ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf118k14
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC187707.1| Gasterosteus aculeatus clone VMRC28-60C14, comple... 54 0.001
2ref|NM_001073089.1| Oryza sativa (japonica cultivar-group) Os12g... 52 0.006
3ref|NM_001070095.1| Oryza sativa (japonica cultivar-group) Os09g... 52 0.006
4dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.006
5dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.006
6dbj|AK099197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.006
7dbj|AK072767.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.006
8gb|AY112580.1| Zea mays CL875_1 mRNA sequence 52 0.006
9emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa... 52 0.006
10emb|AL732642.4|CNS08C9H Oryza sativa chromosome 12, . BAC OSJNBb... 52 0.006
11emb|X74406.1|HSPSEN102 Hemerocallis sp. mRNA for thiol-protease 50 0.023
12emb|CR724005.2|CNS0GLL7 Tetraodon nigroviridis full-length cDNA 48 0.089
13emb|CT835871.1| Oryza sativa (indica cultivar-group) cDNA clone:... 46 0.35
14dbj|AK243212.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 46 0.35
15ref|NM_001074162.1| Oryza sativa (japonica cultivar-group) Os11g... 46 0.35
16ref|NM_001070478.1| Oryza sativa (japonica cultivar-group) Os09g... 46 0.35
17ref|NM_001070471.1| Oryza sativa (japonica cultivar-group) Os09g... 46 0.35
18ref|NM_001069595.1| Oryza sativa (japonica cultivar-group) Os09g... 46 0.35
19ref|NM_001051673.1| Oryza sativa (japonica cultivar-group) Os01g... 46 0.35
20gb|AC189411.1| Brassica rapa subsp. pekinensis clone KBrB060E11,... 46 0.35
21gb|AY700585.1| Zingiber officinale cysteine protease gp2a mRNA, ... 46 0.35
22gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.35
23gb|AY251054.1| Anthurium andraeanum cysteine protease mRNA, comp... 46 0.35
24ref|XM_536212.2| PREDICTED: Canis familiaris similar to Cathepsi... 46 0.35
25dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
26dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
27emb|AL034351.1|HS879K22 Human DNA sequence from clone RP5-879K22... 46 0.35
28gb|AF538038.1| Leishmania mexicana amazonensis cysteine proteina... 46 0.35
29gb|AY141759.1| Leishmania mexicana amazonensis clone 2A1 cystein... 46 0.35
30gb|AY141758.1| Leishmania mexicana amazonensis clone 3A4 cystein... 46 0.35
31gb|AF309687.1|AF309687 Leishmania donovani cysteine protease gen... 46 0.35
32emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine end... 46 0.35
33emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine pro... 46 0.35
34emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine end... 46 0.35
35emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease 46 0.35
36emb|X62163.1|LMLCPA L.mexicana LCPa mRNA for cysteine proteinase 46 0.35
37gb|AY028171.1| Leishmania donovani extra chromosome XC290, parti... 46 0.35
38gb|AF004593.2|AF004593 Leishmania donovani chagasi promastigote-... 46 0.35
39emb|AJ420285.1|LIN420285 Leishmania infantum cpa gene for cystei... 46 0.35
40emb|AJ130942.1|LMA130942 Leishmania major (MRHO/IR/75/ER), amast... 46 0.35
41dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
42dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
43dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
44dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
45dbj|AP005702.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
46dbj|AP005312.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.35
47gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 46 0.35
48dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.35
49dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.35
50dbj|AK071091.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.35
51gb|AF512031.3| Choristoneura fumiferana MNPV polyhedrin, complet... 46 0.35
52gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precu... 46 0.35
53dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene... 46 0.35
54gb|AY111799.1| Zea mays CL872_-2 mRNA sequence 46 0.35
55gb|AY109437.1| Zea mays CL903_-1 mRNA sequence 46 0.35
56gb|AF019146.1|AF019146 Zea mays cysteine proteinase Mir2 (mir2) ... 46 0.35
57gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precurs... 46 0.35
58gb|M97906.1|NPHCATH Choristoneura fumiferana nuclear polyhedrosi... 46 0.35
59gb|L29168.1|LEICYSTPRO Leishmania pifanoi cysteine proteinase ge... 46 0.35
60dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, comple... 46 0.35
61dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidas... 46 0.35
62gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chrom... 44 1.4
63ref|XM_627409.1| Cryptosporidium parvum Iowa II hypothetical pro... 44 1.4
64emb|CR725700.2|CNS0GMWA Tetraodon nigroviridis full-length cDNA 44 1.4
65emb|CR723850.2|CNS0GLGW Tetraodon nigroviridis full-length cDNA 44 1.4
66emb|CR710967.2|CNS0GBJ7 Tetraodon nigroviridis full-length cDNA 44 1.4
67emb|AL513304.27| Human DNA sequence from clone RP11-398B16 on ch... 44 1.4
68emb|BX067361.1|CNS09O51 Single read from an extremity of a full-... 44 1.4
69emb|BX065039.1|CNS09MCJ Single read from an extremity of a full-... 44 1.4
70emb|BX056897.1|CNS09G2D Single read from an extremity of a full-... 44 1.4
71emb|BX056667.1|CNS09FVZ Single read from an extremity of a full-... 44 1.4
72emb|BX056666.1|CNS09FVY Single read from an extremity of a full-... 44 1.4
73emb|BX053071.1|CNS09D43 Single read from an extremity of a full-... 44 1.4
74emb|BX042815.1|CNS09577 Single read from an extremity of a full-... 44 1.4
75emb|BX039805.1|CNS092VL Single read from an extremity of a full-... 44 1.4
76emb|BX034094.1|CNS08YGY Single read from an extremity of a full-... 44 1.4
77emb|BX020010.1|CNS08NLQ Single read from an extremity of a full-... 44 1.4
78emb|BX011839.1|CNS08HAR Single read from an extremity of a full-... 44 1.4
79emb|BX011624.1|CNS08H4S Single read from an extremity of a full-... 44 1.4
80emb|BX009000.1|CNS08F3W Single read from an extremity of a full-... 44 1.4
81emb|BX006361.1|CNS08D2L Single read from an extremity of a full-... 44 1.4
82dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 1.4
83ref|XM_316470.2| Anopheles gambiae str. PEST ENSANGP00000021035 ... 44 1.4
