ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf108a12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_001066588.1| Oryza sativa (japonica cultivar-group) Os07g... 280 2e-71
2dbj|AK067178.1| Oryza sativa (japonica cultivar-group) cDNA clon... 280 2e-71
3dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 170 1e-38
4dbj|AP005908.3| Oryza sativa (japonica cultivar-group) genomic D... 170 1e-38
5gb|AY022935.1| Oryza sativa microsatellite MRG5260 containing (C... 82 8e-12
6dbj|AP006336.1| Lotus japonicus genomic DNA, chromosome 3, clone... 46 0.42
7dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 46 0.42
8gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 46 0.42
9gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 46 0.42
10gb|AC022613.13| Homo sapiens chromosome 15, clone RP11-680F8, co... 44 1.7
11gb|AC102941.9| Homo sapiens chromosome 15, clone RP11-300A12, co... 44 1.7
12gb|AC138036.2| Homo sapiens chromosome 5 clone XXcos-B22C99, com... 44 1.7
13gb|AC021360.15| Homo sapiens chromosome 15, clone RP11-25D17, co... 44 1.7
14gb|AC161468.2| Gallus gallus BAC clone CH261-94J19 from chromoso... 44 1.7
15gb|AC185983.3| Pan troglodytes BAC clone CH251-483E15 from chrom... 42 6.6
16gb|AC188668.3| Pan troglodytes BAC clone CH251-162B7 from chromo... 42 6.6
17gb|AC186035.3| Pan troglodytes BAC clone CH251-638I11 from chrom... 42 6.6
18gb|AC185976.2| Pan troglodytes BAC clone CH251-558J11 from chrom... 42 6.6
19gb|AC186042.3| Pan troglodytes BAC clone CH251-493O10 from chrom... 42 6.6
20gb|BT027030.1| Gasterosteus aculeatus clone CFW154-H06 mRNA sequ... 42 6.6
21gb|AC183760.2| Pan troglodytes BAC clone CH251-730F16 from chrom... 42 6.6
22gb|AC185984.2| Pan troglodytes BAC clone CH251-446C10 from chrom... 42 6.6
23gb|AC159094.5| Mus musculus chromosome 3, clone RP23-277N17, com... 42 6.6
24gb|AC148939.8| Pan troglodytes BAC clone CH251-51M11 from chromo... 42 6.6
25gb|AC182391.3| Pan troglodytes BAC clone CH251-510H16 from chrom... 42 6.6
26gb|AC148834.3| Pan troglodytes BAC clone CH251-4D23 from chromos... 42 6.6
27gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 6.6
28gb|AC102259.7| Mus musculus chromosome 3, clone RP24-199C12, com... 42 6.6
29gb|BC079734.1| Xenopus laevis cDNA clone MGC:83983 IMAGE:6945638... 42 6.6
30gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 42 6.6
31gb|AC146018.3| Pan troglodytes BAC clone RP43-135A21 from 7, com... 42 6.6
32gb|AC148157.1| Homo sapiens chromosome 21 clone XX-181G02-M map ... 42 6.6
33gb|AC146118.3| Pan troglodytes BAC clone RP43-23A6 from 7, compl... 42 6.6
34gb|AC027644.9| Homo sapiens BAC clone RP11-792A8 from 7, complet... 42 6.6
35gb|AC096582.1| Homo sapiens BAC clone RP11-638I8 from 7, complet... 42 6.6
36gb|AC093392.4| Homo sapiens BAC clone RP11-814E24 from 7, comple... 42 6.6
37gb|AC004987.2| Homo sapiens PAC clone RP5-1173I20 from 7, comple... 42 6.6
38ref|XM_541170.2| PREDICTED: Canis familiaris similar to tubby li... 42 6.6
39gb|AC097646.2| Homo sapiens cosmid clone XXcos-2185C14 from 7, c... 42 6.6
40gb|AC097645.2| Homo sapiens cosmid clone XXcos-2185C4 from 7, co... 42 6.6
41gb|AC102114.9| Mus musculus chromosome 10, clone RP23-139F20, co... 42 6.6
42gb|AC131288.3| Homo sapiens chromosome 11, clone RP11-957I23, co... 42 6.6
43gb|AC110079.3| Homo sapiens BAC clone RP11-384K6 from 4, complet... 42 6.6
44gb|AC120440.5| Homo sapiens chromosome 11, clone CTD-2013B7, com... 42 6.6
45gb|AE011789.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 6.6
46gb|AC073556.11| Oryza sativa chromosome 3 BAC OSJNBa0091P11 geno... 42 6.6
47dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 6.6
48gb|AC025787.9| Homo sapiens chromosome 11, clone RP11-227P3, com... 42 6.6
49emb|AL954642.9| Human DNA sequence from clone RP11-885N19 on chr... 42 6.6
50emb|AL627309.15| Human DNA sequence from clone RP11-34P13 on chr... 42 6.6
51emb|AL606534.15| Human DNA sequence from clone RP11-261C10 on ch... 42 6.6
52emb|AL669831.13| Human DNA sequence from clone RP11-206L10 on ch... 42 6.6
53emb|AL592148.7| Human DNA sequence from clone RP11-378J18 on chr... 42 6.6
54emb|AL137020.13| Human DNA sequence from clone RP11-146B14 on ch... 42 6.6
55emb|AL133216.10| Human DNA sequence from clone RP11-291L22 on ch... 42 6.6
56gb|AC073135.3| Homo sapiens BAC clone RP11-694O4 from 7, complet... 42 6.6
57emb|AL022097.1|HS256G22 Human DNA sequence from clone RP1-256G22... 42 6.6
58gb|AC145858.5| Pan troglodytes BAC clone RP43-6D19 from chromoso... 42 6.6
59gb|AC144491.1| Oryza sativa (japonica cultivar-group) chromosome... 42 6.6
60gb|AC115287.5| Homo sapiens chromosome 1 clone RP5-870L9, comple... 42 6.6
61gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 6.6
62emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 6.6
63gb|AC069287.7| Homo sapiens BAC clone RP11-304M2 from 11, comple... 42 6.6
64gb|AC133919.3| Homo sapiens chromosome 16 clone RP11-356C4, comp... 42 6.6
65gb|AC093752.2| Homo sapiens BAC clone RP11-33B1 from 4, complete... 42 6.6
66gb|AC090118.2|AC090118 Homo sapiens chromosome 19 clone unknown,... 42 6.6
67gb|AC150749.3| Pan troglodytes BAC clone CH251-553P23 from chrom... 42 6.6
68gb|AC146179.2| Pan troglodytes BAC clone RP43-36B22 from chromos... 42 6.6
69gb|AF329207.1|AF329207 Homo sapiens clone 19ptel_2030Br sequence 42 6.6
70gb|AY214122.1| Rattus norvegicus calcium sensing receptor mRNA, ... 42 6.6
71gb|AC138393.2| Homo sapiens chromosome 1 clone RP11-504P24, comp... 42 6.6
72gb|AC136309.9| Homo sapiens chromosome 11, clone RP11-242C5, com... 42 6.6
73gb|AC005627.2|AC005627 Homo sapiens PAC clone RP4-577P23 from 1,... 42 6.6
74gb|AC137818.1| Homo sapiens chromosome 16 clone XXcos-y2118c8, c... 42 6.6
75dbj|AP006622.1| Homo sapiens genomic DNA, chromosome 11, clone:R... 42 6.6
76ref|XM_568387.1| Cryptococcus neoformans var. neoformans JEC21 g... 42 6.6
77gb|AC064814.10| Homo sapiens BAC clone CTD-2100B3 from 2, comple... 42 6.6
78dbj|AP001705.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 6.6
79gb|AF109718.1|HSCOS10 Homo sapiens chromosome 3 subtelomeric region 42 6.6
80gb|AC004812.1|AC004812 Homo sapiens PAC clone 267D11 from 12, co... 42 6.6
81gb|U20289.1|RNU20289 Rattus norvegicus calcium sensing receptor ... 42 6.6
82ref|NM_016996.1| Rattus norvegicus calcium-sensing receptor (Cas... 42 6.6
83gb|AC156458.1| Loxodonta africana, clone Loxodonta africana-6767... 42 6.6
84gb|AC153695.2| Mus musculus 10 BAC RP23-184L5 (Roswell Park Can... 42 6.6
85dbj|AP000240.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 42 6.6
86dbj|AP000200.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 42 6.6
87gb|AC010507.6| Homo sapiens chromosome 19 clone LLNLF-176F2, com... 42 6.6
88gb|AC129484.8| Homo sapiens chromosome 11, clone RP13-337F11, co... 42 6.6
89dbj|AP000096.1| Homo sapiens genomic DNA of 21q22.1, GART and AM... 42 6.6 
>ref|NM_001066588.1| Oryza sativa (japonica cultivar-group) Os07g0571700 (Os07g0571700)
           mRNA, complete cds
          Length = 1836
 Score =  280 bits (141), Expect = 2e-71
 Identities = 423/517 (81%)
 Strand = Plus / Plus

