68 (83%) Strand = Plus / Plus Query: 493 aggctgatttatgctggcaagcagcttgcagatgacaagactgccaaggactacaacatc 552 ||||| || |||||||| ||||||||||| |||||||| || || || || |||||||| Sbjct: 162859 aggctcatctatgctggtaagcagcttgctgatgacaaaacagctaaagagtacaacatt 162918 Query: 553 gaaggtgg 560 || ||||| Sbjct: 162919 gagggtgg 162926
>gb|DQ839401.1| Bombyx mandarina ubiquitin mRNA, complete cds Length = 231 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || ||||||||||||||||||||||| ||||||||| Sbjct: 1 atgcagatcttcgtgaagactctaactgggaagaccatcaccctcgaggttgagagcagc 60 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| ||||||||||| || ||||| |||||||| || || || || ||| Sbjct: 61 gacaccatcgacaatgtcaaggccaagatccaggataaggaaggaatcccgcctgatcag 120 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| |||||||| ||||| ||||| ||||| | || ||||| || |||||| Sbjct: 121 cagagattgatttttgctgggaagcaattggaagatgggaggactcttgcagattacaac 180 Query: 322 attcagaaggagtcgactcttca 344 || || |||||||| || ||||| Sbjct: 181 atccaaaaggagtcaacacttca 203
>dbj|AK230345.1| Arabidopsis thaliana mRNA for thioglucosidase 3D precursor, complete cds, clone: RAFL24-20-C13 Length = 2497 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||| | ||||| ||||| || || || ||||| ||||| Sbjct: 444 atgcagattttcgtcaagaccttaacgggaaagacgattactcttgaggtggagagttct 385 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 384 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 325 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 324 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 265 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 264 atccagaaggagtccacacttca 242 Score = 115 bits (58), Expect = 2e-22 Identities = 109/126 (86%) Strand = Plus / Minus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 675 aagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagc 616 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| Sbjct: 615 tctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggat 556 Query: 259 cagcag 264 |||||| Sbjct: 555 cagcag 550 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 216 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 157 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 156 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 97 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 96 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 37 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 36 attcagaaggagtctacacttcacttggt 8
>ref|NM_178961.1| Arabidopsis thaliana UBQ14; protein binding (UBQ14) mRNA, complete cds Length = 1499 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||| | ||||| ||||| || || || ||||| ||||| Sbjct: 593 atgcagattttcgtcaagaccttaacgggaaagacgattactcttgaggtggagagttct 652 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 653 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 712 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 713 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 772 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 773 atccagaaggagtccacacttca 795 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 1049 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 1108 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 1109 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 1168 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 1169 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 1228 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 1229 atccagaaggagtctacccttcacttggtgctaaggctc 1267 Score = 113 bits (57), Expect = 1e-21 Identities = 108/125 (86%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 363 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagct 422 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| | Sbjct: 423 ctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggatc 482 Query: 260 agcag 264 ||||| Sbjct: 483 agcag 487 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 821 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 880 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 881 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 940 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 941 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 1000 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 1001 attcagaaggagtctacacttcacttggt 1029
>ref|NM_116523.2| Arabidopsis thaliana UBQ14; protein binding (UBQ14) mRNA, complete cds Length = 1202 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||| | ||||| ||||| || || || ||||| ||||| Sbjct: 296 atgcagattttcgtcaagaccttaacgggaaagacgattactcttgaggtggagagttct 355 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 356 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 415 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 416 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 475 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 476 atccagaaggagtccacacttca 498 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 752 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 811 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 812 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 871 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 