ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf105b19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC118346.2| Oryza sativa (japonica cultivar-group) chromosome... 105 1e-19
2dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
3gb|DQ245141.1| Zea mays clone 13268 mRNA sequence 103 4e-19
4gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence 103 4e-19
5gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence 103 4e-19
6ref|NM_001074857.1| Oryza sativa (japonica cultivar-group) Os11g... 100 7e-18
7dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
8gb|AY109342.1| Zea mays CL3469_4 mRNA sequence 96 1e-16
9emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa... 96 1e-16
10emb|CT830537.1| Oryza sativa (indica cultivar-group) cDNA clone:... 94 4e-16
11emb|CT828268.1| Oryza sativa (indica cultivar-group) cDNA clone:... 94 4e-16
12ref|NM_001073383.1| Oryza sativa (japonica cultivar-group) Os12g... 94 4e-16
13dbj|AK059123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 4e-16
14gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genom... 92 2e-15
15dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
16gb|AY109560.1| Zea mays CL3469_8 mRNA sequence 88 3e-14
17gb|DQ244498.1| Zea mays clone 8560 mRNA sequence 86 1e-13
18gb|DQ245928.1| Zea mays clone 92533 mRNA sequence 82 2e-12
19gb|AY110912.1| Zea mays CL3469_2 mRNA sequence 80 6e-12
20gb|AY310769.1| Nicotiana benthamiana clone 8-039 unknown mRNA 78 2e-11
21gb|AY846831.1| Triticum aestivum ribosomal protein S29 mRNA, com... 78 2e-11
22dbj|AK224652.1| Solanum lycopersicum cDNA, clone: FC04DA08, HTC ... 74 4e-10
23emb|CT981398.1| partial cDNA sequence from a Lambda ZAP II norma... 74 4e-10
24emb|Y16127.1|LES16127 Lycopersicon esculentum mRNA for hypotheti... 74 4e-10
25gb|DQ083212.1| Oryza sativa (indica cultivar-group) clone 7S11G3... 70 6e-09
26gb|AY389605.1| Hyacinthus orientalis ribosomal protein S29 (RPS2... 68 2e-08
27gb|DQ108844.1| Arabidopsis thaliana clone 32764 mRNA sequence 64 4e-07
28gb|BT028875.1| Arabidopsis thaliana At4g33865 mRNA, complete cds 62 1e-06
29dbj|AK228020.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
30emb|CT988000.1| partial cDNA sequence from a Lambda ZAP II norma... 62 1e-06
31emb|CT985780.1| partial cDNA sequence from a Lambda ZAP II norma... 62 1e-06
32emb|CT984369.1| partial cDNA sequence from a Lambda ZAP II norma... 62 1e-06
33emb|CT981205.1| partial cDNA sequence from a Lambda ZAP II norma... 62 1e-06
34emb|CT980738.1| partial cDNA sequence from a Lambda ZAP II norma... 62 1e-06
35emb|CT980724.1| partial cDNA sequence from a Lambda ZAP II norma... 62 1e-06
36ref|NM_119544.3| Arabidopsis thaliana structural constituent of ... 62 1e-06
37gb|AY086371.1| Arabidopsis thaliana clone 24629 mRNA, complete s... 62 1e-06
38gb|AF325031.2|AF325031 Arabidopsis thaliana AT3g43980 (AT3g43980... 62 1e-06
39dbj|AK176861.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
40dbj|AK176815.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
41dbj|AK176439.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
42dbj|AK176332.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
43dbj|AK176322.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
44dbj|AK176295.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
45dbj|AK176294.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
46dbj|AK176060.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
47dbj|AK175918.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
48dbj|AK175739.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
49dbj|AK175283.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
50dbj|AK175173.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
51dbj|AK175172.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
52dbj|AK175152.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
53dbj|AK175132.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 62 1e-06
54dbj|AK118617.1| Arabidopsis thaliana At4g33865 mRNA for putative... 62 1e-06
55emb|BX828871.1|CNS0A3J1 Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
56emb|BX841605.1|CNS09YHD Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
57gb|AC189386.1| Brassica rapa subsp. pekinensis clone KBrB052L10,... 60 6e-06
58dbj|AK224874.1| Solanum lycopersicum cDNA, clone: FC23DB12, HTC ... 58 2e-05
59ref|NM_114269.2| Arabidopsis thaliana structural constituent of ... 58 2e-05
60gb|AY086767.1| Arabidopsis thaliana clone 2749 mRNA, complete se... 58 2e-05
61gb|DQ108688.1| Arabidopsis thaliana clone 107113 mRNA sequence 58 2e-05
62gb|BT004344.1| Arabidopsis thaliana clone U20117 putative riboso... 58 2e-05
63gb|BT002766.1| Arabidopsis thaliana clone RAFL15-04-A21 (R20117)... 58 2e-05
64emb|BX826239.1|CNS0A7QD Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
65emb|BX825609.1|CNS0A7QE Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
66emb|BX825142.1|CNS0A7PE Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
67emb|BX824534.1|CNS0A7RP Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
68emb|BX841514.1|CNS09YHL Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
69gb|DQ068166.1| Brassica napus isolate mutant Cr3529 clone Bn23 u... 54 4e-04
70dbj|AK176070.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 4e-04
71dbj|AK175819.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 4e-04
72dbj|AK175731.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 4e-04
73emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, ... 52 0.001
74emb|AL031032.1|ATF17I5 Arabidopsis thaliana DNA chromosome 4, BA... 52 0.001
75gb|AC123899.15| Medicago truncatula clone mth2-33n6, complete se... 50 0.006
76gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-2... 50 0.006
77emb|CR931730.1| Medicago truncatula chromosome 5 clone mth2-17o... 50 0.006