                                                                       
Query: 196 ctacacgacggacgacgcgctgtcccaggtgggcttcgggaggttccaggcgctggtgct 255
           |||||||||||||||||||||  | |  |  |||||||| ||||||||||| ||||||||
Sbjct: 103 ctacacgacggacgacgcgctcacgcgcgccggcttcggcaggttccaggccctggtgct 162

                                                                       
Query: 256 ggcctacgccggcgtgggctggaccgcggaggccatggagatcatgatgctgtccttcgt 315
            ||||||||| ||||||| |||  |||||||||||||||| | ||| ||||||| |||||
Sbjct: 163 cgcctacgcctgcgtggggtgggtcgcggaggccatggaggtgatgctgctgtcgttcgt 222

                                                                       
Query: 316 cggcccgtccgtgaaggacgagtggggaatctcgggccagcaggaagggctcatcaccag 375
            ||||||||||||||||  || |||||  | || |||  |  ||| |||||| ||| |||
Sbjct: 223 gggcccgtccgtgaaggctgaatggggggtgtccggcgcggcggaggggctcgtcagcag 282

                                                                       
Query: 376 cgtcgtcttcgccgggatgatcatcgggggctgcctcgggggcgtcatctcggactcata 435
           ||||||||||||||||||| ||||||| | ||||||||| ||| |||||||||||  |||
Sbjct: 283 cgtcgtcttcgccgggatgctcatcggcgcctgcctcggaggcctcatctcggacagata 342

                                                                       
Query: 436 tggcagaagggctggttttctattcactgctgttgtcactggcatatttggttttcttag 495
            |||||||||   |||||||| | ||| || ||||||||||| ||||||||||| || ||
Sbjct: 343 cggcagaaggatcggttttctttccacggcagttgtcactggtatatttggtttgctcag 402

                                                                       
Query: 496 tgctttatcacctaactacatatgcctattatccctccgctttattgtcggtatgggatt 555
           ||| || || || ||||||  || | |  |   |||||||||| |||| ||| |||||||
Sbjct: 403 tgccttctcccccaactacgcatccttgctcgtcctccgctttgttgttggtttgggatt 462

                                                                       
Query: 556 gggttctggtcatgttcttggtacttggttcctagagtttgttcctgctgcaaatagggg 615
           |||| |||| ||||| ||    ||||||||| |||||||||||||||||||||| || ||
Sbjct: 463 gggtgctggccatgtgctgtccacttggttcatagagtttgttcctgctgcaaagagagg 522

                                                                       
Query: 616 tacttgggtggttgtcttccattgtacttggactttcggaacaatccttcaggctcttat 675
           ||| ||| |||| || ||||||||  |||||||| | ||||||||| |  | |||||  |
Sbjct: 523 tacctggatggtcgttttccattgctcttggactgtgggaacaatcttggaagctctgct 582

                                                
Query: 676 tgcatgggctatcatgccagtacttggatggaggtgg 712
           ||| |||||| |||||||||||||||| |||||||||
Sbjct: 583 tgcctgggctgtcatgccagtacttgggtggaggtgg 619



 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 185/232 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1047 ttcttctttggtttgtctactttgcattttgttttgcttactatggcatagtattgctaa 1106
            |||||||||||||||||||  |||||  || |||||||||||||||  || ||||| | |
Sbjct: 951  ttcttctttggtttgtctatcttgcaaattattttgcttactatggggtaatattgttga 1010

                                                                        
Query: 1107 catcggaactaagcaatggtgcaaggagatgtggacctgttggtatgcatttctggcagc 1166
            | || ||||| |||||||||   || || |||| | | ||||| ||  ||||   ||| |
Sbjct: 1011 cctctgaactgagcaatggtcagagaaggtgtgcatcagttgggataaattttatgcaac 1070

                                                                        
Query: 1167 aaaatgatgccagactctacagagatgtcctggtgacaagtattgcggaatttcctggtc 1226
             ||| |||||||  || ||||||||||| || ||||| ||| | || |||||||| ||||
Sbjct: 1071 caaaggatgccaacctttacagagatgtgctagtgaccagtttggcagaatttccaggtc 1130