872 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 931 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 932 atccagaaggagtctacccttcacttggtgctaaggctc 970 Score = 115 bits (58), Expect = 2e-22 Identities = 109/126 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 65 aagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagc 124 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| Sbjct: 125 tctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggat 184 Query: 259 cagcag 264 |||||| Sbjct: 185 cagcag 190 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 524 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 583 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 584 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 643 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 644 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 703 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 704 attcagaaggagtctacacttcacttggt 732
>gb|AC004044.1| Arabidopsis thaliana BAC T5J8 from chromosome IV, top arm, complete sequence Length = 98527 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||| | ||||| ||||| || || || ||||| ||||| Sbjct: 76526 atgcagattttcgtcaagaccttaacgggaaagacgattactcttgaggtggagagttct 76467 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 76466 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 76407 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 76406 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 76347 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 76346 atccagaaggagtccacacttca 76324 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 76070 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 76011 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 76010 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 75951 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 75950 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 75891 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 75890 atccagaaggagtctacccttcacttggtgctaaggctc 75852 Score = 113 bits (57), Expect = 1e-21 Identities = 108/125 (86%) Strand = Plus / Minus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 76756 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagct 76697 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| | Sbjct: 76696 ctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggatc 76637 Query: 260 agcag 264 ||||| Sbjct: 76636 agcag 76632 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 76298 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 76239 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 76238 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 76179 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 76178 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 76119 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 76118 attcagaaggagtctacacttcacttggt 76090
>gb|BT017060.1| Zea mays clone EL01N0358B03.c mRNA sequence Length = 795 Score = 165 bits (83), Expect = 3e-37 Identities = 191/227 (84%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 99 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 158 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||| || || || |||||| Sbjct: 159 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggagggcatcccgccggac 218 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 219 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 278 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| |||||||||||||| || ||| |||| ||| | |||||||| Sbjct: 279 aacatccagaaggagtcgacgctgcacctggtgctccgcctcagggg 325
>gb|AY225193.1| Camelus dromedarius polyubiquitin gene, partial cds Length = 325 Score = 165 bits (83), Expect = 3e-37 Identities = 179/211 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 115 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggtggagcctagc 174 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||| |||||||| || ||||| |||||||| || ||||| |||||| Sbjct: 175 gacaccatcgagaacgtgaaggccaagatccaggataaggaaggcatccctcctgaccag 234 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || ||||||||| |||| ||||| ||||| ||| |||| |||||| Sbjct: 235 cagaggttgatcttcgcaggcaagcagctggaagatggccgcactctttctgattacaac 294 Query: 322 attcagaaggagtcgactcttcacttggtcc 352 || |||||||||||||| || ||| |||||| Sbjct: 295 atccagaaggagtcgaccctgcacctggtcc 325 Score = 75.8 bits (38), Expect = 2e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 256 gaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgac 315 ||||||||| | |||| ||||| ||||||||| |||| ||||| ||||| ||| |||| Sbjct: 1 gaccagcagaggctgatctttgcaggcaagcagctggaagatggccgcactctttctgat 60 Query: 316 tacaacattcagaaggagtcgactcttcacttggtcct 353 |||||||| |||||||||||||| || ||| ||||||| Sbjct: 61 tacaacatccagaaggagtcgaccctgcacctggtcct 98