78dbj|AK233927.1| Sus scrofa mRNA, clone:MLN010068H12, expressed i... 46 0.086
79dbj|AK232797.1| Sus scrofa mRNA, clone:LVRM10028H02, expressed i... 46 0.086
80dbj|AK235789.1| Sus scrofa mRNA, clone:OVRM10115D09, expressed i... 46 0.086
81ref|NM_001001633.1| Sus scrofa 40S ribosomal protein S29 (RPS29)... 46 0.086
82dbj|AP002517.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 46 0.086
83dbj|AB065501.1| Homo sapiens gene for seven transmembrane helix ... 46 0.086
84ref|NM_114266.1| Arabidopsis thaliana structural constituent of ... 44 0.34
85gb|AF349528.1| Arabidopsis thaliana putative ribosomal S29 prote... 44 0.34
86gb|AF326888.1| Arabidopsis thaliana putative ribosomal S29 prote... 44 0.34
87gb|AF361851.1| Arabidopsis thaliana AT3g43980/T15B3_120 mRNA, co... 44 0.34
88gb|AY088245.1| Arabidopsis thaliana clone 473 mRNA, complete seq... 44 0.34
89emb|AL163975.1|ATT15B3 Arabidopsis thaliana DNA chromosome 3, BA... 44 0.34
90gb|AF324695.2|AF324695 Arabidopsis thaliana AT3g43980 (AT3g43980... 44 0.34
91emb|BX822718.1|CNS0A7T6 Arabidopsis thaliana Full-length cDNA Co... 44 0.34
92gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 44 0.34
93gb|L24003.1|TOMTRALTAC Lycopersicon esculentum (DB113) meloidogy... 44 0.34
94gb|AY129480.1| Arabidopsis thaliana AT3g43980/T15B3_120 mRNA, co... 42 1.3
95gb|AC087485.6| Homo sapiens chromosome 15, clone RP11-570N16, co... 42 1.3
96emb|BX062216.1|CNS09K64 Single read from an extremity of a full-... 42 1.3
97emb|BX060052.1|CNS09II0 Single read from an extremity of a full-... 42 1.3
98emb|BX045283.1|CNS0973R Single read from an extremity of a full-... 42 1.3
99emb|BX039902.1|CNS092YA Single read from an extremity of a full-... 42 1.3
100emb|BX035521.1|CNS08ZKL Single read from an extremity of a full-... 42 1.3
101emb|BX034864.1|CNS08Z2C Single read from an extremity of a full-... 42 1.3
102emb|BX032950.1|CNS08XL6 Single read from an extremity of a full-... 42 1.3
103emb|BX032949.1|CNS08XL5 Single read from an extremity of a full-... 42 1.3
104emb|BX032900.1|CNS08XJS Single read from an extremity of a full-... 42 1.3
105emb|BX029858.1|CNS08V7A Single read from an extremity of a full-... 42 1.3
106emb|BX018990.1|CNS08MTE Single read from an extremity of a full-... 42 1.3
107emb|BX024653.1|CNS08R6P Single read from an extremity of a full-... 42 1.3
108emb|BX021452.1|CNS08OPS Single read from an extremity of a full-... 42 1.3
109emb|BX021129.1|CNS08OGT Single read from an extremity of a full-... 42 1.3
110emb|BX018131.1|CNS08M5J Single read from an extremity of a full-... 42 1.3
111emb|BX016647.1|CNS08L0B Single read from an extremity of a full-... 42 1.3
112emb|BX014329.1|CNS08J7X Single read from an extremity of a full-... 42 1.3
113emb|BX013944.1|CNS08IX8 Single read from an extremity of a full-... 42 1.3
114emb|BX013193.1|CNS08ICD Single read from an extremity of a full-... 42 1.3
115emb|BX012751.1|CNS08I03 Single read from an extremity of a full-... 42 1.3
116emb|BX011385.1|CNS08GY5 Single read from an extremity of a full-... 42 1.3
117emb|BX011384.1|CNS08GY4 Single read from an extremity of a full-... 42 1.3
118emb|BX011210.1|CNS08GTA Single read from an extremity of a full-... 42 1.3
119emb|BX011209.1|CNS08GT9 Single read from an extremity of a full-... 42 1.3
120emb|BX009526.1|CNS08FII Single read from an extremity of a full-... 42 1.3
121emb|BX008674.1|CNS08EUU Single read from an extremity of a full-... 42 1.3
122emb|BX008492.1|CNS08EPS Single read from an extremity of a full-... 42 1.3
123emb|BX007367.1|CNS08DUJ Single read from an extremity of a full-... 42 1.3
124emb|BX007366.1|CNS08DUI Single read from an extremity of a full-... 42 1.3
125emb|BX007064.1|CNS08DM4 Single read from an extremity of a full-... 42 1.3
126emb|BX006545.1|CNS08D7P Single read from an extremity of a full-... 42 1.3
127emb|BX006544.1|CNS08D7O Single read from an extremity of a full-... 42 1.3
128emb|BX005506.1|CNS08CEU Single read from an extremity of a full-... 42 1.3
129emb|BX005505.1|CNS08CET Single read from an extremity of a full-... 42 1.3
130emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosom... 42 1.3
131gb|AC136896.6| Homo sapiens chromosome 15, clone RP11-860O1, com... 42 1.3
132emb|CR381644.8| Zebrafish DNA sequence from clone CH211-80A15 in... 42 1.3
133gb|AC135350.6| Homo sapiens chromosome 15, clone RP13-946E15, co... 42 1.3
134emb|BX825823.1|CNS0A6FH Arabidopsis thaliana Full-length cDNA Co... 42 1.3
135ref|XM_321509.2| Anopheles gambiae str. PEST ENSANGP00000018161 ... 42 1.3
136gb|AC006602.1|AC006602 Homo sapiens Chromosome 15q11-q13 PAC clo... 42 1.3
137emb|BX957355.14| Zebrafish DNA sequence from clone CH211-66I15 i... 40 5.3
138gb|CP000453.1| Alkalilimnicola ehrlichei MLHE-1, complete genome 40 5.3
139gb|DQ440193.1| Aedes aegypti clone AET-1667 40S ribosomal protei... 40 5.3
140gb|AY433152.1| Aedes aegypti ASAP ID: 34225 cytosolic small ribo... 40 5.3
141ref|XM_712669.1| Candida albicans SC5314 hypothetical protein (C... 40 5.3
142ref|XM_712668.1| Candida albicans SC5314 hypothetical protein (C... 40 5.3
143ref|XM_712575.1| Candida albicans SC5314 hypothetical protein (C... 40 5.3
144ref|XM_712574.1| Candida albicans SC5314 hypothetical protein (C... 40 5.3
145gb|DQ401084.1| Chlamydomonas sp. ICE-L ribosomal protein S29 sub... 40 5.3
146gb|AY305497.1| Eurytemora affinis voucher Eaf elongation factor-... 40 5.3
147gb|AC007244.2|AC007244 Homo sapiens BAC clone RP11-207L19 from Y... 40 5.3
148gb|CP000016.1| Candidatus Blochmannia pennsylvanicus str. BPEN, ... 40 5.3
149gb|AF266749.1|AF266749 Culex pipiens quinquefasciatus ribsomal p... 40 5.3
150emb|BX001041.6| Zebrafish DNA sequence from clone CH211-62M7, co... 40 5.3
151emb|AL844564.14| Mouse DNA sequence from clone RP23-400D4 on chr... 40 5.3