                                                                
Query: 1227 tgattttggcggctctattggttgacaaggttggtcgcaaactgtcaatggg 1278
            || ||||||||||||||||||||||||   ||||||| ||| ||||| ||||
Sbjct: 1131 tggttttggcggctctattggttgacagaattggtcggaaagtgtcactggg 1182



 Score = 56.0 bits (28), Expect = 4e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1529 cagaaagaagctgtgtttgtcttcgatcttgtactctttcttgcagcaattgcctgtgcc 1588
            ||||||||||| |||||| || | || ||  | |||||||| |||||| | || || |||
Sbjct: 1433 cagaaagaagcagtgtttttcatggacctgatgctctttctagcagcagtggcatgcgcc 1492

                                    
Query: 1589 ctcttccctctagagaccaagggc 1612
            ||| ||||||||||||||||||||
Sbjct: 1493 ctcatccctctagagaccaagggc 1516
to top
>dbj|AK067178.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098E20, full
           insert sequence
          Length = 1842

 Score =  280 bits (141), Expect = 2e-71
 Identities = 423/517 (81%)
 Strand = Plus / Plus

                                                                       
Query: 196 ctacacgacggacgacgcgctgtcccaggtgggcttcgggaggttccaggcgctggtgct 255
           |||||||||||||||||||||  | |  |  |||||||| ||||||||||| ||||||||
Sbjct: 109 ctacacgacggacgacgcgctcacgcgcgccggcttcggcaggttccaggccctggtgct 168

                                                                       
Query: 256 ggcctacgccggcgtgggctggaccgcggaggccatggagatcatgatgctgtccttcgt 315
            ||||||||| ||||||| |||  |||||||||||||||| | ||| ||||||| |||||
Sbjct: 169 cgcctacgcctgcgtggggtgggtcgcggaggccatggaggtgatgctgctgtcgttcgt 228

                                                                       
Query: 316 cggcccgtccgtgaaggacgagtggggaatctcgggccagcaggaagggctcatcaccag 375
            ||||||||||||||||  || |||||  | || |||  |  ||| |||||| ||| |||
Sbjct: 229 gggcccgtccgtgaaggctgaatggggggtgtccggcgcggcggaggggctcgtcagcag 288

                                                                       
Query: 376 cgtcgtcttcgccgggatgatcatcgggggctgcctcgggggcgtcatctcggactcata 435
           ||||||||||||||||||| ||||||| | ||||||||| ||| |||||||||||  |||
Sbjct: 289 cgtcgtcttcgccgggatgctcatcggcgcctgcctcggaggcctcatctcggacagata 348

                                                                       
Query: 436 tggcagaagggctggttttctattcactgctgttgtcactggcatatttggttttcttag 495
            |||||||||   |||||||| | ||| || ||||||||||| ||||||||||| || ||
Sbjct: 349 cggcagaaggatcggttttctttccacggcagttgtcactggtatatttggtttgctcag 408

                                                                       
Query: 496 tgctttatcacctaactacatatgcctattatccctccgctttattgtcggtatgggatt 555
           ||| || || || ||||||  || | |  |   |||||||||| |||| ||| |||||||
Sbjct: 409 tgccttctcccccaactacgcatccttgctcgtcctccgctttgttgttggtttgggatt 468

                                                                       
Query: 556 gggttctggtcatgttcttggtacttggttcctagagtttgttcctgctgcaaatagggg 615
           |||| |||| ||||| ||    ||||||||| |||||||||||||||||||||| || ||
Sbjct: 469 gggtgctggccatgtgctgtccacttggttcatagagtttgttcctgctgcaaagagagg 528

                                                                       
Query: 616 tacttgggtggttgtcttccattgtacttggactttcggaacaatccttcaggctcttat 675
           ||| ||| |||| || ||||||||  |||||||| | ||||||||| |  | |||||  |
Sbjct: 529 tacctggatggtcgttttccattgctcttggactgtgggaacaatcttggaagctctgct 588

                                                
Query: 676 tgcatgggctatcatgccagtacttggatggaggtgg 712
           ||| |||||| |||||||||||||||| |||||||||
Sbjct: 589 tgcctgggctgtcatgccagtacttgggtggaggtgg 625



 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 185/232 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1047 ttcttctttggtttgtctactttgcattttgttttgcttactatggcatagtattgctaa 1106
            |||||||||||||||||||  |||||  || |||||||||||||||  || ||||| | |
Sbjct: 957  ttcttctttggtttgtctatcttgcaaattattttgcttactatggggtaatattgttga 1016

                                                                        
Query: 1107 catcggaactaagcaatggtgcaaggagatgtggacctgttggtatgcatttctggcagc 1166
            | || ||||| |||||||||   || || |||| | | ||||| ||  ||||   ||| |
Sbjct: 1017 cctctgaactgagcaatggtcagagaaggtgtgcatcagttgggataaattttatgcaac 1076

                                                                        
Query: 1167 aaaatgatgccagactctacagagatgtcctggtgacaagtattgcggaatttcctggtc 1226
             ||| |||||||  || ||||||||||| || ||||| ||| | || |||||||| ||||
Sbjct: 1077 caaaggatgccaacctttacagagatgtgctagtgaccagtttggcagaatttccaggtc 1136

                                                                
Query: 1227 tgattttggcggctctattggttgacaaggttggtcgcaaactgtcaatggg 1278
            || ||||||||||||||||||||||||   ||||||| ||| ||||| ||||
Sbjct: 1137 tggttttggcggctctattggttgacagaattggtcggaaagtgtcactggg 1188



 Score = 56.0 bits (28), Expect = 4e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1529 cagaaagaagctgtgtttgtcttcgatcttgtactctttcttgcagcaattgcctgtgcc 1588
            ||||||||||| |||||| || | || ||  | |||||||| |||||| | || || |||
Sbjct: 1439 cagaaagaagcagtgtttttcatggacctgatgctctttctagcagcagtggcatgcgcc 1498

                                    
Query: 1589 ctcttccctctagagaccaagggc 1612
            ||| ||||||||||||||||||||
Sbjct: 1499 ctcatccctctagagaccaagggc 1522
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score =  170 bits (86), Expect = 1e-38
 Identities = 209/250 (83%)
 Strand = Plus / Minus