84dbj|AB109188.1| Helianthus annuus scp3 mRNA for cysteine proteas... 44 1.4
85emb|AM050334.1| Unidentified microorganism phagemid clone pBKR.44 44 1.4
86gb|U34747.1|PSU34747 Phalaenopsis sp. 'hybrid SM9108' cysteine p... 44 1.4
87emb|AM263198.1| Listeria welshimeri serovar 6b str. SLCC5334 com... 42 5.5
88gb|AE014298.4| Drosophila melanogaster chromosome X, complete se... 42 5.5
89ref|NM_027149.2| Mus musculus WD repeat domain 20a (Wdr20a), mRNA 42 5.5
90ref|XM_968514.1| PREDICTED: Tribolium castaneum similar to CG121... 42 5.5
91gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence 42 5.5
92gb|BC064773.1| Mus musculus RIKEN cDNA 2310040A13 gene, mRNA (cD... 42 5.5
93gb|BC026761.1| Mus musculus WD repeat domain 20a, mRNA (cDNA clo... 42 5.5
94gb|AY504966.1| Iris hollandica putative cysteine protease 1 (CYS... 42 5.5
95gb|L77746.1|BACAPRA Bacillus thuringiensis alkaline protease A (... 42 5.5
96gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CI... 42 5.5
97gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, comp... 42 5.5
98gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, co... 42 5.5
99ref|NM_131941.2| Drosophila melanogaster CG11436-RA (CG11436), mRNA 42 5.5
100dbj|AK145389.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN fu... 42 5.5
101dbj|AK136417.1| Mus musculus adult male colon cDNA, RIKEN full-l... 42 5.5
102gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell ... 42 5.5
103dbj|AK052481.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 42 5.5
104dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 5.5
105gb|AY061262.1| Drosophila melanogaster LD19190 full length cDNA 42 5.5
106emb|BX071926.1|CNS09RNU Single read from an extremity of a full-... 42 5.5
107emb|BX071892.1|CNS09RMW Single read from an extremity of a full-... 42 5.5
108emb|BX068916.1|CNS09PC8 Single read from an extremity of a full-... 42 5.5
109emb|BX067978.1|CNS09OM6 Single read from an extremity of a full-... 42 5.5
110emb|BX067274.1|CNS09O2M Single read from an extremity of a full-... 42 5.5
111emb|BX067273.1|CNS09O2L Single read from an extremity of a full-... 42 5.5
112emb|BX065623.1|CNS09MSR Single read from an extremity of a full-... 42 5.5
113emb|BX065469.1|CNS09MOH Single read from an extremity of a full-... 42 5.5
114emb|BX065401.1|CNS09MML Single read from an extremity of a full-... 42 5.5
115emb|BX058037.1|CNS09GY1 Single read from an extremity of a full-... 42 5.5
116emb|BX054975.1|CNS09EKZ Single read from an extremity of a full-... 42 5.5
117emb|BX054726.1|CNS09EE2 Single read from an extremity of a full-... 42 5.5
118emb|BX054725.1|CNS09EE1 Single read from an extremity of a full-... 42 5.5
119emb|BX053305.1|CNS09DAL Single read from an extremity of a full-... 42 5.5
120emb|BX053304.1|CNS09DAK Single read from an extremity of a full-... 42 5.5
121emb|BX046548.1|CNS0982W Single read from an extremity of a full-... 42 5.5
122emb|BX045680.1|CNS097ES Single read from an extremity of a full-... 42 5.5
123emb|BX042580.1|CNS0950O Single read from an extremity of a full-... 42 5.5
124emb|BX042579.1|CNS0950N Single read from an extremity of a full-... 42 5.5
125emb|BX041880.1|CNS094H8 Single read from an extremity of a full-... 42 5.5
126emb|BX041463.1|CNS0945N Single read from an extremity of a full-... 42 5.5
127emb|BX041349.1|CNS0942H Single read from an extremity of a full-... 42 5.5
128emb|BX040977.1|CNS093S5 Single read from an extremity of a full-... 42 5.5
129emb|BX033733.1|CNS08Y6X Single read from an extremity of a full-... 42 5.5
130emb|BX031543.1|CNS08WI3 Single read from an extremity of a full-... 42 5.5
131emb|BX027561.1|CNS08TFH Single read from an extremity of a full-... 42 5.5
132emb|BX025600.1|CNS08RX0 Single read from an extremity of a full-... 42 5.5
133emb|BX021322.1|CNS08OM6 Single read from an extremity of a full-... 42 5.5
134emb|BX020409.1|CNS08NWT Single read from an extremity of a full-... 42 5.5
135emb|BX017672.1|CNS08LSS Single read from an extremity of a full-... 42 5.5
136emb|BX015014.1|CNS08JQY Single read from an extremity of a full-... 42 5.5
137emb|BX010581.1|CNS08GBT Single read from an extremity of a full-... 42 5.5
138emb|BX011957.1|CNS08HE1 Single read from an extremity of a full-... 42 5.5
139emb|BX012160.1|CNS08HJO Single read from an extremity of a full-... 42 5.5
140emb|BX012159.1|CNS08HJN Single read from an extremity of a full-... 42 5.5
141emb|BX011093.1|CNS08GQ1 Single read from an extremity of a full-... 42 5.5
142emb|BX010949.1|CNS08GM1 Single read from an extremity of a full-... 42 5.5
143emb|BX010605.1|CNS08GCH Single read from an extremity of a full-... 42 5.5
144emb|BX010604.1|CNS08GCG Single read from an extremity of a full-... 42 5.5
145emb|BX010191.1|CNS08G0Z Single read from an extremity of a full-... 42 5.5
146emb|BX008394.1|CNS08EN2 Single read from an extremity of a full-... 42 5.5
147emb|BX005487.1|CNS08CEB Single read from an extremity of a full-... 42 5.5
148gb|AF170567.1|AF170567 Bacillus thuringiensis alkaline protease ... 42 5.5
149gb|AF454956.1| Brassica oleracea senescence-associated cysteine ... 42 5.5
150dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic D... 42 5.5
151dbj|AP006697.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 5.5
152gb|AF466200.2| Sorghum bicolor putative protein kinase gene, par... 42 5.5
153dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic D... 42 5.5
154dbj|AP004519.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 5.5
155gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 42 5.5
156gb|AF019145.2|AF019145 Zea mays cysteine protease Mir1 (mir1) mR... 42 5.5
157emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on ch... 42 5.5 
>gb|AC187707.1| Gasterosteus aculeatus clone VMRC28-60C14, complete sequence
          Length = 136383
 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 1111   gtattggatcgtgaagaactcgtgggg 1137
              |||||||||||||||||||||||||||
Sbjct: 103332 gtattggatcgtgaagaactcgtgggg 103358
to top
>ref|NM_001073089.1| Oryza sativa (japonica cultivar-group) Os12g0273800 (Os12g0273800)
            mRNA, complete cds
          Length = 1515