>gb|AC118346.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0039F06, complete sequence
          Length = 133022
 Score =  105 bits (53), Expect = 1e-19
 Identities = 62/65 (95%)
 Strand = Plus / Minus

                                                                         
Query: 71    cgatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcg 130
             ||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||
Sbjct: 87381 cgatgggccactccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcg 87322

                  
Query: 131   tctgg 135
             |||||
Sbjct: 87321 tctgg 87317



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                         
Query: 134   ggcagtgcttccgtagcaacgccaaggatattggcttcatcaag 177
             ||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 86418 ggcagtgcttccgcagcaacgccaaggatattggcttcatcaag 86375



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score =  105 bits (53), Expect = 1e-19
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                            
Query: 71       cgatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcg 130
                ||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||
Sbjct: 24118045 cgatgggccactccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcg 24118104

                     
Query: 131      tctgg 135
                |||||
Sbjct: 24118105 tctgg 24118109



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 43/44 (97%)
 Strand = Plus / Plus

                                                            
Query: 134      ggcagtgcttccgtagcaacgccaaggatattggcttcatcaag 177
                ||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 24119008 ggcagtgcttccgcagcaacgccaaggatattggcttcatcaag 24119051



to top

>gb|DQ245141.1| Zea mays clone 13268 mRNA sequence
          Length = 442

 Score =  103 bits (52), Expect = 4e-19
 Identities = 61/64 (95%)
 Strand = Plus / Plus

                                                                       
Query: 71  cgatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcg 130
           ||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||
Sbjct: 54  cgatggggcactccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcg 113

               
Query: 131 tctg 134
           ||||
Sbjct: 114 tctg 117



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaag 188
           ||||||||||||| |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 174 ggcagtgcttccgcagcaacgccaaggacattggcttcatcaagtaccgctgaag 228



to top

>gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence
          Length = 424

 Score =  103 bits (52), Expect = 4e-19
 Identities = 61/64 (95%)
 Strand = Plus / Plus

                                                                       
Query: 71  cgatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcg 130
           ||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||
Sbjct: 41  cgatggggcactccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcg 100

               
Query: 131 tctg 134
           ||||
Sbjct: 101 tctg 104



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                           
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtacc 181
           ||||||||||||| |||||||||||||| |||||||||||||||||||
Sbjct: 161 ggcagtgcttccgcagcaacgccaaggacattggcttcatcaagtacc 208



to top

>gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence
          Length = 402

 Score =  103 bits (52), Expect = 4e-19
 Identities = 61/64 (95%)
 Strand = Plus / Plus

                                                                       
Query: 71  cgatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcg 130
           ||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||
Sbjct: 27  cgatggggcactccaacgtgtggaactcgcaccccaagaactacgggcccggatcccgcg 86

               
Query: 131 tctg 134
           ||||
Sbjct: 87  tctg 90



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaag 188
           ||||||||||||| |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 147 ggcagtgcttccgcagcaacgccaaggacattggcttcatcaagtaccgctgaag 201



to top

>ref|NM_001074857.1| Oryza sativa (japonica cultivar-group) Os11g0634500 (Os11g0634500)
           mRNA, complete cds
          Length = 171

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 59/62 (95%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtc 132
           ||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 1   atgggccactccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcgtc 60

             
Query: 133 tg 134
           ||
Sbjct: 61  tg 62



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                            
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 119 ggcagtgcttccgcagcaacgccaaggatattggcttcatcaagtaccg 167



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                            
Query: 72       gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgt 131
                |||||| |||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 19577506 gatggggcactccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgt 19577565

                    
Query: 132      ctgg 135
                ||||
Sbjct: 19577566 ctgg 19577569



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                          
Query: 136      cagtgcttccgtagcaacgccaaggatattggcttcatcaag 177
                ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 19578177 cagtgcttccgcagcaacgccaaggacatcggcttcatcaag 19578218



to top

>gb|AY109342.1| Zea mays CL3469_4 mRNA sequence
          Length = 814

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                       
Query: 71  cgatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcg 130
           ||||||| ||||||||||| |||||||| ||||||||||||||||| |||||||||||||
Sbjct: 57  cgatggggcactccaacgtctggaactcgcaccccaagaactacgggcccggatcccgcg 116

               
Query: 131 tctg 134
           ||||
Sbjct: 117 tctg 120



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Plus

                                                                 
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaa 187
           ||||||||||||| ||||| |||||||| |||||||||||||||||||| ||||
Sbjct: 177 ggcagtgcttccgcagcaatgccaaggacattggcttcatcaagtaccgctgaa 230



to top

>emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa0009K11 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 144596

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                          
Query: 72     gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgt 131
              |||||| |||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 109687 gatggggcactccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgt 109746

                  
Query: 132    ctgg 135
              ||||
Sbjct: 109747 ctgg 109750



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                        
Query: 136    cagtgcttccgtagcaacgccaaggatattggcttcatcaag 177
              ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 110358 cagtgcttccgcagcaacgccaaggacatcggcttcatcaag 110399



to top

>emb|CT830537.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA333Z81, full
           insert sequence
          Length = 447

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Plus

                                                                       
Query: 72  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgt 131
           |||||| |||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 77  gatggggcactccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgt 136

              
Query: 132 ctg 134
           |||
Sbjct: 137 ctg 139



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 198 cagtgcttccgcagcaacgccaaggacatcggcttcatcaagtaccg 244



to top

>emb|CT828268.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA216P01, full
           insert sequence
          Length = 413

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaag 188
           ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 110 ggcagtgcttccgcagcaacgccaaggatattggcttcatcaagtaccgctgaag 164



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                
Query: 82  tccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtctg 134
           ||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 1   tccaacgtgtggaactcccaccccaagaactacgggcccggctcccgcgtctg 53



to top

>ref|NM_001073383.1| Oryza sativa (japonica cultivar-group) Os12g0508300 (Os12g0508300)
           mRNA, complete cds
          Length = 457

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Plus

                                                                       
Query: 72  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgt 131
           |||||| |||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 87  gatggggcactccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgt 146

              
Query: 132 ctg 134
           |||
Sbjct: 147 ctg 149



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 208 cagtgcttccgcagcaacgccaaggacatcggcttcatcaagtaccg 254



to top

>dbj|AK059123.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-F08, full
           insert sequence
          Length = 457