                                                                            
Query: 196      ctacacgacggacgacgcgctgtcccaggtgggcttcgggaggttccaggcgctggtgct 255
                |||||||||||||||||||||  | |  |  |||||||| ||||||||||| ||||||||
Sbjct: 23031447 ctacacgacggacgacgcgctcacgcgcgccggcttcggcaggttccaggccctggtgct 23031388

                                                                            
Query: 256      ggcctacgccggcgtgggctggaccgcggaggccatggagatcatgatgctgtccttcgt 315
                 ||||||||| ||||||| |||  |||||||||||||||| | ||| ||||||| |||||
Sbjct: 23031387 cgcctacgcctgcgtggggtgggtcgcggaggccatggaggtgatgctgctgtcgttcgt 23031328

                                                                            
Query: 316      cggcccgtccgtgaaggacgagtggggaatctcgggccagcaggaagggctcatcaccag 375
                 ||||||||||||||||  || |||||  | || |||  |  ||| |||||| ||| |||
Sbjct: 23031327 gggcccgtccgtgaaggctgaatggggggtgtccggcgcggcggaggggctcgtcagcag 23031268

                                                                            
Query: 376      cgtcgtcttcgccgggatgatcatcgggggctgcctcgggggcgtcatctcggactcata 435
                ||||||||||||||||||| ||||||| | ||||||||| ||| |||||||||||  |||
Sbjct: 23031267 cgtcgtcttcgccgggatgctcatcggcgcctgcctcggaggcctcatctcggacagata 23031208

                          
Query: 436      tggcagaagg 445
                 |||||||||
Sbjct: 23031207 cggcagaagg 23031198



 Score = 97.6 bits (49), Expect = 1e-16
 Identities = 112/133 (84%)
 Strand = Plus / Minus

                                                                            
Query: 529      cctccgctttattgtcggtatgggattgggttctggtcatgttcttggtacttggttcct 588
                |||||||||| |||| ||| ||||||||||| |||| ||||| ||    ||||||||| |
Sbjct: 23030495 cctccgctttgttgttggtttgggattgggtgctggccatgtgctgtccacttggttcat 23030436

                                                                            
Query: 589      agagtttgttcctgctgcaaataggggtacttgggtggttgtcttccattgtacttggac 648
                ||||||||||||||||||||| || ||||| ||| |||| || ||||||||  |||||||
Sbjct: 23030435 agagtttgttcctgctgcaaagagaggtacctggatggtcgttttccattgctcttggac 23030376

                             
Query: 649      tttcggaacaatc 661
                | | |||||||||
Sbjct: 23030375 tgtgggaacaatc 23030363



 Score = 65.9 bits (33), Expect = 5e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                            
Query: 1214     gaatttcctggtctgattttggcggctctattggttgacaaggttggtcgcaaactgtca 1273
                |||||||| |||||| ||||||||||||||||||||||||   ||||||| ||| |||||
Sbjct: 23029003 gaatttccaggtctggttttggcggctctattggttgacagaattggtcggaaagtgtca 23028944

                     
Query: 1274     atggg 1278
                 ||||
Sbjct: 23028943 ctggg 23028939



 Score = 56.0 bits (28), Expect = 4e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                            
Query: 1529     cagaaagaagctgtgtttgtcttcgatcttgtactctttcttgcagcaattgcctgtgcc 1588
                ||||||||||| |||||| || | || ||  | |||||||| |||||| | || || |||
Sbjct: 23028038 cagaaagaagcagtgtttttcatggacctgatgctctttctagcagcagtggcatgcgcc 23027979

                                        
Query: 1589     ctcttccctctagagaccaagggc 1612
                ||| ||||||||||||||||||||
Sbjct: 23027978 ctcatccctctagagaccaagggc 23027955



 Score = 56.0 bits (28), Expect = 4e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                            
Query: 1047     ttcttctttggtttgtctactttgcattttgttttgcttactatggcatagtattgctaa 1106
                |||||||||||||||||||  |||||  || |||||||||||||||  || ||||| | |
Sbjct: 23029777 ttcttctttggtttgtctatcttgcaaattattttgcttactatggggtaatattgttga 23029718

                                    
Query: 1107     catcggaactaagcaatggt 1126
                | || ||||| |||||||||
Sbjct: 23029717 cctctgaactgagcaatggt 23029698



 Score = 46.1 bits (23), Expect = 0.42
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 682      ggctatcatgccagtacttggatggaggtgg 712
                |||| |||||||||||||||| |||||||||
Sbjct: 23030139 ggctgtcatgccagtacttgggtggaggtgg 23030109
to top
>dbj|AP005908.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1121_A05
          Length = 172668

 Score =  170 bits (86), Expect = 1e-38
 Identities = 209/250 (83%)
 Strand = Plus / Minus

                                                                          
Query: 196    ctacacgacggacgacgcgctgtcccaggtgggcttcgggaggttccaggcgctggtgct 255
              |||||||||||||||||||||  | |  |  |||||||| ||||||||||| ||||||||
Sbjct: 106661 ctacacgacggacgacgcgctcacgcgcgccggcttcggcaggttccaggccctggtgct 106602

                                                                          
Query: 256    ggcctacgccggcgtgggctggaccgcggaggccatggagatcatgatgctgtccttcgt 315
               ||||||||| ||||||| |||  |||||||||||||||| | ||| ||||||| |||||
Sbjct: 106601 cgcctacgcctgcgtggggtgggtcgcggaggccatggaggtgatgctgctgtcgttcgt 106542

                                                                          
Query: 316    cggcccgtccgtgaaggacgagtggggaatctcgggccagcaggaagggctcatcaccag 375
               ||||||||||||||||  || |||||  | || |||  |  ||| |||||| ||| |||
Sbjct: 106541 gggcccgtccgtgaaggctgaatggggggtgtccggcgcggcggaggggctcgtcagcag 106482

                                                                          
Query: 376    cgtcgtcttcgccgggatgatcatcgggggctgcctcgggggcgtcatctcggactcata 435
              ||||||||||||||||||| ||||||| | ||||||||| ||| |||||||||||  |||
Sbjct: 106481 cgtcgtcttcgccgggatgctcatcggcgcctgcctcggaggcctcatctcggacagata 106422

                        
Query: 436    tggcagaagg 445
               |||||||||
Sbjct: 106421 cggcagaagg 106412



 Score = 97.6 bits (49), Expect = 1e-16
 Identities = 112/133 (84%)
 Strand = Plus / Minus

                                                                          
Query: 529    cctccgctttattgtcggtatgggattgggttctggtcatgttcttggtacttggttcct 588
              |||||||||| |||| ||| ||||||||||| |||| ||||| ||    ||||||||| |
Sbjct: 105709 cctccgctttgttgttggtttgggattgggtgctggccatgtgctgtccacttggttcat 105650

