ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf103m08 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ244751.1| Zea mays clone 10483 mRNA sequence Length = 753 Score = 648 bits (327), Expect = 0.0 Identities = 396/419 (94%) Strand = Plus / Plus Query: 83 gaagatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgc 142 |||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct: 70 gaagatggtgaagttcctgaagccgggcaaggcggtgatcctgctgcagggcaggtacgc 129 Query: 143 ggggaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacgg 202 |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| Sbjct: 130 cgggaagaaggcggtgatcgtgcgcgtgttcgaggagggcacccgcgaccgcccctacgg 189 Query: 203 ccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggc 262 ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 190 gcactgcctcgtcgccggcctggccaagtacccgaagaaggtgatccgcaaggactcggc 249 Query: 263 gaagaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcaccca 322 |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 250 caagaagacggccaagaagtcccgcgtcaaggtgttcctcaagctcgtcaacttcaccca 309 Query: 323 cctcatgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccc 382 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 310 cctcatgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcgcc 369 Query: 383 cgactccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagct 442 ||||||||||||| |||||||||||||| | ||||| |||| |||||||||||||||| Sbjct: 370 cgactccctcacctccaaggacaagaaggtgggcgccgacaaggccgccaaggccaagct 429 Query: 443 cgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 501 ||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 430 cgaggagcggttcaagaccggcaagaacaggtggtttttcaccaagctccgcttttagg 488 Score = 107 bits (54), Expect = 6e-20 Identities = 126/149 (84%), Gaps = 7/149 (4%) Strand = Plus / Plus Query: 529 cccgaaccctttacatttttagtcgctcgttatcggaaactgttgctgcgctcaagattt 588 ||||||||||||||||||||||| ||| |||||||| |||||||||||||| ||||| | Sbjct: 536 cccgaaccctttacatttttagttgcttgttatcggtgactgttgctgcgcttaagatgt 595 Query: 589 cctgttttggctttggtattgcccgtaaagacta-tgtttttagattggatcttatgaga 647 |||||||| |||||||||| | |||| | | | ||||| |||||||||||||| Sbjct: 596 cctgtttt------ggtattgcccatgaagaagactctgtttagtgtggatcttatgaga 649 Query: 648 tatgatggtggttcatgtgttgaatcatg 676 ||||||| || |||||||||||||||||| Sbjct: 650 tatgatgatgtttcatgtgttgaatcatg 678
>emb|CT832789.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA032O03, full insert sequence Length = 691 Score = 535 bits (270), Expect = e-149 Identities = 377/412 (91%), Gaps = 3/412 (0%) Strand = Plus / Plus Query: 87 atggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcgggg 146 ||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||| Sbjct: 56 atggtgaagtttctcaagcccgggaaggcggtgatcctgctgcaggggaggttcgcgggg 115 Query: 147 aagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggccac 206 ||||||||||||||| || || |||||||||||||||||||||||||||||||||||| Sbjct: 116 cggaaggcggtgatcgtgcgggtgttcgaggagggcacccgcgaccgcccctacggccac 175 Query: 207 tgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaag 266 ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| Sbjct: 176 tgcctcgtcgccggcctcgccaagtaccccaagaaggtgatccgcaaggactcggcgaag 235 Query: 267 aagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacctc 326 |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 236 aagacggcgaagaagtcgcgcgtcaagtgcttcctcaagctcgtcaacttcacccacctc 295 Query: 327 atgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccgac 386 ||||||||||||||||||||||||||||||||||||||||| ||| | || |||||| Sbjct: 296 atgcccacccgctacaccctcgacgtcgacctcaaggaggtcgccgcggg---gcccgac 352 Query: 387 tccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgag 446 | ||| |||||| |||||||||| || ||||| ||||||||||||||| |||||| Sbjct: 353 gcgctcgccaccagggacaagaaggtcgccgcctgcaagtccgccaaggcgcgcctcgag 412 Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 498 || | |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 413 gaccgcttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 464