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1107 ccaagtattggatcgtgaagaactcgtgggggatgacatggggcga 1152
            ||||||||||| | ||||||||||||||||| | ||| ||||||||
Sbjct: 890  ccaagtattggctggtgaagaactcgtggggcacgacgtggggcga 935
to top
>ref|NM_001070095.1| Oryza sativa (japonica cultivar-group) Os09g0497500 (Os09g0497500)
            mRNA, complete cds
          Length = 1322

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1109 aagtattggatcgtgaagaactcgtggggg 1138
            ||||| ||||||||||||||||||||||||
Sbjct: 981  aagtactggatcgtgaagaactcgtggggg 1010
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                              
Query: 1107     ccaagtattggatcgtgaagaactcgtgggggatgacatggggcga 1152
                ||||||||||| | ||||||||||||||||| | ||| ||||||||
Sbjct: 10054086 ccaagtattggctggtgaagaactcgtggggcacgacgtggggcga 10054131
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9
          Length = 22696651

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 1109     aagtattggatcgtgaagaactcgtggggg 1138
                ||||| ||||||||||||||||||||||||
Sbjct: 18948303 aagtactggatcgtgaagaactcgtggggg 18948274



 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                       
Query: 689      ctggtgtctctgtcggagcaacagctgatagactgcgac 727
                ||||| |||||||||||||| |||||| | |||||||||
Sbjct: 12845073 ctggtctctctgtcggagcagcagctggtggactgcgac 12845035



 Score = 46.1 bits (23), Expect = 0.35
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                            
Query: 665      atacacaagatcaagagagggactctggtgtctctgtcggagcaacagctgatagactgc 724
                ||||| ||||||||||  ||||  |||||||| |||||||||||  ||||| | ||||||
Sbjct: 22051024 atacagaagatcaagaaggggaagctggtgtcactgtcggagcaggagctggtcgactgc 22050965

                   
Query: 725      gac 727
                |||
Sbjct: 22050964 gac 22050962



 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 1107     ccaagtattggatcgtgaagaactcgtgggg 1137
                ||||||| |||||||| ||||||||||||||
Sbjct: 22126355 ccaagtactggatcgttaagaactcgtgggg 22126325



 Score = 46.1 bits (23), Expect = 0.35
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 1109     aagtattggatcgtgaagaactcgtgg 1135
                |||||||||||||| ||||||||||||
Sbjct: 22154283 aagtattggatcgtcaagaactcgtgg 22154257



 Score = 44.1 bits (22), Expect = 1.4
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                              
Query: 1108     caagtattggatcgtgaagaactcgtgggggatgacatggggcgac 1153
                |||||| |||||| | |||||||||||||||| ||  |||||||||
Sbjct: 22050584 caagtactggatcatcaagaactcgtgggggaagaactggggcgac 22050539
to top
>dbj|AK099197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023120K15, full
            insert sequence
          Length = 1290

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1109 aagtattggatcgtgaagaactcgtggggg 1138
            ||||| ||||||||||||||||||||||||
Sbjct: 972  aagtactggatcgtgaagaactcgtggggg 1001
to top
>dbj|AK072767.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023138P12, full
            insert sequence
          Length = 1322

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1109 aagtattggatcgtgaagaactcgtggggg 1138
            ||||| ||||||||||||||||||||||||
Sbjct: 981  aagtactggatcgtgaagaactcgtggggg 1010
to top
>gb|AY112580.1| Zea mays CL875_1 mRNA sequence
          Length = 1553

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 670 caagatcaagagagggactctggtgtctctgtcggagcaacagctgatagactgcgac 727
           |||||||| || |||||  |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 574 caagatcacgacagggaagctggtgtcgctgtcggagcaggagctgatcgactgcgac 631
to top
>emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa0056I18 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 145890

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                            
Query: 1107   ccaagtattggatcgtgaagaactcgtgggggatgacatggggcga 1152
              ||||||||||| | ||||||||||||||||| | ||| ||||||||
Sbjct: 108535 ccaagtattggctggtgaagaactcgtggggcacgacgtggggcga 108490
to top
>emb|AL732642.4|CNS08C9H Oryza sativa chromosome 12, . BAC OSJNBb0071E08 of library OSJNBb
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 132906

 Score = 52.0 bits (26), Expect = 0.006
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                          
Query: 1107 ccaagtattggatcgtgaagaactcgtgggggatgacatggggcga 1152
            ||||||||||| | ||||||||||||||||| | ||| ||||||||
Sbjct: 3988 ccaagtattggctggtgaagaactcgtggggcacgacgtggggcga 3943
to top
>emb|X74406.1|HSPSEN102 Hemerocallis sp. mRNA for thiol-protease
          Length = 1320

 Score = 50.1 bits (25), Expect = 0.023
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 1109 aagtattggatcgtgaagaactcgtgggg 1137
            ||||||||||| |||||||||||||||||
Sbjct: 937  aagtattggattgtgaagaactcgtgggg 965
to top
>emb|CR724005.2|CNS0GLL7 Tetraodon nigroviridis full-length cDNA
          Length = 859

 Score = 48.1 bits (24), Expect = 0.089
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1112 tattggatcgtgaagaactcgtggggga 1139
            |||||||||||||||||||| |||||||
Sbjct: 471  tattggatcgtgaagaactcctggggga 498
to top
>emb|CT835871.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA103L09, full
            insert sequence
          Length = 1004

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||||| ||||||||||||||
Sbjct: 505  ccaagtactggatcgttaagaactcgtgggg 535
to top
>dbj|AK243212.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J100042M20, full
            insert sequence
          Length = 1406