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Plus

                                                                       
Query: 72  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgt 131
           |||||| |||||||||||||||||||||||||||||||||||||| || || ||||||||
Sbjct: 87  gatggggcactccaacgtgtggaactcccaccccaagaactacgggccgggctcccgcgt 146

              
Query: 132 ctg 134
           |||
Sbjct: 147 ctg 149



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 208 cagtgcttccgcagcaacgccaaggacatcggcttcatcaagtaccg 254



to top

>gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete
             sequence
          Length = 134496

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 52/54 (96%)
 Strand = Plus / Minus

                                                                   
Query: 73    atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcc 126
             ||||| |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 64650 atgggacactccaacgtgtggaactcgcaccccaagaactacggccccggatcc 64597



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                         
Query: 134   ggcagtgcttccgtagcaacgccaaggatattggcttcatcaag 177
             ||||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 64274 ggcagtgcttccgcagcaacgccaaggacattggcttcatcaag 64231



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 52/54 (96%)
 Strand = Plus / Minus

                                                                      
Query: 73       atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcc 126
                ||||| |||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 31829940 atgggacactccaacgtgtggaactcgcaccccaagaactacggccccggatcc 31829887



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                            
Query: 134      ggcagtgcttccgtagcaacgccaaggatattggcttcatcaag 177
                ||||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 31829564 ggcagtgcttccgcagcaacgccaaggacattggcttcatcaag 31829521



to top

>gb|AY109560.1| Zea mays CL3469_8 mRNA sequence
          Length = 586

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 151 ggcagtgcttccgcagcaacgccaaggacattggtttcatcaagtaccgttgaaga 206



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 71  cgatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcg 130
           ||||||| ||||||||||| |||||||| ||||| |||||||||||||| || |||||||
Sbjct: 31  cgatgggccactccaacgtttggaactcgcaccctaagaactacggccctggctcccgcg 90

               
Query: 131 tctg 134
           ||||
Sbjct: 91  tctg 94



to top

>gb|DQ244498.1| Zea mays clone 8560 mRNA sequence
          Length = 572

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                              
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||||||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 185 ggcagtgcttccgcagcaacgccaaggacattggcttcatcaagtaccgtt 235



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Plus

                                                                 
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcc 126
           ||||| ||||| ||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 67  atgggacactcgaacgtctggaactcgcaccccaagaactacggccccggatcc 120



to top

>gb|DQ245928.1| Zea mays clone 92533 mRNA sequence
          Length = 563

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatc 125
           ||||| |||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 100 atgggacactccaacgtgtggaactcgcaccccaagaactacggccctggatc 152



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                               
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaa 187
           ||||||||||| |||||||||||||| |||||||||||||||||||| ||||
Sbjct: 220 cagtgcttccgcagcaacgccaaggacattggcttcatcaagtaccgctgaa 271



to top

>gb|AY110912.1| Zea mays CL3469_2 mRNA sequence
          Length = 489

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                               
Query: 74  tgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatc 125
           |||| |||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 92  tgggacactccaacgtgtggaactcgcaccccaagaactacggccctggatc 143



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                               
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaa 187
           ||||||||||| |||||||||||||| |||||||||||||||||||| ||||
Sbjct: 211 cagtgcttccgcagcaacgccaaggacattggcttcatcaagtaccgctgaa 262



to top

>gb|AY310769.1| Nicotiana benthamiana clone 8-039 unknown mRNA
          Length = 392

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||||||||||| |||||||||||||| | ||||||||||||||||||||
Sbjct: 176 ggcagtgcttccgcagcaacgccaaggaaactggcttcatcaagtaccgtt 226



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 72  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccg 128
           |||||||||||| ||| | |||||  | |||||||||||||||||||| || |||||
Sbjct: 57  gatgggtcactctaacatctggaatgctcaccccaagaactacggccctggctcccg 113



to top

>gb|AY846831.1| Triticum aestivum ribosomal protein S29 mRNA, complete cds
          Length = 398

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||||||||||| ||| |||||||||| ||||||||||||||||||||||
Sbjct: 157 ggcagtgcttccgcagcgacgccaaggacattggcttcatcaagtaccgtt 207



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                 
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcc 126
           ||||| ||||| ||||| |||||||| |||||||||||||||||| ||||||||
Sbjct: 39  atgggacactcgaacgtctggaactcgcaccccaagaactacggcgccggatcc 92



to top

>dbj|AK224652.1| Solanum lycopersicum cDNA, clone: FC04DA08, HTC in fruit
          Length = 458

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||||||||| ||||| |||||||| ||||||||||||||||||||||
Sbjct: 164 cagtgcttccgcagcaatgccaaggaaattggcttcatcaagtaccgtt 212



 Score = 48.1 bits (24), Expect = 0.022
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 72  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccc 119
           |||||||||||| ||| | |||||| | ||||| ||||||||||||||
Sbjct: 43  gatgggtcactctaacatctggaacgctcacccaaagaactacggccc 90



to top

>emb|CT981398.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 446

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 117 ggcagtgcttccgcagcaacgccaaggaaattggcttcattaagtaccg 165



to top

>emb|Y16127.1|LES16127 Lycopersicon esculentum mRNA for hypothetical protein
          Length = 474

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||||||||| ||||| |||||||| ||||||||||||||||||||||
Sbjct: 174 cagtgcttccgcagcaatgccaaggaaattggcttcatcaagtaccgtt 222



to top

>gb|DQ083212.1| Oryza sativa (indica cultivar-group) clone 7S11G34 mRNA sequence
          Length = 346

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 23  cagtgcttccgcagcaacgccaaggacatcggcttcatcaagtaccg 69



to top

>gb|AY389605.1| Hyacinthus orientalis ribosomal protein S29 (RPS29) mRNA, partial
           cds
          Length = 481

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                 
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaa 187
           ||||||||||||||||||| |||||||| |||||||| || |||||||| ||||
Sbjct: 172 ggcagtgcttccgtagcaatgccaaggaaattggctttattaagtaccgctgaa 225



to top

>gb|DQ108844.1| Arabidopsis thaliana clone 32764 mRNA sequence
          Length = 347

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgcgtc 132
           ||||||||||| || || |||||||| || || || || ||||| || ||||| ||  | 
Sbjct: 69  atgggtcactctaatgtatggaactctcatccgaataagtacggtcctggatctcgttta 128