>emb|CR662490.2|CNS0FA5C Tetraodon nigroviridis full-length cDNA Length = 397 Score = 165 bits (83), Expect = 3e-37 Identities = 168/195 (86%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 58 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 117 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 118 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 177 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacact-tgctgactacaa 320 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | | |||||||| Sbjct: 178 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccggactacaa 237 Query: 321 cattcagaaggagtc 335 ||| ||||||||||| Sbjct: 238 catccagaaggagtc 252 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 157 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 206
>gb|AY087759.1| Arabidopsis thaliana clone 38261 mRNA, complete sequence Length = 1190 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||| | ||||| ||||| || || || ||||| ||||| Sbjct: 297 atgcagattttcgtcaagaccttaacgggaaagacgattactcttgaggtggagagttct 356 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 357 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 416 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 417 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 476 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 477 atccagaaggagtccacacttca 499 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 753 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 812 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 813 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 872 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 873 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 932 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 933 atccagaaggagtctacccttcacttggtgctaaggctc 971 Score = 115 bits (58), Expect = 2e-22 Identities = 109/126 (86%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 66 aagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagc 125 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| Sbjct: 126 tctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggat 185 Query: 259 cagcag 264 |||||| Sbjct: 186 cagcag 191 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 525 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 584 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 585 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 644 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 645 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 704 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 705 attcagaaggagtctacacttcacttggt 733
>emb|AL161495.2|ATCHRIV7 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 7 Length = 199615 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||| | ||||| ||||| || || || ||||| ||||| Sbjct: 125196 atgcagattttcgtcaagaccttaacgggaaagacgattactcttgaggtggagagttct 125137 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 125136 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 125077 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 125076 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 125017 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 125016 atccagaaggagtccacacttca 124994 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 124740 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 124681 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 124680 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 124621 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 124620 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 124561 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 124560 atccagaaggagtctacccttcacttggtgctaaggctc 124522 Score = 113 bits (57), Expect = 1e-21 Identities = 108/125 (86%) Strand = Plus / Minus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 125426 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagct 125367 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| | Sbjct: 125366 ctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggatc 125307 Query: 260 agcag 264 ||||| Sbjct: 125306 agcag 125302 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Minus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 124968 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 124909 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 124908 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 124849 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 124848 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 124789 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 124788 attcagaaggagtctacacttcacttggt 124760
>dbj|AP005546.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1003_C09 Length = 124746 Score = 165 bits (83), Expect = 3e-37 Identities = 101/107 (94%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 27864 aagatgcagatcttcgtgaagaccctaacggggaagaccatcacgctcgaggtcgagagc 27923 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagg 245 ||||||||||||||||| ||||||||||| || |||||||||||||| Sbjct: 27924 agcgacaccatcgacaatgtcaaggccaagatccaggacaaggaagg 27970 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Plus Query: 250 cctccggaccagcagcgtttgatatttgctggcaagcagttggaggatggacgcacactt 309 ||||||||||||||||| | || || || ||||||||| |||||||||| ||||| || Sbjct: 28074 cctccggaccagcagcgcctcatcttcgccggcaagcagctggaggatggccgcaccctg 28133 Query: 310 gctgactacaacattcagaaggagtc 335 || ||||||||||| ||||||||||| Sbjct: 28134 gccgactacaacatccagaaggagtc 28159