>ref|NM_001071942.1| Oryza sativa (japonica cultivar-group) Os10g0564300 (Os10g0564300) mRNA, complete cds Length = 720 Score = 535 bits (270), Expect = e-149 Identities = 377/412 (91%), Gaps = 3/412 (0%) Strand = Plus / Plus Query: 87 atggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcgggg 146 ||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||| Sbjct: 54 atggtgaagtttctcaagcccgggaaggcggtgatcctgctgcaggggaggttcgcgggg 113 Query: 147 aagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggccac 206 ||||||||||||||| || || |||||||||||||||||||||||||||||||||||| Sbjct: 114 cggaaggcggtgatcgtgcgggtgttcgaggagggcacccgcgaccgcccctacggccac 173 Query: 207 tgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaag 266 ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| Sbjct: 174 tgcctcgtcgccggcctcgccaagtaccccaagaaggtgatccgcaaggactcggcgaag 233 Query: 267 aagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacctc 326 |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 234 aagacggcgaagaagtcgcgcgtcaagtgcttcctcaagctcgtcaacttcacccacctc 293 Query: 327 atgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccgac 386 ||||||||||||||||||||||||||||||||||||||||| ||| | || |||||| Sbjct: 294 atgcccacccgctacaccctcgacgtcgacctcaaggaggtcgccgcggg---gcccgac 350 Query: 387 tccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgag 446 | ||| |||||| |||||||||| || ||||| ||||||||||||||| |||||| Sbjct: 351 gcgctcgccaccagggacaagaaggtcgccgcctgcaagtccgccaaggcgcgcctcgag 410 Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 498 || | |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 411 gaccgcttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 462
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10 Length = 22685906 Score = 535 bits (270), Expect = e-149 Identities = 377/412 (91%), Gaps = 3/412 (0%) Strand = Plus / Minus Query: 87 atggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcgggg 146 ||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||| Sbjct: 21769752 atggtgaagtttctcaagcccgggaaggcggtgatcctgctgcaggggaggttcgcgggg 21769693 Query: 147 aagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggccac 206 ||||||||||||||| || || |||||||||||||||||||||||||||||||||||| Sbjct: 21769692 cggaaggcggtgatcgtgcgggtgttcgaggagggcacccgcgaccgcccctacggccac 21769633 Query: 207 tgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaag 266 ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| Sbjct: 21769632 tgcctcgtcgccggcctcgccaagtaccccaagaaggtgatccgcaaggactcggcgaag 21769573 Query: 267 aagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacctc 326 |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 21769572 aagacggcgaagaagtcgcgcgtcaagtgcttcctcaagctcgtcaacttcacccacctc 21769513 Query: 327 atgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccgac 386 ||||||||||||||||||||||||||||||||||||||||| ||| | || |||||| Sbjct: 21769512 atgcccacccgctacaccctcgacgtcgacctcaaggaggtcgccgcggg---gcccgac 21769456 Query: 387 tccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgag 446 | ||| |||||| |||||||||| || ||||| ||||||||||||||| |||||| Sbjct: 21769455 gcgctcgccaccagggacaagaaggtcgccgcctgcaagtccgccaaggcgcgcctcgag 21769396 Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 498 || | |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21769395 gaccgcttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 21769344
>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete sequence Length = 141307 Score = 535 bits (270), Expect = e-149 Identities = 377/412 (91%), Gaps = 3/412 (0%) Strand = Plus / Minus Query: 87 atggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcgggg 146 ||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||| Sbjct: 84435 atggtgaagtttctcaagcccgggaaggcggtgatcctgctgcaggggaggttcgcgggg 84376 Query: 147 aagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggccac 206 ||||||||||||||| || || |||||||||||||||||||||||||||||||||||| Sbjct: 84375 cggaaggcggtgatcgtgcgggtgttcgaggagggcacccgcgaccgcccctacggccac 84316 Query: 207 tgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaag 266 ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| Sbjct: 84315 tgcctcgtcgccggcctcgccaagtaccccaagaaggtgatccgcaaggactcggcgaag 84256 Query: 267 aagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacctc 326 |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 84255 aagacggcgaagaagtcgcgcgtcaagtgcttcctcaagctcgtcaacttcacccacctc 84196 Query: 327 atgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccgac 386 ||||||||||||||||||||||||||||||||||||||||| ||| | || |||||| Sbjct: 84195 atgcccacccgctacaccctcgacgtcgacctcaaggaggtcgccgcggg---gcccgac 84139 Query: 387 tccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgag 446 | ||| |||||| |||||||||| || ||||| ||||||||||||||| |||||| Sbjct: 84138 gcgctcgccaccagggacaagaaggtcgccgcctgcaagtccgccaaggcgcgcctcgag 84079 Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 498 || | |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 84078 gaccgcttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 84027