                                                               
Query: 133 tggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           || ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 129 tgacagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 180



to top

>gb|BT028875.1| Arabidopsis thaliana At4g33865 mRNA, complete cds
          Length = 171

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 121 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 171



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 1   atgggtcactccaacgtctggaattctcatcctaagaaatacgg 44



to top

>dbj|AK228020.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL14-54-A12
          Length = 370

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>emb|CT988000.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 392

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||| ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 122 cagtgtttccgcagcaatgccaaggagattggcttcatcaagtaccg 168



to top

>emb|CT985780.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 450

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccc 119
           ||||||||||| ||||| |||||||| |||||||||| |||||||||
Sbjct: 74  atgggtcactcgaacgtctggaactctcaccccaagagctacggccc 120



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||| ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 194 cagtgtttccgcagcaatgccaaggagattggcttcatcaagtaccg 240



to top

>emb|CT984369.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 412

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccc 119
           ||||||||||| ||||| |||||||| |||||||||| |||||||||
Sbjct: 23  atgggtcactcgaacgtctggaactctcaccccaagagctacggccc 69



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||| ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 143 cagtgtttccgcagcaatgccaaggagattggcttcatcaagtaccg 189



to top

>emb|CT981205.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 385

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccc 119
           ||||||||||| ||||| |||||||| |||||||||| |||||||||
Sbjct: 9   atgggtcactcgaacgtctggaactctcaccccaagagctacggccc 55



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||| ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 129 cagtgtttccgcagcaatgccaaggagattggcttcatcaagtaccg 175



to top

>emb|CT980738.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 385

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccc 119
           ||||||||||| ||||| |||||||| |||||||||| |||||||||
Sbjct: 9   atgggtcactcgaacgtctggaactctcaccccaagagctacggccc 55



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||| ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 129 cagtgtttccgcagcaatgccaaggagattggcttcatcaagtaccg 175



to top

>emb|CT980724.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 450

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccc 119
           ||||||||||| ||||| |||||||| |||||||||| |||||||||
Sbjct: 74  atgggtcactcgaacgtctggaactctcaccccaagagctacggccc 120



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||| ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 194 cagtgtttccgcagcaatgccaaggagattggcttcatcaagtaccg 240



to top

>ref|NM_119544.3| Arabidopsis thaliana structural constituent of ribosome (AT4G33865)
           mRNA, complete cds
          Length = 439

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 203 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 253



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 83  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 126



to top

>gb|AY086371.1| Arabidopsis thaliana clone 24629 mRNA, complete sequence
          Length = 423

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 203 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 253



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 83  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 126



to top

>gb|AF325031.2|AF325031 Arabidopsis thaliana AT3g43980 (AT3g43980/T15B3_120) mRNA, complete
           cds
          Length = 420

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 200 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 250



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 80  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 123



to top

>dbj|AK176861.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL25-41-O05
          Length = 359

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 164 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 214



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 44  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 87



to top

>dbj|AK176815.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL25-36-M09
          Length = 496

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 177 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 227



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 57  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 100



to top

>dbj|AK176439.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL24-19-N14
          Length = 367

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK176332.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-32-J11
          Length = 385

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 205 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 255



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 85  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 128



to top

>dbj|AK176322.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-29-F01
          Length = 370

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK176295.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-24-M01
          Length = 368

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 170 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 220



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 50  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 93



to top

>dbj|AK176294.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-24-E02
          Length = 370

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK176060.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-80-C13
          Length = 407

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK175918.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-58-A09
          Length = 407

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 177 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 227



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 57  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 100



to top

>dbj|AK175739.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-28-I01
          Length = 407

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK175283.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-72-B11
          Length = 388

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK175173.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-59-B22
          Length = 359

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 164 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 214



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 44  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 87



to top

>dbj|AK175172.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-59-A02
          Length = 370

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK175152.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-57-E24
          Length = 423

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 188 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 238



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 68  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 111



to top

>dbj|AK175132.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-54-P17
          Length = 394

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 164 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 214



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 44  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 87



to top

>dbj|AK118617.1| Arabidopsis thaliana At4g33865 mRNA for putative ribosomal S29
           subunit, complete cds, clone: RAFL19-88-C17
          Length = 427

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 221 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 271



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 101 atgggtcactccaacgtctggaattctcatcctaagaaatacgg 144



to top

>emb|BX828871.1|CNS0A3J1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL45ZE11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 382

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 158 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 208



to top

>emb|BX841605.1|CNS09YHD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL66ZF11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 358

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 136 cagtgtttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 186



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 16  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 59



to top

>gb|AC189386.1| Brassica rapa subsp. pekinensis clone KBrB052L10, complete sequence
          Length = 150609

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                        
Query: 136    cagtgcttccgtagcaacgccaaggatattggcttcatcaag 177
              |||||||||||||||||||||||||| || || |||||||||
Sbjct: 124862 cagtgcttccgtagcaacgccaaggaaatcggattcatcaag 124903



to top

>dbj|AK224874.1| Solanum lycopersicum cDNA, clone: FC23DB12, HTC in fruit
          Length = 433

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 134 ggcagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccg 182
           ||||||||||||| ||||| |||||||| ||||| ||||| ||||||||
Sbjct: 170 ggcagtgcttccgcagcaatgccaaggaaattggtttcattaagtaccg 218



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 72  gatgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatcccgc 129
           |||||||||||| ||| | |||||| | || ||||||||||||||||| || ||||||
Sbjct: 51  gatgggtcactctaacatctggaacgctcatcccaagaactacggccctggttcccgc 108



to top

>ref|NM_114269.2| Arabidopsis thaliana structural constituent of ribosome (AT3G44010)
           mRNA, complete cds
          Length = 483

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 189 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 237



to top

>gb|AY086767.1| Arabidopsis thaliana clone 2749 mRNA, complete sequence
          Length = 482

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 189 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 237



to top

>gb|DQ108688.1| Arabidopsis thaliana clone 107113 mRNA sequence
          Length = 393

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 137 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 185



to top

>gb|BT004344.1| Arabidopsis thaliana clone U20117 putative ribosomal protein S29
           (At3g44010) mRNA, complete cds
          Length = 202

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 121 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 169



to top

>gb|BT002766.1| Arabidopsis thaliana clone RAFL15-04-A21 (R20117) putative
           ribosomal protein S29 (At3g44010) mRNA, complete cds
          Length = 421

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 189 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 237



to top

>emb|BX826239.1|CNS0A7QD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL93ZC06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 360