>emb|X92422.1|ZMUBIS27F Z.mays mRNA for ubiquitin/ribosomal protein S27a fusion protein Length = 777 Score = 165 bits (83), Expect = 3e-37 Identities = 191/227 (84%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 ||||||||||||||||| |||||||| ||||||||||||||||| || ||||| ||| | Sbjct: 88 aagatgcagatcttcgtgaagaccctgacggggaagaccatcacgctggaggtggagtcc 147 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 ||||||||||||||||| |||||||| || ||||||||||| || || || |||||| Sbjct: 148 tcggacaccatcgacaacgtgaaggccaagatccaggacaaggagggcatcccgccggac 207 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 |||||||| | || || || ||||||||| | |||||||| ||||| || || |||||| Sbjct: 208 cagcagcgcctcatcttcgccggcaagcagctcgaggatggccgcaccctcgccgactac 267 Query: 319 aacattcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 ||||| |||||||||||||| || ||| ||||| || | |||||||| Sbjct: 268 aacatccagaaggagtcgacgctgcacctggtcgtccgcctcagggg 314
>gb|L05394.1|ATHUBQ14G Arabidopsis thaliana polyubiquitin (ubq14) gene sequence Length = 1605 Score = 165 bits (83), Expect = 3e-37 Identities = 173/203 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| |||||||||||| | ||||| ||||| || || || ||||| ||||| Sbjct: 700 atgcagattttcgtcaagaccttaacgggaaagacgattactcttgaggtggagagttct 759 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||||||||||||||| || || |||||||| || ||||||||||||||| Sbjct: 760 gacaccatcgacaacgtcaaggccaagatccaagacaaggagggtattcctccggaccag 819 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| ||||||||||||||||| | || ||||||||||||||| Sbjct: 820 cagaggttgatcttcgctggaaagcagttggaggatggcagaactcttgctgactacaac 879 Query: 322 attcagaaggagtcgactcttca 344 || ||||||||||| || ||||| Sbjct: 880 atccagaaggagtccacacttca 902 Score = 133 bits (67), Expect = 1e-27 Identities = 181/219 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| ||||| ||||| ||||| || |||||||| || || || || |||||| | Sbjct: 1156 atgcagattttcgtgaagactctcactggaaagaccattactcttgaagttgagagctcc 1215 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || |||||||||||||| || |||||||||||| Sbjct: 1216 gacaccattgacaacgtgaaggctaagatccaggacaaggaaggtatccctccggaccag 1275 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| | || || ||||| || ||| | |||||||| || || | || ||||||||| Sbjct: 1276 cagcgtctcatcttcgctggaaaacagcttgaggatggtcgtactttggccgactacaac 1335 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctc 360 || ||||||||||| || ||||||||||| || |||||| Sbjct: 1336 atccagaaggagtctacccttcacttggtgctaaggctc 1374 Score = 113 bits (57), Expect = 1e-21 Identities = 108/125 (86%) Strand = Plus / Plus Query: 140 agatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagca 199 ||||||||||||| || ||||| ||||| || ||||| |||||||||||||| || ||| Sbjct: 470 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggtggaaagct 529 Query: 200 gcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacc 259 ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||| | Sbjct: 530 ctgacaccatcgacaacgttaaggccaagatccaggataaggaaggcattcctccggatc 589 Query: 260 agcag 264 ||||| Sbjct: 590 agcag 594 Score = 73.8 bits (37), Expect = 8e-10 Identities = 166/209 (79%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| |||||||| | || || ||||| ||||| | ||||| |||||| Sbjct: 928 atgcagatctttgtcaagacgttgactggaaagactatcactttggaggtggagagctct 987 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||| |||||||| ||||| ||||| || |||||||| || || || || ||||||||| Sbjct: 988 gacactatcgacaatgtcaaagccaagatccaggacaaagagggtatcccaccggaccag 1047 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || || || || || | || ||||| | || | |||||||||||| Sbjct: 1048 cagagattgatcttcgccggaaaacaacttgaagatggtagaactttggctgactacaac 1107 Query: 322 attcagaaggagtcgactcttcacttggt 350 |||||||||||||| || ||||||||||| Sbjct: 1108 attcagaaggagtctacacttcacttggt 1136
>ref|XM_001135183.1| PREDICTED: Pan troglodytes similar to ubiquitin A-52 residue ribosomal protein fusion product 1 (LOC735674), mRNA Length = 1126 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||||||||| || ||||||||||| ||||||||| ||| Sbjct: 280 atgcagatctttgtgaagaccctcacgggcaaaaccatcacccttgaggtcgagcccagt 339 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || ||||| ||||||||||| |||||||| || || || || |||||| Sbjct: 340 gacaccattgagaatgtcaaagccaaaattcaagacaaggagggtatcccacctgaccag 399 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||||||||||||||| ||| |||||||||| ||||| || | ||||||||| Sbjct: 400 cagcgtctgatatttgctggcaaacagctggaggatggccgcactctctcagactacaac 459 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 460 atccagaaagagtc 473