>dbj|AK066340.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013064A22, full insert sequence Length = 723 Score = 535 bits (270), Expect = e-149 Identities = 377/412 (91%), Gaps = 3/412 (0%) Strand = Plus / Plus Query: 87 atggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcgggg 146 ||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||| Sbjct: 55 atggtgaagtttctcaagcccgggaaggcggtgatcctgctgcaggggaggttcgcgggg 114 Query: 147 aagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggccac 206 ||||||||||||||| || || |||||||||||||||||||||||||||||||||||| Sbjct: 115 cggaaggcggtgatcgtgcgggtgttcgaggagggcacccgcgaccgcccctacggccac 174 Query: 207 tgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaag 266 ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| Sbjct: 175 tgcctcgtcgccggcctcgccaagtaccccaagaaggtgatccgcaaggactcggcgaag 234 Query: 267 aagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacctc 326 |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 235 aagacggcgaagaagtcgcgcgtcaagtgcttcctcaagctcgtcaacttcacccacctc 294 Query: 327 atgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccgac 386 ||||||||||||||||||||||||||||||||||||||||| ||| | || |||||| Sbjct: 295 atgcccacccgctacaccctcgacgtcgacctcaaggaggtcgccgcggg---gcccgac 351 Query: 387 tccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgag 446 | ||| |||||| |||||||||| || ||||| ||||||||||||||| |||||| Sbjct: 352 gcgctcgccaccagggacaagaaggtcgccgcctgcaagtccgccaaggcgcgcctcgag 411 Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 498 || | |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 412 gaccgcttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct 463
>emb|CT833910.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA048D01, full insert sequence Length = 717 Score = 523 bits (264), Expect = e-145 Identities = 378/416 (90%) Strand = Plus / Plus Query: 86 gatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcggg 145 ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 104 gatggtgaagttcctgaagccggggaaggcggtgatcctgctgcaggggcggtacgcggg 163 Query: 146 gaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggcca 205 | ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 164 gcggaaggcggtgatcgtgcgcgtgttcgaggagggcacccgtgaccgcccctacggcca 223 Query: 206 ctgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaa 265 |||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| Sbjct: 224 ctgcctcgtcgccggcctcgccaagtacccgaagaaggtgatccgcaaggactcggcgaa 283 Query: 266 gaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacct 325 ||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||| | Sbjct: 284 gaagacggcgaagaagtcgagggtcaagtgcttcctcaagctcgtcaacttcacccacat 343 Query: 326 catgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccga 385 ||||||||||||||||||||||||||||||| ||||||| ||||||||||| | ||||| Sbjct: 344 catgcccacccgctacaccctcgacgtcgacttcaaggacgtggcctccgggggacccga 403 Query: 386 ctccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcga 445 | ||||| ||||| ||||||||| | ||||| |||| |||||||||| ||||| Sbjct: 404 cgccctcgccacccgcgacaagaaggtggccgcctgcaaggccgccaaggctcgcctcga 463 Query: 446 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 464 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 519
>ref|NM_001053105.1| Oryza sativa (japonica cultivar-group) Os02g0284600 (Os02g0284600) mRNA, complete cds Length = 688 Score = 523 bits (264), Expect = e-145 Identities = 378/416 (90%) Strand = Plus / Plus Query: 86 gatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcggg 145 ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 109 gatggtgaagttcctgaagccggggaaggcggtgatcctgctgcaggggcggtacgcggg 168 Query: 146 gaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggcca 205 | ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 169 gcggaaggcggtgatcgtgcgcgtgttcgaggagggcacccgtgaccgcccctacggcca 228 Query: 206 ctgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaa 265 |||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| Sbjct: 229 ctgcctcgtcgccggcctcgccaagtacccgaagaaggtgatccgcaaggactcggcgaa 288 Query: 266 gaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacct 325 ||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||| | Sbjct: 289 gaagacggcgaagaagtcgagggtcaagtgcttcctcaagctcgtcaacttcacccacat 348 Query: 326 catgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccga 385 ||||||||||||||||||||||||||||||| ||||||| ||||||||||| | ||||| Sbjct: 349 catgcccacccgctacaccctcgacgtcgacttcaaggacgtggcctccgggggacccga 408 Query: 386 ctccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcga 445 | ||||| ||||| ||||||||| | ||||| |||| |||||||||| ||||| Sbjct: 409 cgccctcgccacccgcgacaagaaggtggccgcctgcaaggccgccaaggctcgcctcga 468 Query: 446 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 469 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 524