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 141 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 189



to top

>emb|BX825609.1|CNS0A7QE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL48ZG03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 460

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 165 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 213



to top

>emb|BX825142.1|CNS0A7PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL15ZD07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 459

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 165 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 213



to top

>emb|BX824534.1|CNS0A7RP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH54ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 394

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| |||||||||||||| ||||| ||||| ||||| ||||||||||
Sbjct: 174 cagtgtttccgtagcaacgctaaggagattggattcattaagtaccgtt 222



to top

>emb|BX841514.1|CNS09YHL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 413

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 142 ttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           |||||||||||||||||||| || || ||||| ||||||||||||
Sbjct: 183 ttccgtagcaacgccaaggaaatcggattcattaagtaccgttga 227



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 57  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 100



to top

>gb|DQ068166.1| Brassica napus isolate mutant Cr3529 clone Bn23 unknown mRNA
          Length = 185

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagt 178
           ||||||||||| ||||||||||| || ||||| ||||||||||
Sbjct: 143 cagtgcttccgcagcaacgccaaagaaattggattcatcaagt 185



to top

>dbj|AK176070.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-81-B04
          Length = 407

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| ||||||||||| |||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaaagccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK175819.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-41-I17
          Length = 407

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| ||||||||||| |||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaaagccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>dbj|AK175731.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-27-J17
          Length = 407

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttga 186
           ||||| ||||||||||| |||||||| || || ||||| ||||||||||||
Sbjct: 172 cagtgtttccgtagcaaagccaaggaaatcggattcattaagtaccgttga 222



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
           ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 52  atgggtcactccaacgtctggaattctcatcctaagaaatacgg 95



to top

>emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 80
          Length = 192861

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 136   cagtgcttccgtagcaacgccaagga 161
             ||||||||||||||||||||||||||
Sbjct: 82479 cagtgcttccgtagcaacgccaagga 82504



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 136   cagtgcttccgtagcaacgccaagga 161
             ||||| ||||||||||||||||||||
Sbjct: 67101 cagtgtttccgtagcaacgccaagga 67076



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 73    atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
             ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 67671 atgggtcactccaacgtctggaattctcatcctaagaaatacgg 67628



to top

>emb|AL031032.1|ATF17I5 Arabidopsis thaliana DNA chromosome 4, BAC clone  F17I5 (ESSA project)
          Length = 86748

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 136   cagtgcttccgtagcaacgccaagga 161
             ||||||||||||||||||||||||||
Sbjct: 33455 cagtgcttccgtagcaacgccaagga 33480



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 136   cagtgcttccgtagcaacgccaagga 161
             ||||| ||||||||||||||||||||
Sbjct: 18077 cagtgtttccgtagcaacgccaagga 18052



 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 73    atgggtcactccaacgtgtggaactcccaccccaagaactacgg 116
             ||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 18647 atgggtcactccaacgtctggaattctcatcctaagaaatacgg 18604



to top

>gb|AC123899.15| Medicago truncatula clone mth2-33n6, complete sequence
          Length = 127126

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 73     atgggtcactccaacgtgtggaactcccaccccaaga 109
              |||||||||||||| ||||||||||| ||||| ||||
Sbjct: 126508 atgggtcactccaatgtgtggaactctcaccctaaga 126472



to top

>gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-22c10, complete
             sequence
          Length = 123020

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 73    atgggtcactccaacgtgtggaactcccaccccaaga 109
             |||||||||||||| ||||||||||| ||||| ||||
Sbjct: 18705 atgggtcactccaatgtgtggaactctcaccctaaga 18669



to top

>emb|CR931730.1| Medicago truncatula chromosome 5 clone  mth2-17o15, COMPLETE
           SEQUENCE
          Length = 89342

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 73  atgggtcactccaacgtgtggaactcccaccccaaga 109
           |||||||||||||| || |||||||| ||||||||||
Sbjct: 130 atgggtcactccaatgtctggaactctcaccccaaga 166



 Score = 44.1 bits (22), Expect = 0.34
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcat 173
           ||||||||||  ||||| |||||||| |||||||||||
Sbjct: 883 cagtgcttccacagcaatgccaaggaaattggcttcat 920



to top

>dbj|AK233927.1| Sus scrofa mRNA, clone:MLN010068H12, expressed in mesenteric lymph
           node
          Length = 308

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 152 acgccaaggatattggcttcatcaagt 178
           |||| ||||||||||||||||||||||
Sbjct: 167 acgcgaaggatattggcttcatcaagt 193



to top

>dbj|AK232797.1| Sus scrofa mRNA, clone:LVRM10028H02, expressed in liver
          Length = 305

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 152 acgccaaggatattggcttcatcaagt 178
           |||| ||||||||||||||||||||||
Sbjct: 167 acgcgaaggatattggcttcatcaagt 193



to top

>dbj|AK235789.1| Sus scrofa mRNA, clone:OVRM10115D09, expressed in ovary
          Length = 307

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 152 acgccaaggatattggcttcatcaagt 178
           |||| ||||||||||||||||||||||
Sbjct: 168 acgcgaaggatattggcttcatcaagt 194



to top

>ref|NM_001001633.1| Sus scrofa 40S ribosomal protein S29 (RPS29), mRNA
 gb|AY550074.1| Sus scrofa 40S ribosomal protein S29 mRNA, complete cds
          Length = 287

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 152 acgccaaggatattggcttcatcaagt 178
           |||| ||||||||||||||||||||||
Sbjct: 137 acgcgaaggatattggcttcatcaagt 163



to top

>dbj|AP002517.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-116P9, complete
              sequences
          Length = 173251

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 228    ttcataaaatatttaatctatgt 250
              |||||||||||||||||||||||
Sbjct: 101862 ttcataaaatatttaatctatgt 101884



to top

>dbj|AB065501.1| Homo sapiens gene for seven transmembrane helix receptor, complete cds,
             isolate:CBRC7TM_64
          Length = 56423

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 228   ttcataaaatatttaatctatgt 250
             |||||||||||||||||||||||
Sbjct: 25346 ttcataaaatatttaatctatgt 25324



to top

>ref|NM_114266.1| Arabidopsis thaliana structural constituent of ribosome (AT3G43980)
           mRNA, complete cds
          Length = 400

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 197 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 250



to top

>gb|AF349528.1| Arabidopsis thaliana putative ribosomal S29 protein (At3g43980)
           mRNA, complete cds
          Length = 221

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 121 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 174



to top

>gb|AF326888.1| Arabidopsis thaliana putative ribosomal S29 protein (At3g43980)
           mRNA, complete cds
          Length = 536