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||||| ||||||||||||||
Sbjct: 1121 ccaagtactggatcgttaagaactcgtgggg 1151
to top
>ref|NM_001074162.1| Oryza sativa (japonica cultivar-group) Os11g0255300 (Os11g0255300)
            mRNA, complete cds
          Length = 1509

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||||| ||||||||||||||
Sbjct: 1048 ccaagtactggatcgtcaagaactcgtgggg 1078
to top
>ref|NM_001070478.1| Oryza sativa (japonica cultivar-group) Os09g0564200 (Os09g0564200)
            mRNA, complete cds
          Length = 1110

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||||| ||||||||||||||
Sbjct: 932  ccaagtactggatcgttaagaactcgtgggg 962
to top
>ref|NM_001070471.1| Oryza sativa (japonica cultivar-group) Os09g0562700 (Os09g0562700)
           mRNA, partial cds
          Length = 904

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 665 atacacaagatcaagagagggactctggtgtctctgtcggagcaacagctgatagactgc 724
           ||||| ||||||||||  ||||  |||||||| |||||||||||  ||||| | ||||||
Sbjct: 133 atacagaagatcaagaaggggaagctggtgtcactgtcggagcaggagctggtcgactgc 192

              
Query: 725 gac 727
           |||
Sbjct: 193 gac 195



 Score = 44.1 bits (22), Expect = 1.4
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 1108 caagtattggatcgtgaagaactcgtgggggatgacatggggcgac 1153
            |||||| |||||| | |||||||||||||||| ||  |||||||||
Sbjct: 573  caagtactggatcatcaagaactcgtgggggaagaactggggcgac 618
to top
>ref|NM_001069595.1| Oryza sativa (japonica cultivar-group) Os09g0381400 (Os09g0381400)
           mRNA, complete cds
          Length = 1880

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 689 ctggtgtctctgtcggagcaacagctgatagactgcgac 727
           ||||| |||||||||||||| |||||| | |||||||||
Sbjct: 628 ctggtctctctgtcggagcagcagctggtggactgcgac 666
to top
>ref|NM_001051673.1| Oryza sativa (japonica cultivar-group) Os01g0907600 (Os01g0907600)
           mRNA, complete cds
          Length = 1377

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 689 ctggtgtctctgtcggagcaacagctgatagactgcgac 727
           |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 554 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 592
to top
>gb|AC189411.1| Brassica rapa subsp. pekinensis clone KBrB060E11, complete sequence
          Length = 139940

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 46    tggtaacacgatcatgttctcca 68
             |||||||||||||||||||||||
Sbjct: 38066 tggtaacacgatcatgttctcca 38044
to top
>gb|AY700585.1| Zingiber officinale cysteine protease gp2a mRNA, complete cds
          Length = 1359

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 979  tggatcgtgaagaactcgtgggg 1001
to top
>gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0026D03 map near S2137, complete sequence
          Length = 115141

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 1107  ccaagtattggatcgtgaagaactcgtgggg 1137
             ||||||| |||||||| ||||||||||||||
Sbjct: 34031 ccaagtactggatcgtcaagaactcgtgggg 34061
to top
>gb|AY251054.1| Anthurium andraeanum cysteine protease mRNA, complete cds
          Length = 1814

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 1082 tggatcgtgaagaactcgtgggg 1104
to top
>ref|XM_536212.2| PREDICTED: Canis familiaris similar to Cathepsin H precursor
            (LOC479065), mRNA
          Length = 1206

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 796  tggatcgtgaagaactcgtgggg 818
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 1107    ccaagtattggatcgtgaagaactcgtgggg 1137
               ||||||| |||||||| ||||||||||||||
Sbjct: 8298369 ccaagtactggatcgtcaagaactcgtgggg 8298339
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 689      ctggtgtctctgtcggagcaacagctgatagactgcgac 727
                |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 39495272 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 39495310
to top
>emb|AL034351.1|HS879K22 Human DNA sequence from clone RP5-879K22 on chromosome 1q32.1-41
             Contains part of the gene for melanoma antigen recognized
             by T cells 2 protein (MART2), complete sequence
          Length = 137678

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 145   gtcgctgctgacaagtgatgttc 167
             |||||||||||||||||||||||
Sbjct: 47274 gtcgctgctgacaagtgatgttc 47252
to top
>gb|AF538038.1| Leishmania mexicana amazonensis cysteine proteinase (cys1) gene,
            complete cds
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 913  tggatcgtgaagaactcgtgggg 935
to top
>gb|AY141759.1| Leishmania mexicana amazonensis clone 2A1 cysteine proteinase mRNA,
            complete cds
          Length = 1568

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 961  tggatcgtgaagaactcgtgggg 983
to top
>gb|AY141758.1| Leishmania mexicana amazonensis clone 3A4 cysteine proteinase mRNA,
            complete cds
          Length = 2431

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 1079 tggatcgtgaagaactcgtgggg 1101
to top
>gb|AF309687.1|AF309687 Leishmania donovani cysteine protease gene, complete cds
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 910  tggatcgtgaagaactcgtgggg 932
to top
>emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine endopeptidase EP-A
          Length = 1299

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 964  tggatcgtgaagaactcgtgggg 986
to top
>emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine proteinase
          Length = 5593

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 689  ctggtgtctctgtcggagcaacagctgatagactgcgac 727
            |||||||| ||||||||||| |||||| | |||||||||
Sbjct: 4394 ctggtgtcgctgtcggagcagcagctggtggactgcgac 4432



 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||| ||||||||||||||||
Sbjct: 4782 ccaagtactggatcatgaagaactcgtgggg 4812
to top
>emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine endopeptidase EP-A
          Length = 2752

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 2341 tggatcgtgaagaactcgtgggg 2363
to top
>emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease
          Length = 1440

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||||| ||||||||||||||
Sbjct: 1043 ccaagtactggatcgtcaagaactcgtgggg 1073
to top
>emb|X62163.1|LMLCPA L.mexicana LCPa mRNA for cysteine proteinase
          Length = 2355

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 2140 tggatcgtgaagaactcgtgggg 2162
to top
>gb|AY028171.1| Leishmania donovani extra chromosome XC290, partial sequence
          Length = 44273

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1115  tggatcgtgaagaactcgtgggg 1137
             |||||||||||||||||||||||
Sbjct: 27733 tggatcgtgaagaactcgtgggg 27755
to top
>gb|AF004593.2|AF004593 Leishmania donovani chagasi promastigote-specific cysteine protease
            (ldccys2) gene, complete cds
          Length = 2684