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2 Length = 35954743 Score = 523 bits (264), Expect = e-145 Identities = 378/416 (90%) Strand = Plus / Minus Query: 86 gatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcggg 145 ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 10700506 gatggtgaagttcctgaagccggggaaggcggtgatcctgctgcaggggcggtacgcggg 10700447 Query: 146 gaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggcca 205 | ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 10700446 gcggaaggcggtgatcgtgcgcgtgttcgaggagggcacccgtgaccgcccctacggcca 10700387 Query: 206 ctgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaa 265 |||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| Sbjct: 10700386 ctgcctcgtcgccggcctcgccaagtacccgaagaaggtgatccgcaaggactcggcgaa 10700327 Query: 266 gaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacct 325 ||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||| | Sbjct: 10700326 gaagacggcgaagaagtcgagggtcaagtgcttcctcaagctcgtcaacttcacccacat 10700267 Query: 326 catgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccga 385 ||||||||||||||||||||||||||||||| ||||||| ||||||||||| | ||||| Sbjct: 10700266 catgcccacccgctacaccctcgacgtcgacttcaaggacgtggcctccgggggacccga 10700207 Query: 386 ctccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcga 445 | ||||| ||||| ||||||||| | ||||| |||| |||||||||| ||||| Sbjct: 10700206 cgccctcgccacccgcgacaagaaggtggccgcctgcaaggccgccaaggctcgcctcga 10700147 Query: 446 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 10700146 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 10700091
>dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0018M09 Length = 157377 Score = 523 bits (264), Expect = e-145 Identities = 378/416 (90%) Strand = Plus / Minus Query: 86 gatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcggg 145 ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 118196 gatggtgaagttcctgaagccggggaaggcggtgatcctgctgcaggggcggtacgcggg 118137 Query: 146 gaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggcca 205 | ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 118136 gcggaaggcggtgatcgtgcgcgtgttcgaggagggcacccgtgaccgcccctacggcca 118077 Query: 206 ctgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaa 265 |||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| Sbjct: 118076 ctgcctcgtcgccggcctcgccaagtacccgaagaaggtgatccgcaaggactcggcgaa 118017 Query: 266 gaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacct 325 ||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||| | Sbjct: 118016 gaagacggcgaagaagtcgagggtcaagtgcttcctcaagctcgtcaacttcacccacat 117957 Query: 326 catgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccga 385 ||||||||||||||||||||||||||||||| ||||||| ||||||||||| | ||||| Sbjct: 117956 catgcccacccgctacaccctcgacgtcgacttcaaggacgtggcctccgggggacccga 117897 Query: 386 ctccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcga 445 | ||||| ||||| ||||||||| | ||||| |||| |||||||||| ||||| Sbjct: 117896 cgccctcgccacccgcgacaagaaggtggccgcctgcaaggccgccaaggctcgcctcga 117837 Query: 446 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 117836 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 117781
>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1115_D03 Length = 169378 Score = 523 bits (264), Expect = e-145 Identities = 378/416 (90%) Strand = Plus / Minus Query: 86 gatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcggg 145 ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 39987 gatggtgaagttcctgaagccggggaaggcggtgatcctgctgcaggggcggtacgcggg 39928 Query: 146 gaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggcca 205 | ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 39927 gcggaaggcggtgatcgtgcgcgtgttcgaggagggcacccgtgaccgcccctacggcca 39868 Query: 206 ctgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaa 265 |||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| Sbjct: 39867 ctgcctcgtcgccggcctcgccaagtacccgaagaaggtgatccgcaaggactcggcgaa 39808 Query: 266 gaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacct 325 ||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||| | Sbjct: 39807 gaagacggcgaagaagtcgagggtcaagtgcttcctcaagctcgtcaacttcacccacat 39748 Query: 326 catgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccga 385 ||||||||||||||||||||||||||||||| ||||||| ||||||||||| | ||||| Sbjct: 39747 catgcccacccgctacaccctcgacgtcgacttcaaggacgtggcctccgggggacccga 39688 Query: 386 ctccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcga 445 | ||||| ||||| ||||||||| | ||||| |||| |||||||||| ||||| Sbjct: 39687 cgccctcgccacccgcgacaagaaggtggccgcctgcaaggccgccaaggctcgcctcga 39628 Query: 446 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 39627 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 39572