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 179 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 232



to top

>gb|AF361851.1| Arabidopsis thaliana AT3g43980/T15B3_120 mRNA, complete cds
          Length = 379

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 179 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 232



to top

>gb|AY088245.1| Arabidopsis thaliana clone 473 mRNA, complete sequence
          Length = 401

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 198 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 251



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 73  atgggtcactccaacgtgtggaactcccaccccaagaactacggccccggatc 125
           ||||||||||| || || ||||||||||| || ||||| ||||| || |||||
Sbjct: 78  atgggtcactctaatgtatggaactcccatccgaagaagtacggtcctggatc 130



to top

>emb|AL163975.1|ATT15B3 Arabidopsis thaliana DNA chromosome 3, BAC clone T15B3
          Length = 114656

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 136   cagtgcttccgtagcaacgccaaggatattggcttcat 173
             ||||| |||||||||||||| ||||| ||||| |||||
Sbjct: 89979 cagtgtttccgtagcaacgctaaggagattggattcat 89942



to top

>gb|AF324695.2|AF324695 Arabidopsis thaliana AT3g43980 (AT3g43980/T15B3_120) mRNA, complete
           cds
          Length = 483

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 179 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 232



to top

>emb|BX822718.1|CNS0A7T6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB5ZC08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 371

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           ||||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 152 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 205



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 246     tatgtgttttagtagtttgttt 267
               ||||||||||||||||||||||
Sbjct: 4104525 tatgtgttttagtagtttgttt 4104504



to top

>gb|L24003.1|TOMTRALTAC Lycopersicon esculentum (DB113) meloidogyne-induced giant cell
           protein mRNA, 3' end
          Length = 210

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 163 attggcttcatcaagtaccgtt 184
           ||||||||||||||||||||||
Sbjct: 6   attggcttcatcaagtaccgtt 27



to top

>gb|AY129480.1| Arabidopsis thaliana AT3g43980/T15B3_120 mRNA, complete cds
          Length = 171

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 136 cagtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgtt 184
           ||||| ||||| || ||||||||||| || || ||||| ||||||||||
Sbjct: 121 cagtgtttccgcagtaacgccaaggagatcggattcattaagtaccgtt 169



to top

>gb|AC087485.6| Homo sapiens chromosome 15, clone RP11-570N16, complete sequence
          Length = 169771

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 236   atatttaatctatgtgtttta 256
             |||||||||||||||||||||
Sbjct: 51402 atatttaatctatgtgtttta 51422



to top

>emb|BX062216.1|CNS09K64 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 416

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 195 acgccaaggatattggcttca 215



to top

>emb|BX060052.1|CNS09II0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 383

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 194 acgccaaggatattggcttca 214



to top

>emb|BX045283.1|CNS0973R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 396

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 207 acgccaaggatattggcttca 227



to top

>emb|BX039902.1|CNS092YA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 427

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 217 acgccaaggatattggcttca 237



to top

>emb|BX035521.1|CNS08ZKL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 209

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 119 acgccaaggatattggcttca 139



to top

>emb|BX034864.1|CNS08Z2C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 189 acgccaaggatattggcttca 209



to top

>emb|BX032950.1|CNS08XL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 173

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 145 acgccaaggatattggcttca 125



to top

>emb|BX032949.1|CNS08XL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 191 acgccaaggatattggcttca 211



to top

>emb|BX032900.1|CNS08XJS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 164 acgccaaggatattggcttca 144



to top

>emb|BX029858.1|CNS08V7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 211 acgccaaggatattggcttca 231



to top

>emb|BX018990.1|CNS08MTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 199 acgccaaggatattggcttca 219



to top

>emb|BX024653.1|CNS08R6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 353

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 195 acgccaaggatattggcttca 215



to top

>emb|BX021452.1|CNS08OPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 410

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 211 acgccaaggatattggcttca 231



to top

>emb|BX021129.1|CNS08OGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 355

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 144 acgccaaggatattggcttca 164



to top

>emb|BX018131.1|CNS08M5J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 403

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 194 acgccaaggatattggcttca 214



to top

>emb|BX016647.1|CNS08L0B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 409

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 157 acgccaaggatattggcttca 137



to top

>emb|BX014329.1|CNS08J7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 207 acgccaaggatattggcttca 227



to top

>emb|BX013944.1|CNS08IX8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 413

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 195 acgccaaggatattggcttca 215



to top

>emb|BX013193.1|CNS08ICD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 423

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 161 acgccaaggatattggcttca 141



to top

>emb|BX012751.1|CNS08I03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 438

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 169 acgccaaggatattggcttca 149



to top

>emb|BX011385.1|CNS08GY5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 239

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 153 acgccaaggatattggcttca 133



to top

>emb|BX011384.1|CNS08GY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 370

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 190 acgccaaggatattggcttca 210



to top

>emb|BX011210.1|CNS08GTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 287

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 134 acgccaaggatattggcttca 114



to top

>emb|BX011209.1|CNS08GT9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 389

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 204 acgccaaggatattggcttca 224



to top

>emb|BX009526.1|CNS08FII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 420

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 155 acgccaaggatattggcttca 135



to top

>emb|BX008674.1|CNS08EUU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 382

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 190 acgccaaggatattggcttca 210



to top

>emb|BX008492.1|CNS08EPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 422

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 214 acgccaaggatattggcttca 234



to top

>emb|BX007367.1|CNS08DUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 386

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 141 acgccaaggatattggcttca 121



to top

>emb|BX007366.1|CNS08DUI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 212

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 2   acgccaaggatattggcttca 22



to top

>emb|BX007064.1|CNS08DM4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 207 acgccaaggatattggcttca 227



to top

>emb|BX006545.1|CNS08D7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 376

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 144 acgccaaggatattggcttca 124



to top

>emb|BX006544.1|CNS08D7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 198 acgccaaggatattggcttca 218



to top

>emb|BX005506.1|CNS08CEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 344

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 106 acgccaaggatattggcttca 86



to top

>emb|BX005505.1|CNS08CET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 386

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 178 acgccaaggatattggcttca 198



to top

>emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosome, clone 11N17
          Length = 147295

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 152    acgccaaggatattggcttca 172
              |||||||||||||||||||||
Sbjct: 114315 acgccaaggatattggcttca 114295



to top

>gb|AC136896.6| Homo sapiens chromosome 15, clone RP11-860O1, complete sequence
          Length = 214946