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 1268 tggatcgtgaagaactcgtgggg 1290
to top
>emb|AJ420285.1|LIN420285 Leishmania infantum cpa gene for cysteine proteinase
          Length = 1665

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 1003 tggatcgtgaagaactcgtgggg 1025
to top
>emb|AJ130942.1|LMA130942 Leishmania major (MRHO/IR/75/ER), amastigote cpa gene encoding
            cysteine proteinase A
          Length = 697

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 539  tggatcgtgaagaactcgtgggg 561
to top
>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1417F08
          Length = 155536

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 689   ctggtgtctctgtcggagcaacagctgatagactgcgac 727
             |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 70286 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 70324
to top
>dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0042B15
          Length = 157981

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 1107  ccaagtattggatcgtgaagaactcgtgggg 1137
             ||||||| |||||||| ||||||||||||||
Sbjct: 47848 ccaagtactggatcgttaagaactcgtgggg 47818



 Score = 46.1 bits (23), Expect = 0.35
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 1109  aagtattggatcgtgaagaactcgtgg 1135
             |||||||||||||| ||||||||||||
Sbjct: 75776 aagtattggatcgtcaagaactcgtgg 75750
to top
>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0635G10
          Length = 146728

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                         
Query: 665   atacacaagatcaagagagggactctggtgtctctgtcggagcaacagctgatagactgc 724
             ||||| ||||||||||  ||||  |||||||| |||||||||||  ||||| | ||||||
Sbjct: 93088 atacagaagatcaagaaggggaagctggtgtcactgtcggagcaggagctggtcgactgc 93029

                
Query: 725   gac 727
             |||
Sbjct: 93028 gac 93026



 Score = 44.1 bits (22), Expect = 1.4
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 1108  caagtattggatcgtgaagaactcgtgggggatgacatggggcgac 1153
             |||||| |||||| | |||||||||||||||| ||  |||||||||
Sbjct: 92648 caagtactggatcatcaagaactcgtgggggaagaactggggcgac 92603
to top
>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0497A05
          Length = 130919

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 689   ctggtgtctctgtcggagcaacagctgatagactgcgac 727
             |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 49714 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 49752
to top
>dbj|AP005702.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0027G10
          Length = 184759

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                     
Query: 689    ctggtgtctctgtcggagcaacagctgatagactgcgac 727
              ||||| |||||||||||||| |||||| | |||||||||
Sbjct: 152850 ctggtctctctgtcggagcagcagctggtggactgcgac 152812
to top
>dbj|AP005312.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0505H05
          Length = 152845

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 689  ctggtgtctctgtcggagcaacagctgatagactgcgac 727
            ||||| |||||||||||||| |||||| | |||||||||
Sbjct: 7057 ctggtctctctgtcggagcagcagctggtggactgcgac 7019
to top
>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 1109   aagtattggatcgtgaagaactcgtggggga 1139
              ||||| |||||||| ||||||||||||||||
Sbjct: 152854 aagtactggatcgtcaagaactcgtggggga 152884
to top
>dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-D05, full
           insert sequence
          Length = 904

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 665 atacacaagatcaagagagggactctggtgtctctgtcggagcaacagctgatagactgc 724
           ||||| ||||||||||  ||||  |||||||| |||||||||||  ||||| | ||||||
Sbjct: 133 atacagaagatcaagaaggggaagctggtgtcactgtcggagcaggagctggtcgactgc 192

              
Query: 725 gac 727
           |||
Sbjct: 193 gac 195



 Score = 44.1 bits (22), Expect = 1.4
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 1108 caagtattggatcgtgaagaactcgtgggggatgacatggggcgac 1153
            |||||| |||||| | |||||||||||||||| ||  |||||||||
Sbjct: 573  caagtactggatcatcaagaactcgtgggggaagaactggggcgac 618
to top
>dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099K03, full
            insert sequence
          Length = 1511

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||||| ||||||||||||||
Sbjct: 1049 ccaagtactggatcgtcaagaactcgtgggg 1079
to top
>dbj|AK071091.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079N05, full
           insert sequence
          Length = 1419

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 689 ctggtgtctctgtcggagcaacagctgatagactgcgac 727
           ||||| |||||||||||||| |||||| | |||||||||
Sbjct: 622 ctggtctctctgtcggagcagcagctggtggactgcgac 660
to top
>gb|AF512031.3| Choristoneura fumiferana MNPV polyhedrin, complete genome
          Length = 129593

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 698    ctgtcggagcaacagctgatagactgcgact 728
              ||||||||||||||||| || ||||||||||
Sbjct: 102260 ctgtcggagcaacagctcattgactgcgact 102290
to top
>gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precursor (EP3A) gene, complete
            cds
          Length = 2588

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 689  ctggtgtctctgtcggagcaacagctgatagactgcgac 727
            |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 1502 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 1540
to top
>dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene for cysteine
            endopeptidase, complete cds
          Length = 3836

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1107 ccaagtattggatcgtgaagaactcgtgggg 1137
            ||||||| |||||||| ||||||||||||||
Sbjct: 2565 ccaagtactggatcgtcaagaactcgtgggg 2595
to top
>gb|AY111799.1| Zea mays CL872_-2 mRNA sequence
          Length = 1761

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 1073 tggatcgtgaagaactcgtgggg 1095
to top
>gb|AY109437.1| Zea mays CL903_-1 mRNA sequence
          Length = 1664

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 689 ctggtgtctctgtcggagcaacagctgatagactgcgac 727
           |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 629 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 667
to top
>gb|AF019146.1|AF019146 Zea mays cysteine proteinase Mir2 (mir2) mRNA, complete cds
          Length = 1761

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 1073 tggatcgtgaagaactcgtgggg 1095
to top
>gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precursor, mRNA, complete cds
          Length = 1328

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 972  tggatcgtgaagaactcgtgggg 994
to top
>gb|M97906.1|NPHCATH Choristoneura fumiferana nuclear polyhedrosis virus cathepsin gene,
           complete cds
          Length = 1338

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 698 ctgtcggagcaacagctgatagactgcgact 728
           ||||||||||||||||| || ||||||||||
Sbjct: 715 ctgtcggagcaacagctcattgactgcgact 745
to top
>gb|L29168.1|LEICYSTPRO Leishmania pifanoi cysteine proteinase gene, complete cds
          Length = 1377