                                                                          
Query: 589    agagtttgttcctgctgcaaataggggtacttgggtggttgtcttccattgtacttggac 648
              ||||||||||||||||||||| || ||||| ||| |||| || ||||||||  |||||||
Sbjct: 105649 agagtttgttcctgctgcaaagagaggtacctggatggtcgttttccattgctcttggac 105590

                           
Query: 649    tttcggaacaatc 661
              | | |||||||||
Sbjct: 105589 tgtgggaacaatc 105577



 Score = 65.9 bits (33), Expect = 5e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                          
Query: 1214   gaatttcctggtctgattttggcggctctattggttgacaaggttggtcgcaaactgtca 1273
              |||||||| |||||| ||||||||||||||||||||||||   ||||||| ||| |||||
Sbjct: 104217 gaatttccaggtctggttttggcggctctattggttgacagaattggtcggaaagtgtca 104158

                   
Query: 1274   atggg 1278
               ||||
Sbjct: 104157 ctggg 104153



 Score = 56.0 bits (28), Expect = 4e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                          
Query: 1529   cagaaagaagctgtgtttgtcttcgatcttgtactctttcttgcagcaattgcctgtgcc 1588
              ||||||||||| |||||| || | || ||  | |||||||| |||||| | || || |||
Sbjct: 103252 cagaaagaagcagtgtttttcatggacctgatgctctttctagcagcagtggcatgcgcc 103193

                                      
Query: 1589   ctcttccctctagagaccaagggc 1612
              ||| ||||||||||||||||||||
Sbjct: 103192 ctcatccctctagagaccaagggc 103169



 Score = 56.0 bits (28), Expect = 4e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                          
Query: 1047   ttcttctttggtttgtctactttgcattttgttttgcttactatggcatagtattgctaa 1106
              |||||||||||||||||||  |||||  || |||||||||||||||  || ||||| | |
Sbjct: 104991 ttcttctttggtttgtctatcttgcaaattattttgcttactatggggtaatattgttga 104932

                                  
Query: 1107   catcggaactaagcaatggt 1126
              | || ||||| |||||||||
Sbjct: 104931 cctctgaactgagcaatggt 104912



 Score = 46.1 bits (23), Expect = 0.42
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 682    ggctatcatgccagtacttggatggaggtgg 712
              |||| |||||||||||||||| |||||||||
Sbjct: 105353 ggctgtcatgccagtacttgggtggaggtgg 105323
to top
>gb|AY022935.1| Oryza sativa microsatellite MRG5260 containing (CTC)X9, closest to
           marker R2561, genomic sequence
          Length = 227

 Score = 81.8 bits (41), Expect = 8e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                       
Query: 196 ctacacgacggacgacgcgctgtcccaggtgggcttcgggaggttccaggcgctggtgct 255
           |||||||||||||||||||||  | |  |  |||||||| ||||||||||| ||||||||
Sbjct: 98  ctacacgacggacgacgcgctcacgcgcgccggcttcggcaggttccaggccctggtgct 39

                                                
Query: 256 ggcctacgccggcgtgggctggaccgcggaggccatg 292
            ||||||||| ||||||| |||  |||||||||||||
Sbjct: 38  cgcctacgcctgcgtggggtgggtcgcggaggccatg 2
to top
>dbj|AP006336.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT07E09, TM0293,
             complete sequence
          Length = 113091

 Score = 46.1 bits (23), Expect = 0.42
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 579   cttggttcctagagtttgttcctgctgcaaataggggtacttgggtggttgtctt 633
             ||||||| || ||||||||||||||  | ||||| ||||| ||| ||||||||||
Sbjct: 39189 cttggtttcttgagtttgttcctgcccccaatagaggtacctggatggttgtctt 39135
to top
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 46.1 bits (23), Expect = 0.42
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 245     gcgctggtgctggcctacgccggcgtg 271
               |||||||||||||||||||| ||||||
Sbjct: 2493297 gcgctggtgctggcctacgctggcgtg 2493323
to top
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 46.1 bits (23), Expect = 0.42
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 77      ccggcgcggcggcgcttgcgccg 99
               |||||||||||||||||||||||
Sbjct: 3302086 ccggcgcggcggcgcttgcgccg 3302064
to top
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 46.1 bits (23), Expect = 0.42
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 245     gcgctggtgctggcctacgccggcgtg 271
               |||||||||||||||||||| ||||||
Sbjct: 1823753 gcgctggtgctggcctacgctggcgtg 1823727
to top
>gb|AC022613.13| Homo sapiens chromosome 15, clone RP11-680F8, complete sequence
          Length = 188117

 Score = 44.1 bits (22), Expect = 1.7
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 452   tttctattcactgctgttgtca 473
             ||||||||||||||||||||||
Sbjct: 10503 tttctattcactgctgttgtca 10524
to top
>gb|AC102941.9| Homo sapiens chromosome 15, clone RP11-300A12, complete sequence
          Length = 174941

 Score = 44.1 bits (22), Expect = 1.7
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 452    tttctattcactgctgttgtca 473
              ||||||||||||||||||||||
Sbjct: 160940 tttctattcactgctgttgtca 160961
to top
>gb|AC138036.2| Homo sapiens chromosome 5 clone XXcos-B22C99, complete sequence
          Length = 42108

 Score = 44.1 bits (22), Expect = 1.7
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1664  gcatacccatcagattaaatta 1685
             ||||||||||||||||||||||
Sbjct: 21802 gcatacccatcagattaaatta 21823
to top
>gb|AC021360.15| Homo sapiens chromosome 15, clone RP11-25D17, complete sequence
          Length = 147133

 Score = 44.1 bits (22), Expect = 1.7
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 452   tttctattcactgctgttgtca 473
             ||||||||||||||||||||||
Sbjct: 50789 tttctattcactgctgttgtca 50768
to top
>gb|AC161468.2| Gallus gallus BAC clone CH261-94J19 from chromosome unknown, complete
              sequence
          Length = 238361

 Score = 44.1 bits (22), Expect = 1.7
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 34     ccctcctcccccagccctccgc 55
              ||||||||||||||||||||||
Sbjct: 117406 ccctcctcccccagccctccgc 117385
to top
>gb|AC185983.3| Pan troglodytes BAC clone CH251-483E15 from chromosome 1, complete
              sequence
          Length = 177643