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 236   atatttaatctatgtgtttta 256
             |||||||||||||||||||||
Sbjct: 70796 atatttaatctatgtgtttta 70816



to top

>emb|CR381644.8| Zebrafish DNA sequence from clone CH211-80A15 in linkage group 8,
              complete sequence
          Length = 171750

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 243    atctatgtgttttagtagttt 263
              |||||||||||||||||||||
Sbjct: 162109 atctatgtgttttagtagttt 162129



to top

>gb|AC135350.6| Homo sapiens chromosome 15, clone RP13-946E15, complete sequence
          Length = 158316

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 236   atatttaatctatgtgtttta 256
             |||||||||||||||||||||
Sbjct: 60121 atatttaatctatgtgtttta 60101



to top

>emb|BX825823.1|CNS0A6FH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZC02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 412

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 137 agtgcttccgtagcaacgccaaggatattggcttcatcaagtaccgttgaaga 189
           |||| ||||| || ||||||||||| || || ||||| |||||||||| ||||
Sbjct: 126 agtgtttccgcagtaacgccaaggagatcggattcattaagtaccgttaaaga 178



to top

>ref|XM_321509.2| Anopheles gambiae str. PEST ENSANGP00000018161
           (ENSANGG00000015672), partial mRNA
          Length = 371

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 acgccaaggatattggcttca 172
           |||||||||||||||||||||
Sbjct: 212 acgccaaggatattggcttca 232



to top

>gb|AC006602.1|AC006602 Homo sapiens Chromosome 15q11-q13 PAC clone pDJ476i9 from the
             Prader-Willi/Angelman Syndrome region, complete sequence
          Length = 93610

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 236   atatttaatctatgtgtttta 256
             |||||||||||||||||||||
Sbjct: 24171 atatttaatctatgtgtttta 24151



to top

>emb|BX957355.14| Zebrafish DNA sequence from clone CH211-66I15 in linkage group 23,
              complete sequence
          Length = 155581

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 237    tatttaatctatgtgtttta 256
              ||||||||||||||||||||
Sbjct: 113804 tatttaatctatgtgtttta 113785



to top

>gb|CP000453.1| Alkalilimnicola ehrlichei MLHE-1, complete genome
          Length = 3275944

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 89      tgtggaactcccaccccaag 108
               ||||||||||||||||||||
Sbjct: 3174691 tgtggaactcccaccccaag 3174710



to top

>gb|DQ440193.1| Aedes aegypti clone AET-1667 40S ribosomal protein S29 mRNA,
           complete cds
          Length = 171

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 acgccaaggatattggcttc 171
           ||||||||||||||||||||
Sbjct: 137 acgccaaggatattggcttc 156



to top

>gb|AY433152.1| Aedes aegypti ASAP ID: 34225 cytosolic small ribosomal subunit S29
           mRNA sequence
          Length = 368

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 acgccaaggatattggcttc 171
           ||||||||||||||||||||
Sbjct: 167 acgccaaggatattggcttc 186



to top

>ref|XM_712669.1| Candida albicans SC5314 hypothetical protein (CaO19_5387), mRNA
          Length = 4041

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 56  cggaagcggagaagacgatg 75
           ||||||||||||||||||||
Sbjct: 234 cggaagcggagaagacgatg 253



to top

>ref|XM_712668.1| Candida albicans SC5314 hypothetical protein (CaO19_5386), mRNA
          Length = 414

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 56  cggaagcggagaagacgatg 75
           ||||||||||||||||||||
Sbjct: 150 cggaagcggagaagacgatg 131



to top

>ref|XM_712575.1| Candida albicans SC5314 hypothetical protein (CaO19_12842), mRNA
          Length = 4041

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 56  cggaagcggagaagacgatg 75
           ||||||||||||||||||||
Sbjct: 234 cggaagcggagaagacgatg 253



to top

>ref|XM_712574.1| Candida albicans SC5314 hypothetical protein (CaO19_12841), mRNA
          Length = 414

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 56  cggaagcggagaagacgatg 75
           ||||||||||||||||||||
Sbjct: 150 cggaagcggagaagacgatg 131



to top

>gb|DQ401084.1| Chlamydomonas sp. ICE-L ribosomal protein S29 subunit mRNA,
           complete cds
          Length = 735

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 99  ccaccccaagaactacggcc 118
           ||||||||||||||||||||
Sbjct: 76  ccaccccaagaactacggcc 95



to top

>gb|AY305497.1| Eurytemora affinis voucher Eaf elongation factor-2 mRNA, partial
           cds
          Length = 2119

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 154 gccaaggatattggcttcatcaag 177
           ||||||||||||| ||||||||||
Sbjct: 152 gccaaggatattgccttcatcaag 175



to top

>gb|AC007244.2|AC007244 Homo sapiens BAC clone RP11-207L19 from Y, complete sequence
          Length = 184977

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 293    gaggttttggtgagaactgt 312
              ||||||||||||||||||||
Sbjct: 140525 gaggttttggtgagaactgt 140506



to top

>gb|CP000016.1| Candidatus Blochmannia pennsylvanicus str. BPEN, complete genome
          Length = 791654

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 234    aaatatttaatctatgtgttttag 257
              ||||||||||| ||||||||||||
Sbjct: 597760 aaatatttaatgtatgtgttttag 597737



to top

>gb|AF266749.1|AF266749 Culex pipiens quinquefasciatus ribsomal protein S29 mRNA, complete
           cds
          Length = 322

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 acgccaaggatattggcttc 171
           ||||||||||||||||||||
Sbjct: 179 acgccaaggatattggcttc 198



to top

>emb|BX001041.6| Zebrafish DNA sequence from clone CH211-62M7, complete sequence
          Length = 167472

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 237   tatttaatctatgtgtttta 256
             ||||||||||||||||||||
Sbjct: 99017 tatttaatctatgtgtttta 98998



to top

>emb|AL844564.14| Mouse DNA sequence from clone RP23-400D4 on chromosome 11, complete
             sequence
          Length = 196136

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 231   ataaaatatttaatctatgt 250
             ||||||||||||||||||||
Sbjct: 89476 ataaaatatttaatctatgt 89495


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 59,195,753
Number of extensions: 3104966
Number of successful extensions: 227383
Number of sequences better than 10.0: 151
Number of HSP's gapped: 227383
Number of HSP's successfully gapped: 211
Length of query: 369
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 347
Effective length of database: 18,508,616,841
Effective search space: 6422490043827
Effective search space used: 6422490043827
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
to top