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1115 tggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||||||
Sbjct: 1113 tggatcgtgaagaactcgtgggg 1135
to top
>dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, complete cds
          Length = 1429

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 689 ctggtgtctctgtcggagcaacagctgatagactgcgac 727
           |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 548 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 586
to top
>dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidase, complete cds
          Length = 2544

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 689  ctggtgtctctgtcggagcaacagctgatagactgcgac 727
            |||||||| |||||||||||  ||||||| |||||||||
Sbjct: 1461 ctggtgtcgctgtcggagcaggagctgatcgactgcgac 1499
to top
>gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chromosome unknown, complete
              sequence
          Length = 199482

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 1279   tctagaattccagatccatccatttt 1304
              ||||||||||||| ||||||||||||
Sbjct: 179547 tctagaattccaggtccatccatttt 179522
to top
>ref|XM_627409.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd8_5310),
            partial mRNA
          Length = 3126

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1310 gtcaaagtttgtaatattggcc 1331
            ||||||||||||||||||||||
Sbjct: 1064 gtcaaagtttgtaatattggcc 1043
to top
>emb|CR725700.2|CNS0GMWA Tetraodon nigroviridis full-length cDNA
          Length = 1282

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1112 tattggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||| |||||
Sbjct: 896  tattggatcgtgaagaactcctgggg 921
to top
>emb|CR723850.2|CNS0GLGW Tetraodon nigroviridis full-length cDNA
          Length = 1275

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1112 tattggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||| |||||
Sbjct: 891  tattggatcgtgaagaactcctgggg 916
to top
>emb|CR710967.2|CNS0GBJ7 Tetraodon nigroviridis full-length cDNA
          Length = 604

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1112 tattggatcgtgaagaactcgtgggg 1137
            |||||||||||||||||||| |||||
Sbjct: 219  tattggatcgtgaagaactcctgggg 244
to top
>emb|AL513304.27| Human DNA sequence from clone RP11-398B16 on chromosome 10 Contains
            part of the gene for double-stranded RNA specific
            adenosine deaminase (ADAR3), a novel gene and two CpG
            islands, complete sequence
          Length = 163243

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1391 catcttgaaaataaggatctgt 1412
            ||||||||||||||||||||||
Sbjct: 8520 catcttgaaaataaggatctgt 8499
to top
>emb|BX067361.1|CNS09O51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 487 tgtggatgacggtgcacaacag 508
to top
>emb|BX065039.1|CNS09MCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX056897.1|CNS09G2D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 491 tgtggatgacggtgcacaacag 512
to top
>emb|BX056667.1|CNS09FVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX056666.1|CNS09FVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 690 tgtggatgacggtgcacaacag 669
to top
>emb|BX053071.1|CNS09D43 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 406

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 228 tgtggatgacggtgcacaacag 249
to top
>emb|BX042815.1|CNS09577 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 519 tgtggatgacggtgcacaacag 540
to top
>emb|BX039805.1|CNS092VL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaacag 521
to top
>emb|BX034094.1|CNS08YGY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX020010.1|CNS08NLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 345 tgtggatgacggtgcacaacag 366
to top
>emb|BX011839.1|CNS08HAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX011624.1|CNS08H4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 479 tgtggatgacggtgcacaacag 500
to top
>emb|BX009000.1|CNS08F3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX006361.1|CNS08D2L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 438 tgtggatgacggtgcacaacag 459
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 629     tgctgggcattccccaccgtcgctac 654
               ||||||||||||||||||||| ||||
Sbjct: 7244970 tgctgggcattccccaccgtcactac 7244945
to top
>ref|XM_316470.2| Anopheles gambiae str. PEST ENSANGP00000021035
           (ENSANGG00000018546), partial mRNA
          Length = 1077

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 234 tgtggatgacggtgcacaacag 255
           ||||||||||||||||||||||
Sbjct: 902 tgtggatgacggtgcacaacag 881
to top
>dbj|AB109188.1| Helianthus annuus scp3 mRNA for cysteine protease-3, complete cds
          Length = 1286

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1112 tattggatcgtgaagaactcgtgggg 1137
            ||||||||||||| ||||||||||||
Sbjct: 925  tattggatcgtgaggaactcgtgggg 950
to top
>emb|AM050334.1| Unidentified microorganism phagemid clone pBKR.44
          Length = 5776

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1060 acaacaacaaaatggggctgac 1081
            ||||||||||||||||||||||
Sbjct: 3444 acaacaacaaaatggggctgac 3423
to top
>gb|U34747.1|PSU34747 Phalaenopsis sp. 'hybrid SM9108' cysteine proteinase mRNA, complete
            cds
          Length = 1334

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1109 aagtattggatcgtgaagaactcgtggggg 1138
            |||||||||||||||| |||||| ||||||
Sbjct: 924  aagtattggatcgtgaggaactcatggggg 953
to top
>emb|AM263198.1| Listeria welshimeri serovar 6b str. SLCC5334 complete genome
          Length = 2814130

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1289   cagatccatccattttaattt 1309
              |||||||||||||||||||||
Sbjct: 617838 cagatccatccattttaattt 617858
to top
>gb|AE014298.4| Drosophila melanogaster chromosome X, complete sequence
          Length = 22422827

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 1148    ggcgacaaaggctacatactaatga 1172
               |||||||||||||||||| ||||||
Sbjct: 4444461 ggcgacaaaggctacatagtaatga 4444437
to top
>ref|NM_027149.2| Mus musculus WD repeat domain 20a (Wdr20a), mRNA
          Length = 2427

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1178 ggaacaaagcattcatcaggg 1198
            |||||||||||||||||||||
Sbjct: 2283 ggaacaaagcattcatcaggg 2303
to top
>ref|XM_968514.1| PREDICTED: Tribolium castaneum similar to CG12163-PB, isoform B
            (LOC662417), mRNA
          Length = 5381

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1111 gtattggatcgtgaagaactcgtggggga 1139
            |||||||||||| || |||||||||||||
Sbjct: 5166 gtattggatcgtcaaaaactcgtggggga 5194
to top
>gb|BT014316.1| Lycopersicon esculentum clone 133569F, mRNA sequence
          Length = 1354