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 118389 catacccatcagattaaatta 118369
to top
>gb|AC188668.3| Pan troglodytes BAC clone CH251-162B7 from chromosome 7, complete
             sequence
          Length = 146420

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 56062 catacccatcagattaaatta 56082
to top
>gb|AC186035.3| Pan troglodytes BAC clone CH251-638I11 from chromosome 4, complete
             sequence
          Length = 202186

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 51329 catacccatcagattaaatta 51349
to top
>gb|AC185976.2| Pan troglodytes BAC clone CH251-558J11 from chromosome 4, complete
             sequence
          Length = 174061

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 78970 catacccatcagattaaatta 78990
to top
>gb|AC186042.3| Pan troglodytes BAC clone CH251-493O10 from chromosome 1, complete
             sequence
          Length = 174022

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 93098 catacccatcagattaaatta 93078
to top
>gb|BT027030.1| Gasterosteus aculeatus clone CFW154-H06 mRNA sequence
          Length = 1737

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 283 ggaggccatggagatcatgatgctg 307
           ||||||||||||||||||| |||||
Sbjct: 345 ggaggccatggagatcatgctgctg 369
to top
>gb|AC183760.2| Pan troglodytes BAC clone CH251-730F16 from chromosome 4, complete
              sequence
          Length = 179960

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 124178 catacccatcagattaaatta 124158
to top
>gb|AC185984.2| Pan troglodytes BAC clone CH251-446C10 from chromosome 1, complete
             sequence
          Length = 146175

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 99853 catacccatcagattaaatta 99833
to top
>gb|AC159094.5| Mus musculus chromosome 3, clone RP23-277N17, complete sequence
          Length = 192452

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1127  gcaaggagatgtggacctgtt 1147
             |||||||||||||||||||||
Sbjct: 93260 gcaaggagatgtggacctgtt 93280
to top
>gb|AC148939.8| Pan troglodytes BAC clone CH251-51M11 from chromosome 7, complete
              sequence
          Length = 183313

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 157703 catacccatcagattaaatta 157683
to top
>gb|AC182391.3| Pan troglodytes BAC clone CH251-510H16 from chromosome 1, complete
              sequence
          Length = 188995

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 134635 catacccatcagattaaatta 134615
to top
>gb|AC148834.3| Pan troglodytes BAC clone CH251-4D23 from chromosome 7, complete
             sequence
          Length = 192312

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 63925 catacccatcagattaaatta 63945
to top
>gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 13, complete
             sequence
          Length = 787999

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 55    ccgagtcgcgcctcatctccc 75
             |||||||||||||||||||||
Sbjct: 20565 ccgagtcgcgcctcatctccc 20585
to top
>gb|AC102259.7| Mus musculus chromosome 3, clone RP24-199C12, complete sequence
          Length = 182793

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1127  gcaaggagatgtggacctgtt 1147
             |||||||||||||||||||||
Sbjct: 52666 gcaaggagatgtggacctgtt 52646
to top
>gb|BC079734.1| Xenopus laevis cDNA clone MGC:83983 IMAGE:6945638, complete cds
          Length = 1871

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1528 tcagaaagaagctgtgtttgt 1548
            |||||||||||||||||||||
Sbjct: 1176 tcagaaagaagctgtgtttgt 1196
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 79     ggcgcggcggcgcttgcgccg 99
              |||||||||||||||||||||
Sbjct: 753195 ggcgcggcggcgcttgcgccg 753175
to top
>gb|AC146018.3| Pan troglodytes BAC clone RP43-135A21 from 7, complete sequence
          Length = 177841

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 157038 catacccatcagattaaatta 157018
to top
>gb|AC148157.1| Homo sapiens chromosome 21 clone XX-181G02-M map q21.3-22.11, complete
              sequence
          Length = 210352

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1049   cttctttggtttgtctacttt 1069
              |||||||||||||||||||||
Sbjct: 154644 cttctttggtttgtctacttt 154664
to top
>gb|AC146118.3| Pan troglodytes BAC clone RP43-23A6 from 7, complete sequence
          Length = 166241

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 88283 catacccatcagattaaatta 88263
to top
>gb|AC027644.9| Homo sapiens BAC clone RP11-792A8 from 7, complete sequence
          Length = 188207

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1665 catacccatcagattaaatta 1685
            |||||||||||||||||||||
Sbjct: 3622 catacccatcagattaaatta 3602
to top
>gb|AC096582.1| Homo sapiens BAC clone RP11-638I8 from 7, complete sequence
          Length = 132122

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 36796 catacccatcagattaaatta 36816
to top
>gb|AC093392.4| Homo sapiens BAC clone RP11-814E24 from 7, complete sequence
          Length = 99597

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 94927 catacccatcagattaaatta 94907
to top
>gb|AC004987.2| Homo sapiens PAC clone RP5-1173I20 from 7, complete sequence
          Length = 111158

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 87905 catacccatcagattaaatta 87885
to top
>ref|XM_541170.2| PREDICTED: Canis familiaris similar to tubby like protein 4 isoform 1
            (LOC484053), mRNA
          Length = 4915

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 95   cgccgaagtctcccgccagtc 115
            |||||||||||||||||||||
Sbjct: 3515 cgccgaagtctcccgccagtc 3535
to top
>gb|AC097646.2| Homo sapiens cosmid clone XXcos-2185C14 from 7, complete sequence
          Length = 42961

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 21599 catacccatcagattaaatta 21579
to top
>gb|AC097645.2| Homo sapiens cosmid clone XXcos-2185C4 from 7, complete sequence
          Length = 41572

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 32522 catacccatcagattaaatta 32502
to top
>gb|AC102114.9| Mus musculus chromosome 10, clone RP23-139F20, complete sequence
          Length = 232173

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1127   gcaaggagatgtggacctgtt 1147
              |||||||||||||||||||||
Sbjct: 125321 gcaaggagatgtggacctgtt 125301
to top
>gb|AC131288.3| Homo sapiens chromosome 11, clone RP11-957I23, complete sequence
          Length = 74550

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 65752 catacccatcagattaaatta 65772
to top
>gb|AC110079.3| Homo sapiens BAC clone RP11-384K6 from 4, complete sequence
          Length = 167099

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 21765 catacccatcagattaaatta 21785
to top
>gb|AC120440.5| Homo sapiens chromosome 11, clone CTD-2013B7, complete sequence
          Length = 45460

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 45197 catacccatcagattaaatta 45177
to top
>gb|AE011789.1| Xanthomonas axonopodis pv. citri str. 306,  section 167 of 469 of the
            complete genome
          Length = 10221