>gb|BT026658.1| Gasterosteus aculeatus clone CEC34-C05 mRNA sequence Length = 1510 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || |||||||||||||| ||||||||| |||| Sbjct: 288 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctggaggtcgagcccagc 347 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||| |||||||| || ||||| |||||||| || || || || ||| Sbjct: 348 gacaccatcgagaacgtgaaggccaagatccaggataaggaaggcatccccccagatcag 407 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| ||||||||| |||| ||||| ||||| || ||||||||||| Sbjct: 408 cagaggctgatctttgccggcaagcagctggaagatggccgcaccctctctgactacaac 467 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 468 atccagaaggagtc 481 Score = 149 bits (75), Expect = 2e-32 Identities = 162/191 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||||||||| || |||||||||||||| ||||||||| |||| Sbjct: 972 atgcagatcttcgtgaagaccctcactggcaagaccatcacccttgaggtcgagcccagc 1031 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||| |||||||| || ||||| |||||||| || || || || ||| Sbjct: 1032 gacaccatcgagaacgtgaaggccaagatccaggataaggaaggcatccccccagatcag 1091 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| ||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 1092 cagaggctgatctttgccggcaagcagctggaagatggccgcaccctctcagactacaac 1151 Query: 322 attcagaagga 332 || |||||||| Sbjct: 1152 atccagaagga 1162 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||||||||| || |||||||||||||| ||||||||| |||| Sbjct: 516 atgcagatctttgtgaagaccctcactggcaagaccatcaccctggaggtcgagcccagc 575 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||| |||||||| || ||||| |||||||| || || || || ||| Sbjct: 576 gacaccatcgagaacgtgaaggccaagatccaggataaggaaggcatccccccagatcag 635 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| ||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 636 cagaggctgatctttgccggcaagcagctggaagatggccgcaccctctccgactacaac 695 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 696 atccagaaggagtc 709 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || || |||||||| || |||||||||||||| ||||||||| |||| Sbjct: 60 atgcagatctttgtgaaaaccctcactggcaagaccatcacccttgaggtcgagcccagc 119 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||| |||||||| || ||||| |||||||| || || || || ||| Sbjct: 120 gacaccatcgagaacgtgaaggccaagatccaggataaggaaggcatccccccagatcag 179 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| ||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 180 cagaggctgatctttgcaggcaagcagctggaagatggccgcaccctctccgactacaac 239 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 240 atccagaaggagtc 253 Score = 139 bits (70), Expect = 2e-29 Identities = 163/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || ||||||||||| || |||||||||||||| ||||||||| |||| Sbjct: 744 atgcagatctttgtgaagaccctcactggcaagaccatcaccctggaggtcgagcccagc 803 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||||||| ||||| ||||| || || ||||| |||||||| || || || || ||| Sbjct: 804 gacaccatcgagaacgtgaaggcaaagatccaggataaggaaggcatccccccagatcag 863 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||| ||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 864 cagaggctgatctttgccggcaagcagctggaagatggccgcaccctctccgactacaac 923 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 924 atccagaaggagtc 937
>ref|XM_001115463.1| PREDICTED: Macaca mulatta similar to ubiquitin A-52 residue ribosomal protein fusion product 1 (LOC720243), mRNA Length = 929 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||||||||| || ||||||||||||||||||||| ||| Sbjct: 235 atgcagatctttgtgaagaccctcacgggcaaaaccatcaccctcgaggtcgagcccagt 294 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || ||||| ||||||||||| |||||||| || || || || |||||| Sbjct: 295 gacaccattgagaatgtcaaagccaaaattcaagacaaggagggtatcccacctgaccag 354 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||||||||||||||| ||| |||| ||||| ||||| || | ||||||||| Sbjct: 355 cagcgtctgatatttgctggcaaacagctggaagatggccgcactctctcagactacaac 414 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 415 atccagaaagagtc 428
>gb|DQ216252.1| Taeniopygia guttata clone 0058P0005E02 ubiquitin C variant 12-like mRNA, complete sequence Length = 1378 Score = 163 bits (82), Expect = 1e-36 Identities = 178/210 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||||||||||||||| || || |||||||||||||| || || ||| ||| Sbjct: 524 gatgcagatcttcgtcaagaccctgaccggcaagaccatcaccctggaagttgagcccag 583 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| |||||||||||||| || |||||||||||||| ||||| || ||||| Sbjct: 584 tgacaccatcgagaacgtcaaggccaagatccaggacaaggaaggcattcccccagacca 643 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| |||||||| |||||| |||| ||||| ||||| || | |||||||| Sbjct: 644 gcagaggctgatctttgctggtaagcagctggaagatgggcgcaccctctccgactacaa 703 Query: 321 cattcagaaggagtcgactcttcacttggt 350 ||| ||||| ||||| ||||| ||| |||| Sbjct: 704 catccagaaagagtcaactctgcacctggt 733 Score = 155 bits (78), Expect = 3e-34 Identities = 177/210 (84%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 ||||||||||||||| |||||||| || || |||||||||||||| || || ||| ||| Sbjct: 980 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaagttgagcccag 1039 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || ||||||||||| || |||||||||||||| || ||||| ||||| Sbjct: 1040 tgacaccatcgagaatgtcaaggccaagatccaggacaaggaaggtatccctcctgacca 1099 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| || |||||||||||| |||| ||||| ||||| || | |||||||| Sbjct: 1100 gcagaggctgattttcgctggcaagcagctggaagatgggcgcaccctctccgactacaa 1159 Query: 321 cattcagaaggagtcgactcttcacttggt 350 ||| ||||||||||| ||||| ||| |||| Sbjct: 1160 catccagaaggagtcaactctgcacctggt 1189 Score = 145 bits (73), Expect = 3e-31 Identities = 175/209 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 69 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggtggagcccagt 128 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || ||||||||||| || ||||||||||| || ||||| || |||||| Sbjct: 129 gacaccattgaaaatgtcaaggccaagatccaggacaaggagggcattcccccagaccag 