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 1112 tattggatcgtgaagaactcgtgggggatgacatggggcga 1152
            ||||||||| | |||||||||||||||| |  |||||||||
Sbjct: 1046 tattggatcataaagaactcgtgggggaagcgatggggcga 1086
to top
>gb|BC064773.1| Mus musculus RIKEN cDNA 2310040A13 gene, mRNA (cDNA clone
            IMAGE:30051454), partial cds
          Length = 2413

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1178 ggaacaaagcattcatcaggg 1198
            |||||||||||||||||||||
Sbjct: 2240 ggaacaaagcattcatcaggg 2260
to top
>gb|BC026761.1| Mus musculus WD repeat domain 20a, mRNA (cDNA clone MGC:30262
            IMAGE:4221717), complete cds
          Length = 2290

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1178 ggaacaaagcattcatcaggg 1198
            |||||||||||||||||||||
Sbjct: 2133 ggaacaaagcattcatcaggg 2153
to top
>gb|AY504966.1| Iris hollandica putative cysteine protease 1 (CYS1) mRNA, complete
           cds
          Length = 1171

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 620 tgtggatcttgctgggcattc 640
           |||||||||||||||||||||
Sbjct: 427 tgtggatcttgctgggcattc 447
to top
>gb|L77746.1|BACAPRA Bacillus thuringiensis alkaline protease A (aprA[Bt]) gene, complete
            cds
          Length = 1750

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1243 tggtagatcgactgattaaag 1263
            |||||||||||||||||||||
Sbjct: 1444 tggtagatcgactgattaaag 1424
to top
>gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-249B10, complete
             sequence
          Length = 213633

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 24    attagcactaccatcaaatga 44
             |||||||||||||||||||||
Sbjct: 87482 attagcactaccatcaaatga 87502
to top
>gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, complete sequence
          Length = 215866

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 24     attagcactaccatcaaatga 44
              |||||||||||||||||||||
Sbjct: 128379 attagcactaccatcaaatga 128359
to top
>gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, complete sequence
          Length = 184813

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1178  ggaacaaagcattcatcaggg 1198
             |||||||||||||||||||||
Sbjct: 14192 ggaacaaagcattcatcaggg 14212
to top
>ref|NM_131941.2| Drosophila melanogaster CG11436-RA (CG11436), mRNA
          Length = 1996

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1148 ggcgacaaaggctacatactaatga 1172
            |||||||||||||||||| ||||||
Sbjct: 1453 ggcgacaaaggctacatagtaatga 1477
to top
>dbj|AK145389.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN full-length enriched
            library, clone:I0C0032E22 product:WD-repeat protein 20
            (DMR protein) homolog [Homo sapiens], full insert
            sequence
          Length = 2344

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1178 ggaacaaagcattcatcaggg 1198
            |||||||||||||||||||||
Sbjct: 2206 ggaacaaagcattcatcaggg 2226
to top
>dbj|AK136417.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
            library, clone:9030014L17 product:WD-repeat protein 20
            (DMR protein) homolog [Homo sapiens], full insert
            sequence
          Length = 2381

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1178 ggaacaaagcattcatcaggg 1198
            |||||||||||||||||||||
Sbjct: 2243 ggaacaaagcattcatcaggg 2263
to top
>gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167097

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1148   ggcgacaaaggctacatactaatga 1172
              |||||||||||||||||| ||||||
Sbjct: 112744 ggcgacaaaggctacatagtaatga 112768
to top
>dbj|AK052481.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched
            library, clone:D430033K12 product:DMR PROTEIN homolog
            [Homo sapiens], full insert sequence
          Length = 2285

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1178 ggaacaaagcattcatcaggg 1198
            |||||||||||||||||||||
Sbjct: 2230 ggaacaaagcattcatcaggg 2250
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 689    ctggtgtctctgtcggagcaacagctgatagactgcg 725
              |||||||| ||||||||||| |||||| | |||||||
Sbjct: 463799 ctggtgtccctgtcggagcagcagctgctcgactgcg 463835
to top
>gb|AY061262.1| Drosophila melanogaster LD19190 full length cDNA
          Length = 1987

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1148 ggcgacaaaggctacatactaatga 1172
            |||||||||||||||||| ||||||
Sbjct: 1424 ggcgacaaaggctacatagtaatga 1448
to top
>emb|BX071926.1|CNS09RNU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 486 tgtggatgacggtgcacaaca 506
to top
>emb|BX071892.1|CNS09RMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1058

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 494 tgtggatgacggtgcacaaca 514
to top
>emb|BX068916.1|CNS09PC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 496 tgtggatgacggtgcacaaca 516
to top
>emb|BX067978.1|CNS09OM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 506 tgtggatgacggtgcacaaca 526
to top
>emb|BX067274.1|CNS09O2M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 477 tgtggatgacggtgcacaaca 497
to top
>emb|BX067273.1|CNS09O2L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 753 tgtggatgacggtgcacaaca 733
to top
>emb|BX065623.1|CNS09MSR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 696

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 482 tgtggatgacggtgcacaaca 502
to top
>emb|BX065469.1|CNS09MOH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 479 tgtggatgacggtgcacaaca 499
to top
>emb|BX065401.1|CNS09MML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 478 tgtggatgacggtgcacaaca 498
to top
>emb|BX058037.1|CNS09GY1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 549

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 463 tgtggatgacggtgcacaaca 483
to top
>emb|BX054975.1|CNS09EKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 466 tgtggatgacggtgcacaaca 486
to top
>emb|BX054726.1|CNS09EE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 486 tgtggatgacggtgcacaaca 506
to top
>emb|BX054725.1|CNS09EE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 363 tgtggatgacggtgcacaaca 343
to top
>emb|BX053305.1|CNS09DAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 487 tgtggatgacggtgcacaaca 507
to top
>emb|BX053304.1|CNS09DAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 712 tgtggatgacggtgcacaaca 692
to top
>emb|BX046548.1|CNS0982W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 454 tgtggatgacggtgcacaaca 474
to top
>emb|BX045680.1|CNS097ES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 489 tgtggatgacggtgcacaaca 509
to top
>emb|BX042580.1|CNS0950O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 561