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 362  gggctcatcaccagcgtcgtc 382
            |||||||||||||||||||||
Sbjct: 6114 gggctcatcaccagcgtcgtc 6094
to top
>gb|AC073556.11| Oryza sativa chromosome 3 BAC OSJNBa0091P11 genomic sequence, complete
             sequence
          Length = 160738

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1562  ctctttcttgcagcaattgcc 1582
             |||||||||||||||||||||
Sbjct: 24285 ctctttcttgcagcaattgcc 24265
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 1562    ctctttcttgcagcaattgcc 1582
               |||||||||||||||||||||
Sbjct: 3757203 ctctttcttgcagcaattgcc 3757223
to top
>gb|AC025787.9| Homo sapiens chromosome 11, clone RP11-227P3, complete sequence
          Length = 168793

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 14311 catacccatcagattaaatta 14291
to top
>emb|AL954642.9| Human DNA sequence from clone RP11-885N19 on chromosome 9 Contains the 3'
              end of the CACNA1B gene for alpha 1B subunit of L type
              voltage-dependent calcium channel, a pseudogene similar to
              part of interleukin 9 receptor (ILR9), a tubulin, beta
              polypeptide 4, member Q (TUBB4Q) pseudogene and five CpG
              islands, complete sequence
          Length = 154372

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 149201 catacccatcagattaaatta 149221
to top
>emb|AL627309.15| Human DNA sequence from clone RP11-34P13 on chromosome 1 Contains a
              pseudogene similar to part of DEAD/H box polypeptide 11
              (CHL1-like helicase homolog, S. cerevisiae) (DDX11), two
              novel pseudogenes, nine novel genes, two novel proteins
              similar to the olfactory receptor family, a capicua homolog
              (Drosophila) (CIC) pseudogene and two CpG islands, complete
              sequence
          Length = 166904

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 149157 catacccatcagattaaatta 149137
to top
>emb|AL606534.15| Human DNA sequence from clone RP11-261C10 on chromosome 1 Contains four
             novel genes, the 5' end of a novel gene and the 3' end of
             the gene for KARP-1-binding protein (KAB), complete
             sequence
          Length = 183541

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 97234 catacccatcagattaaatta 97214
to top
>emb|AL669831.13| Human DNA sequence from clone RP11-206L10 on chromosome 1 Contains
             thirteen novel genes, a novel pseudogene, a novel gene
             similar to the F-box only protein 25 gene(FBXO25), a novel
             pseudogene similar to the beta-tubulin family and a CpG
             island, complete sequence
          Length = 179567

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 62598 catacccatcagattaaatta 62578
to top
>emb|AL592148.7| Human DNA sequence from clone RP11-378J18 on chromosome 1 Contains
            the gene for a novel protein (FLJ13840), the TAF1A gene
            for TATA box binding protein (TBP)-associated factor, RNA
            polymerase I, A, 48kDa, two novel genes, the gene for
            C219-reactive peptide (FLJ39207), the 3' of the gene for
            a novel protein (FLJ12806) and a CpG island, complete
            sequence
          Length = 194034

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1665 catacccatcagattaaatta 1685
            |||||||||||||||||||||
Sbjct: 9959 catacccatcagattaaatta 9939
to top
>emb|AL137020.13| Human DNA sequence from clone RP11-146B14 on chromosome 9 Contains part
             of the JMJD2C gene for jumonji domain containing 2C,
             complete sequence
          Length = 182231

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 498   ctttatcacctaactacatat 518
             |||||||||||||||||||||
Sbjct: 94612 ctttatcacctaactacatat 94592
to top
>emb|AL133216.10| Human DNA sequence from clone RP11-291L22 on chromosome 10 Contains the
             3' end of a gene for a novel protein similar to
             17-beta-hydroxysteroid dehydrogenase type 7 (HSD17B7), the
             gene for a novel protein similar to CDC10 cell division
             cycle 10, homolog (S. cerevisiae) (CDC10), a novel gene, a
             novel gene containing FLJ14186, a capicua homolog
             (Drosophila) (CIC) pseudogene and a CpG island, complete
             sequence
          Length = 166835

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 58698 catacccatcagattaaatta 58718
to top
>gb|AC073135.3| Homo sapiens BAC clone RP11-694O4 from 7, complete sequence
          Length = 190016

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 40593 catacccatcagattaaatta 40573
to top
>emb|AL022097.1|HS256G22 Human DNA sequence from clone RP1-256G22 on chromosome 6p24.1-25.3
             Contains a heterogeneous nuclear ribonucleoprotein A0
             (HNRPA0) pseudogene and part of the gene for
             phenylalanine-tRNA synthetase (FARS1), complete sequence
          Length = 149140

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 627   ttgtcttccattgtacttgga 647
             |||||||||||||||||||||
Sbjct: 77558 ttgtcttccattgtacttgga 77538
to top
>gb|AC145858.5| Pan troglodytes BAC clone RP43-6D19 from chromosome 7, complete
             sequence
          Length = 196528

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 16913 catacccatcagattaaatta 16893
to top
>gb|AC144491.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNAa0091P11, complete sequence
          Length = 132151

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1562  ctctttcttgcagcaattgcc 1582
             |||||||||||||||||||||
Sbjct: 35716 ctctttcttgcagcaattgcc 35736
to top
>gb|AC115287.5| Homo sapiens chromosome 1 clone RP5-870L9, complete sequence
          Length = 99182

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 54789 catacccatcagattaaatta 54769
to top
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 79      ggcgcggcggcgcttgcgccg 99
               |||||||||||||||||||||
Sbjct: 1647837 ggcgcggcggcgcttgcgccg 1647817
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 79      ggcgcggcggcgcttgcgccg 99
               |||||||||||||||||||||
Sbjct: 2073526 ggcgcggcggcgcttgcgccg 2073506
to top
>gb|AC069287.7| Homo sapiens BAC clone RP11-304M2 from 11, complete sequence
          Length = 199487

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 104589 catacccatcagattaaatta 104609
to top
>gb|AC133919.3| Homo sapiens chromosome 16 clone RP11-356C4, complete sequence
          Length = 210446

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 167242 catacccatcagattaaatta 167262
to top
>gb|AC093752.2| Homo sapiens BAC clone RP11-33B1 from 4, complete sequence
          Length = 130879

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 37371 catacccatcagattaaatta 37351
to top
>gb|AC090118.2|AC090118 Homo sapiens chromosome 19 clone unknown, complete sequence
          Length = 41396