188 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||||||||| ||||| || | ||||||||| Sbjct: 189 cagaggctgatctttgctggcaagcagctggaggatgggcgcaccctctccgactacaac 248 Query: 322 attcagaaggagtcgactcttcacttggt 350 || ||||| ||||| ||||| ||| |||| Sbjct: 249 atccagaaagagtcaactctccacctggt 277 Score = 135 bits (68), Expect = 3e-28 Identities = 161/192 (83%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||| || |||||||| || || |||||||||||||| ||||| ||| ||| Sbjct: 296 gatgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggtggagcccag 355 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 ||||||||||| || ||||||||||| || |||||||||||||| |||||||| ||| | Sbjct: 356 tgacaccatcgagaatgtcaaggccaagatccaggacaaggaaggtattcctcctgacaa 415 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| |||||||| |||||| |||| ||||| ||||| || | |||||||| Sbjct: 416 gcagaggctgatctttgctggtaagcagctggaagatgggcgcaccctgtcagactacaa 475 Query: 321 cattcagaagga 332 || |||||||| Sbjct: 476 tatccagaagga 487 Score = 119 bits (60), Expect = 2e-23 Identities = 159/192 (82%) Strand = Plus / Plus Query: 141 gatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcag 200 |||||||||||||||||||||||| || || ||||||||||| || ||||| ||| ||| Sbjct: 752 gatgcagatcttcgtcaagaccctgaccggcaagaccatcactcttgaggtggagcccag 811 Query: 201 cgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggacca 260 |||||||| || || || |||||||| || |||||||||||||| ||||| || ||||| Sbjct: 812 tgacaccattgaaaatgtgaaggccaagatccaggacaaggaaggcattccaccagacca 871 Query: 261 gcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaa 320 |||| | |||| || ||||| |||||| |||||||||| || || | | |||||||| Sbjct: 872 gcagaggctgattttcgctggtaagcagctggaggatggtcgtactttgtccgactacaa 931 Query: 321 cattcagaagga 332 ||| |||||||| Sbjct: 932 catccagaagga 943 Score = 44.1 bits (22), Expect = 0.73 Identities = 43/50 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||| || ||||||| ||||| |||||||||| |||||||||||||| Sbjct: 1080 gaaggtatccctcctgaccagcagaggctgattttcgctggcaagcagct 1129
>gb|BT012698.1| Lycopersicon esculentum clone 113569R, mRNA sequence Length = 1626 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| |||||||| ||||| || ||||| |||||||| ||| Sbjct: 289 atgcagatcttcgtgaagactctcacgggtaagacgattacccttgaggtcgaaagctca 348 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||||||||| || || ||||| |||||||| ||||| || |||||| Sbjct: 349 gacaccattgacaacgtcaaggctaagatccaggataaggaaggcattcccccagaccag 408 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||| || ||||||||||| ||||| ||||| || |||||||||||| Sbjct: 409 cagaggttgatctttgcaggaaagcagttggaagatggccgcaccctagctgactacaac 468 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 469 atccagaaggagtc 482 Score = 151 bits (76), Expect = 4e-33 Identities = 187/224 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||| ||||| || |||||||| || ||||| ||||||||||| ||||| |||||| | Sbjct: 973 atgcaaatctttgtgaagacccttaccgggaaaaccatcaccctggaggttgagagctcc 1032 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| ||||| ||||||||||| || || |||||||| || ||||| || |||||| Sbjct: 1033 gacaccattgacaatgtcaaggccaagatccaagacaaggagggtattcccccagaccag 1092 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| ||||||||||||||| | |||||||| ||||| | || ||||| ||| Sbjct: 1093 cagaggttgatttttgctggcaagcagctcgaggatggccgcactttggcggactataac 1152 Query: 322 attcagaaggagtcgactcttcacttggtcctcaggctcagggg 365 || || ||||||||||| || |||||||| || ||||| ||||| Sbjct: 1153 atccaaaaggagtcgaccctgcacttggtgcttaggctgagggg 1196 Score = 131 bits (66), Expect = 4e-27 Identities = 162/194 (83%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||| ||||| || || || ||||||||||| | ||||| || ||| | Sbjct: 517 atgcagatcttcgttaagactcttaccggaaagaccatcactttggaggtggaaagctcc 576 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| |||||||| ||||| || || ||||| ||||||||||| || || |||||| Sbjct: 577 gacaccattgacaacgtgaaggctaagatccaggataaggaagggatccccccagaccag 636 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| |||||| | |||||||| ||||| || |||||||||||| Sbjct: 637 cagaggttgatcttcgctggaaagcagctcgaggatggtcgcaccctggctgactacaac 696 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 697 atccagaaggagtc 710 Score = 123 bits (62), Expect = 1e-24 Identities = 161/194 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||| | || |||||||||||||| | ||||| ||||| Sbjct: 1201 atgcagatctttgtgaagaccttgaccgggaagaccatcactttggaggtggagagttct 1260 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||||||||| || || || || |||||||||||||| ||||| || || |||||| Sbjct: 1261 gacaccatcgacaatgtgaaagctaagattcaggacaaggaggggatcccaccagaccag 1320 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| |||||| | |||||||| ||||| |||||||||||||| Sbjct: 1321 cagaggttgattttcgctggtaagcagcttgaggatggccgcacccttgctgactacaat 1380 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 1381 atccagaaggagtc 1394 Score = 121 bits (61), Expect = 4e-24 Identities = 175/213 (82%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||| || || ||||||||||| || ||||||||||| | ||||| || ||| | Sbjct: 745 atgcagatttttgttaagaccctcaccggaaagaccatcactttggaggtggaaagctcc 804 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || || ||||| || || ||||||||||| || |||||| | |||||| Sbjct: 