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 504 tgtggatgacggtgcacaaca 524
to top
>emb|BX042579.1|CNS0950N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 743 tgtggatgacggtgcacaaca 723
to top
>emb|BX041880.1|CNS094H8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 361 tgtggatgacggtgcacaaca 341
to top
>emb|BX041463.1|CNS0945N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 503 tgtggatgacggtgcacaaca 523
to top
>emb|BX041349.1|CNS0942H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 397 tgtggatgacggtgcacaaca 417
to top
>emb|BX040977.1|CNS093S5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 511 tgtggatgacggtgcacaaca 531
to top
>emb|BX033733.1|CNS08Y6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 481 tgtggatgacggtgcacaaca 501
to top
>emb|BX031543.1|CNS08WI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 480 tgtggatgacggtgcacaaca 500
to top
>emb|BX027561.1|CNS08TFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaaca 520
to top
>emb|BX025600.1|CNS08RX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 490 tgtggatgacggtgcacaaca 510
to top
>emb|BX021322.1|CNS08OM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 512 tgtggatgacggtgcacaaca 532
to top
>emb|BX020409.1|CNS08NWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 490 tgtggatgacggtgcacaaca 510
to top
>emb|BX017672.1|CNS08LSS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaaca 520
to top
>emb|BX015014.1|CNS08JQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 493 tgtggatgacggtgcacaaca 513
to top
>emb|BX010581.1|CNS08GBT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 799

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 492 tgtggatgacggtgcacaaca 512
to top
>emb|BX011957.1|CNS08HE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 541 tgtggatgacggtgcacaaca 521
to top
>emb|BX012160.1|CNS08HJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 484 tgtggatgacggtgcacaaca 504
to top
>emb|BX012159.1|CNS08HJN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 654 tgtggatgacggtgcacaaca 634
to top
>emb|BX011093.1|CNS08GQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 482 tgtggatgacggtgcacaaca 502
to top
>emb|BX010949.1|CNS08GM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 497 tgtggatgacggtgcacaaca 517
to top
>emb|BX010605.1|CNS08GCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 485 tgtggatgacggtgcacaaca 505
to top
>emb|BX010604.1|CNS08GCG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 656 tgtggatgacggtgcacaaca 636
to top
>emb|BX010191.1|CNS08G0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 484 tgtggatgacggtgcacaaca 504
to top
>emb|BX008394.1|CNS08EN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 435 tgtggatgacggtgcacaaca 455
to top
>emb|BX005487.1|CNS08CEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 234 tgtggatgacggtgcacaaca 254
           |||||||||||||||||||||
Sbjct: 483 tgtggatgacggtgcacaaca 503
to top
>gb|AF170567.1|AF170567 Bacillus thuringiensis alkaline protease A (aprA) gene, complete cds
          Length = 1500

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1243 tggtagatcgactgattaaag 1263
            |||||||||||||||||||||
Sbjct: 1444 tggtagatcgactgattaaag 1424
to top
>gb|AF454956.1| Brassica oleracea senescence-associated cysteine protease (CP1)
           mRNA, partial cds
          Length = 1582

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 657 ttgaaggaatacacaagatcaagagagggactctggtgtctctgtcggagcaa 709
           ||||||| ||| || ||||||||| ||||   || ||||||||||||||||||
Sbjct: 468 ttgaagggataaaccagatcaagacaggggagcttgtgtctctgtcggagcaa 520
to top
>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0585H11
          Length = 149371

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 689   ctggtgtctctgtcggagcaacagctgatagactgcg 725
             |||||||| ||||||||||| |||||| | |||||||
Sbjct: 65963 ctggtgtccctgtcggagcagcagctgctcgactgcg 65999
to top
>dbj|AP006697.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT41M05, TM0404,
             complete sequence
          Length = 103744

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 390   accttacaaatgaagagttca 410
             |||||||||||||||||||||
Sbjct: 27543 accttacaaatgaagagttca 27563
to top
>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative
             Cf-2, fertilization-independent endosperm proteins,
             hypothetical protein, putative non-LTR retroelement
             reverse transcriptase, OCL5 protein, tryptophan synthase
             beta-subunit, hypothetical proteins, putative AP
             endonuclease, putative RNA polymerase II complex component
             SRB7, putative beta-1,3-glucanase, hypothetical protein,
             TNP2-like protein, hypothetical protein, putative
             phosphate/phosphoenolpyruvate translocator, putative
             protein, hypothetical proteins, putative
             galactosyltransferase family, hypothetical protein,
             putative cytochrome P450 family, putative lipid transfer
             protein, putative photoreceptor-interacting protein, and
             hypothetical protein genes, complete cds; and hypothetical
             protein gene, partial cds
          Length = 202197

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1267  acttgctttaaatctagaatt 1287
             |||||||||||||||||||||
Sbjct: 64759 acttgctttaaatctagaatt 64779
to top
>dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1567_G09
          Length = 121388

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 689   ctggtgtctctgtcggagcaacagctgatagactgcg 725
             |||||||| ||||||||||| |||||| | |||||||
Sbjct: 17711 ctggtgtccctgtcggagcagcagctgctcgactgcg 17747
to top
>dbj|AP004519.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT07K08, TM0046b,
            complete sequence
          Length = 71321

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 390  accttacaaatgaagagttca 410
            |||||||||||||||||||||
Sbjct: 4738 accttacaaatgaagagttca 4758
to top
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 1243    tggtagatcgactgattaaag 1263
               |||||||||||||||||||||
Sbjct: 2263405 tggtagatcgactgattaaag 2263425
to top
>gb|AF019145.2|AF019145 Zea mays cysteine protease Mir1 (mir1) mRNA, complete cds
          Length = 1463

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1115 tggatcgtgaagaactcgtgg 1135
            |||||||||||||||||||||
Sbjct: 1040 tggatcgtgaagaactcgtgg 1060
to top
>emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on chromosome 12, complete
            sequence
          Length = 205332

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1178 ggaacaaagcattcatcaggg 1198
            |||||||||||||||||||||
Sbjct: 9748 ggaacaaagcattcatcaggg 9728


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 240,755,208
Number of extensions: 13508197
Number of successful extensions: 380616
Number of sequences better than 10.0: 157
Number of HSP's gapped: 380616
Number of HSP's successfully gapped: 167
Length of query: 1450
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1427
Effective length of database: 18,503,978,556
Effective search space: 26405177399412
Effective search space used: 26405177399412
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top