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1665 catacccatcagattaaatta 1685
            |||||||||||||||||||||
Sbjct: 2369 catacccatcagattaaatta 2389
to top
>gb|AC150749.3| Pan troglodytes BAC clone CH251-553P23 from chromosome 7, complete
             sequence
          Length = 237211

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 18069 catacccatcagattaaatta 18089
to top
>gb|AC146179.2| Pan troglodytes BAC clone RP43-36B22 from chromosome 7, complete
             sequence
          Length = 159208

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 62727 catacccatcagattaaatta 62747
to top
>gb|AF329207.1|AF329207 Homo sapiens clone 19ptel_2030Br sequence
          Length = 1089

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1665 catacccatcagattaaatta 1685
            |||||||||||||||||||||
Sbjct: 431  catacccatcagattaaatta 451
to top
>gb|AY214122.1| Rattus norvegicus calcium sensing receptor mRNA, complete cds
          Length = 4107

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 18   ctccaccggctccataccctcctcc 42
            ||||||||||||||| |||||||||
Sbjct: 3275 ctccaccggctccattccctcctcc 3299
to top
>gb|AC138393.2| Homo sapiens chromosome 1 clone RP11-504P24, complete sequence
          Length = 184644

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 80782 catacccatcagattaaatta 80762
to top
>gb|AC136309.9| Homo sapiens chromosome 11, clone RP11-242C5, complete sequence
          Length = 150642

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 143618 catacccatcagattaaatta 143598
to top
>gb|AC005627.2|AC005627 Homo sapiens PAC clone RP4-577P23 from 1, complete sequence
          Length = 137304

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 18296 catacccatcagattaaatta 18316
to top
>gb|AC137818.1| Homo sapiens chromosome 16 clone XXcos-y2118c8, complete sequence
          Length = 42524

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1665 catacccatcagattaaatta 1685
            |||||||||||||||||||||
Sbjct: 1700 catacccatcagattaaatta 1720
to top
>dbj|AP006622.1| Homo sapiens genomic DNA, chromosome 11, clone:RP11-1276E07, complete
              sequence
          Length = 114001

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1665   catacccatcagattaaatta 1685
              |||||||||||||||||||||
Sbjct: 106182 catacccatcagattaaatta 106162
to top
>ref|XM_568387.1| Cryptococcus neoformans var. neoformans JEC21 glycoprotein
           (CNM00090) partial mRNA
          Length = 1589

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 55  ccgagtcgcgcctcatctccc 75
           |||||||||||||||||||||
Sbjct: 225 ccgagtcgcgcctcatctccc 245
to top
>gb|AC064814.10| Homo sapiens BAC clone CTD-2100B3 from 2, complete sequence
          Length = 134167

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 1058  tttgtctactttgcattttgttttgcttactat 1090
             ||||||| || | ||||||||||||||||||||
Sbjct: 57483 tttgtctgctgtccattttgttttgcttactat 57515
to top
>dbj|AP001705.1| Homo sapiens genomic DNA, chromosome 21q, section 49/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1049   cttctttggtttgtctacttt 1069
              |||||||||||||||||||||
Sbjct: 161623 cttctttggtttgtctacttt 161643
to top
>gb|AF109718.1|HSCOS10 Homo sapiens chromosome 3 subtelomeric region
          Length = 40247

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 37916 catacccatcagattaaatta 37896
to top
>gb|AC004812.1|AC004812 Homo sapiens PAC clone 267D11 from 12, complete sequence
          Length = 138532

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 33    accctcctcccccagccctcc 53
             |||||||||||||||||||||
Sbjct: 84263 accctcctcccccagccctcc 84283
to top
>gb|U20289.1|RNU20289 Rattus norvegicus calcium sensing receptor mRNA, complete cds
          Length = 3761

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 18   ctccaccggctccataccctcctcc 42
            ||||||||||||||| |||||||||
Sbjct: 2911 ctccaccggctccattccctcctcc 2935
to top
>ref|NM_016996.1| Rattus norvegicus calcium-sensing receptor (Casr), mRNA
 gb|U10354.1|RNU10354 Rattus norvegicus kidney extracellular calcium-sensing receptor mRNA,
            complete cds
          Length = 4113

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 18   ctccaccggctccataccctcctcc 42
            ||||||||||||||| |||||||||
Sbjct: 3285 ctccaccggctccattccctcctcc 3309
to top
>gb|AC156458.1| Loxodonta africana, clone Loxodonta africana-6767875B22, complete
            sequence
          Length = 38495

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 846  tgaacaacatggctctgccct 866
            |||||||||||||||||||||
Sbjct: 4343 tgaacaacatggctctgccct 4363
to top
>gb|AC153695.2| Mus musculus  10 BAC RP23-184L5 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse 10 BAC Library) complete sequence
          Length = 209875

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1127  gcaaggagatgtggacctgtt 1147
             |||||||||||||||||||||
Sbjct: 38062 gcaaggagatgtggacctgtt 38082
to top
>dbj|AP000240.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
              clone:B175P11, complete sequence
          Length = 176099

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1049   cttctttggtttgtctacttt 1069
              |||||||||||||||||||||
Sbjct: 151980 cttctttggtttgtctacttt 152000
to top
>dbj|AP000200.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             B355D16-T1073, segment 6/8, complete sequence
          Length = 100000

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1049  cttctttggtttgtctacttt 1069
             |||||||||||||||||||||
Sbjct: 16368 cttctttggtttgtctacttt 16348
to top
>gb|AC010507.6| Homo sapiens chromosome 19 clone LLNLF-176F2, complete sequence
          Length = 39993

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 37625 catacccatcagattaaatta 37605
to top
>gb|AC129484.8| Homo sapiens chromosome 11, clone RP13-337F11, complete sequence
          Length = 52805

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1665  catacccatcagattaaatta 1685
             |||||||||||||||||||||
Sbjct: 51710 catacccatcagattaaatta 51690
to top
>dbj|AP000096.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related,
             B335D16-P10G11 region, segment 6/7
          Length = 100000

 Score = 42.1 bits (21), Expect = 6.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1049  cttctttggtttgtctacttt 1069
             |||||||||||||||||||||
Sbjct: 16368 cttctttggtttgtctacttt 16348


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 297,452,813
Number of extensions: 15451369
Number of successful extensions: 307344
Number of sequences better than 10.0: 90
Number of HSP's gapped: 307336
Number of HSP's successfully gapped: 119
Length of query: 1719
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1696
Effective length of database: 18,503,978,556
Effective search space: 31382747630976
Effective search space used: 31382747630976
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top