805 gacaccattgataatgttaaggctaagatccaggacaaggagggaattccttcagaccag 864 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | ||||| || ||||| |||||| | ||||| || ||||| ||||| ||||||||| Sbjct: 865 cagaggttgattttcgctggtaagcagctcgaggacggccgcacccttgccgactacaac 924 Query: 322 attcagaaggagtcgactcttcacttggtcctc 354 || |||||||||||||| |||||| | |||||| Sbjct: 925 atccagaaggagtcgacccttcaccttgtcctc 957 Score = 89.7 bits (45), Expect = 1e-14 Identities = 159/197 (80%) Strand = Plus / Plus Query: 139 aagatgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagc 198 |||||||||||||| || || || ||||| || ||||| |||||||| ||||| || || Sbjct: 58 aagatgcagatctttgtgaaaactctcaccggaaagactatcaccctagaggtggaaagt 117 Query: 199 agcgacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggac 258 || || ||||||||||| ||||| || || ||||| |||||||| ||||| ||||| Sbjct: 118 tctgatacaatcgacaacgttaaggctaagatccaggataaggaaggaattcccccggat 177 Query: 259 cagcagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactac 318 ||||| | | || || ||||| |||||||||||||| ||||| || || ||||| ||| Sbjct: 178 cagcaaaggcttatcttcgctggaaagcagttggaggacggacgtactctagctgattac 237 Query: 319 aacattcagaaggagtc 335 ||||| ||||||||||| Sbjct: 238 aacatccagaaggagtc 254
>dbj|AB168934.1| Macaca fascicularis testis cDNA, clone: QtsA-15896, similar to human ubiquitin A-52 residue ribosomal protein fusionproduct 1 (UBA52), mRNA, RefSeq: NM_003333.2 Length = 551 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||| || |||||||||||||| || ||||||||||||||||||||| ||| Sbjct: 52 atgcagatctttgtgaagaccctcacgggcaaaaccatcaccctcgaggtcgagcccagt 111 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || || ||||| ||||||||||| |||||||| || || || || |||||| Sbjct: 112 gacaccattgagaatgtcaaagccaaaattcaagacaaggagggtatcccacctgaccag 171 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 |||||| |||||||||||||||| ||| |||| ||||| ||||| || | ||||||||| Sbjct: 172 cagcgtctgatatttgctggcaaacagctggaagatggccgcactctctcagactacaac 231 Query: 322 attcagaaggagtc 335 || ||||| ||||| Sbjct: 232 atccagaaagagtc 245
>emb|CR734308.2|CNS0GTDF Tetraodon nigroviridis full-length cDNA Length = 684 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 290 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 349 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 350 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 409 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 410 atccagaaggagtc 423 Score = 157 bits (79), Expect = 7e-35 Identities = 160/187 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 458 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 517 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 518 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 577 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 578 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 637 Query: 322 attcaga 328 || |||| Sbjct: 638 atccaga 644 Score = 155 bits (78), Expect = 3e-34 Identities = 165/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 182 atccagaaggagtc 195 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 329 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 386 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 557 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 606
>emb|CR734033.2|CNS0GT5S Tetraodon nigroviridis full-length cDNA Length = 755 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 76 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 135 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 136 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 195 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 196 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 255 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 256 atccagaaggagtc 269 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 304 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 363 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 364 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 423 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 424 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 483 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 484 atccagaaggagtc 497 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 532 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 591 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 592 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 651 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 652 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 711 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 712 atccagaaggagtc 725 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 175 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 232 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 403 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 460 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 631 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 688
>emb|CR733056.2|CNS0GSJ4 Tetraodon nigroviridis full-length cDNA Length = 751 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 72 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 131 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 132 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 191 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 192 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 251 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 252 atccagaaggagtc 265 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 300 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 359 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 360 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 419 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 420 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 479 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 480 atccagaaggagtc 493 Score = 147 bits (74), Expect = 7e-32 Identities = 164/194 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 528 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 587 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 ||||||| || ||||| |||||||| || |||||||||||||| ||||| || | ||| Sbjct: 588 aacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgttcag 647 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 648 cagaggctgatttttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 707 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 708 atccagaaggagtc 721 Score = 67.9 bits (34), Expect = 5e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| ||||| ||||| |||||||||| ||||||||||||||| Sbjct: 627 gaaggcattccccctgttcagcagaggctgatttttgctggcaagcagct 676 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 171 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 228 Score = 60.0 bits (30), Expect = 1e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||||| |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 399 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 456
>emb|CR732801.2|CNS0GSD6 Tetraodon nigroviridis full-length cDNA Length = 809 Score = 163 bits (82), Expect = 1e-36 Identities = 166/194 (85%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 457 atgcagatcttcgtcaagacccttactggcaaaaccatcaccctcgaggtggagcccagc 516 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||||| || || ||| Sbjct: 517 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattccccctgatcag 576 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| |||| ||||| ||||| || | ||||||||| Sbjct: 577 cagaggctgatctttgctggcaagcagctggaagatggccgcaccctgtccgactacaac 636 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 637 atccagaaggagtc 650 Score = 151 bits (76), Expect = 4e-33 Identities = 169/200 (84%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 |||||||||||||||||||||||||| || || ||||||||||||||||| ||| |||| Sbjct: 2 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggtggagcccagc 61 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| |||||||| || |||||||||||||| ||| | || || ||| Sbjct: 62 gacaccattgagaacgtgaaggccaagatccaggacaaggaaggcattacccctgatcag 121 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 122 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctgtccgactacaac 181 Query: 322 attcagaaggagtcgactct 341 || ||||| ||||| ||||| Sbjct: 182 atccagaaagagtccactct 201 Score = 123 bits (62), Expect = 1e-24 Identities = 162/194 (83%), Gaps = 1/194 (0%) Strand = Plus / Plus Query: 142 atgcagatcttcgtcaagaccctcacggggaagaccatcaccctcgaggtcgagagcagc 201 ||||||||||||||||||||||| || || || ||||||||||||||||| ||| |||| Sbjct: 230 atgcagatcttcgtcaagaccctgactggcaaaaccatcaccctcgaggtggagcccagc 289 Query: 202 gacaccatcgacaacgtcaaggccaaaattcaggacaaggaagggattcctccggaccag 261 |||||||| || ||||| ||| ||||||| |||||||| ||||| | || || || ||| Sbjct: 290 gacaccattgagaacgtgaagaccaaaatccaggacaaagaaggcctccc-cctgatcag 348 Query: 262 cagcgtttgatatttgctggcaagcagttggaggatggacgcacacttgctgactacaac 321 ||| | |||| ||||||||||||||| | || ||||| ||||| || | ||||||||| Sbjct: 349 cagaggctgatctttgctggcaagcagcttgaagatggccgcaccctctccgactacaac 408 Query: 322 attcagaaggagtc 335 || ||||||||||| Sbjct: 409 atccagaaggagtc 422 Score = 52.0 bits (26), Expect = 0.003 Identities = 50/58 (86%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||||||| | |||| ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 101 gaaggcattacccctgatcagcagaggctgatctttgctggcaagcagcttgaagatg 158 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Plus Query: 469 gaaggcattcctcctgtgcagcaaaggctgatttatgctggcaagcagct 518 ||||||||||| |||| ||||| |||||||| | ||||||||||||||| Sbjct: 556 gaaggcattccccctgatcagcagaggctgatctttgctggcaagcagct 605 Score = 48.1 bits (24), Expect = 0.047 Identities = 36/40 (90%) Strand = Plus / Plus Query: 487 cagcaaaggctgatttatgctggcaagcagcttgcagatg 526 ||||| |||||||| | ||||||||||||||||| ||||| Sbjct: 346 cagcagaggctgatctttgctggcaagcagcttgaagatg 385 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 133,234,630 Number of extensions: 7244760 Number of successful extensions: 159392 Number of sequences better than 10.0: 2668 Number of HSP's gapped: 158139 Number of HSP's successfully gapped: 7344 Length of query: 770 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 748 Effective length of database: 18,508,616,841 Effective search space: 13844445397068 Effective search space used: 13844445397068 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