>dbj|AK121593.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033038C19, full insert sequence Length = 689 Score = 523 bits (264), Expect = e-145 Identities = 378/416 (90%) Strand = Plus / Plus Query: 86 gatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcggg 145 ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 110 gatggtgaagttcctgaagccggggaaggcggtgatcctgctgcaggggcggtacgcggg 169 Query: 146 gaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggcca 205 | ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 170 gcggaaggcggtgatcgtgcgcgtgttcgaggagggcacccgtgaccgcccctacggcca 229 Query: 206 ctgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaa 265 |||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||| Sbjct: 230 ctgcctcgtcgccggcctcgccaagtacccgaagaaggtgatccgcaaggactcggcgaa 289 Query: 266 gaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacct 325 ||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||| | Sbjct: 290 gaagacggcgaagaagtcgagggtcaagtgcttcctcaagctcgtcaacttcacccacat 349 Query: 326 catgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccga 385 ||||||||||||||||||||||||||||||| ||||||| ||||||||||| | ||||| Sbjct: 350 catgcccacccgctacaccctcgacgtcgacttcaaggacgtggcctccgggggacccga 409 Query: 386 ctccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcga 445 | ||||| ||||| ||||||||| | ||||| |||| |||||||||| ||||| Sbjct: 410 cgccctcgccacccgcgacaagaaggtggccgcctgcaaggccgccaaggctcgcctcga 469 Query: 446 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 470 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctagg 525
>gb|BT016577.1| Zea mays clone Contig410 mRNA sequence Length = 724 Score = 482 bits (243), Expect = e-132 Identities = 372/415 (89%) Strand = Plus / Plus Query: 86 gatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgcggg 145 |||||||||||||||||||||||| ||||| |||||||| ||||||||| ||| ||| || Sbjct: 40 gatggtgaagttcctcaagcccggcaaggccgtgatcctcctgcagggccggttcgccgg 99 Query: 146 gaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacggcca 205 | |||||| | |||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct: 100 caggaaggcagagatcgtgcgcgtgttcgaggagggcacccgcgaccgcccctacggcca 159 Query: 206 ctgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggcgaa 265 |||||||||||||||||| || |||||||||||||||||| |||||| ||||||||| || Sbjct: 160 ctgcctcgtcgccggcctcgccaagtaccccaagaaggtggtccgcagggactcggccaa 219 Query: 266 gaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcacccacct 325 ||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||| Sbjct: 220 gaagacggcgaagaagtcgcgcgtcaagtgcttcatcaagctcgtcaacttcacccacct 279 Query: 326 catgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccccga 385 ||||||||||||||||||||||||||||||| ||||||| |||||| |||||| ||||| Sbjct: 280 catgcccacccgctacaccctcgacgtcgacttcaaggacgtggccaccggcgggcccga 339 Query: 386 ctccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagctcga 445 | | ||| ||||| ||||||||| || |||| |||| |||||||||| ||||| Sbjct: 340 cgcgctctccacccgcgacaagaaggtcgccgcatgcaaggccgccaaggcgcgcctcga 399 Query: 446 ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctag 500 |||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 400 ggagaggttcaagaccggcaagaacaggtggttctttaccaagctccgcttctag 454
>dbj|AK240923.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J065039E11, full insert sequence Length = 2492 Score = 456 bits (230), Expect = e-125 Identities = 331/364 (90%), Gaps = 3/364 (0%) Strand = Plus / Plus Query: 135 aggtacgcggggaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgc 194 |||| ||||||| ||||||||||||||| || || |||||||||||||||||||||||| Sbjct: 1970 aggttcgcggggcggaaggcggtgatcgtgcgggtgttcgaggagggcacccgcgaccgc 2029 Query: 195 ccctacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaag 254 ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| Sbjct: 2030 ccctacggccactgcctcgtcgccggcctcgccaagtaccccaagaaggtgatccgcaag 2089 Query: 255 gactcggcgaagaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaac 314 |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| Sbjct: 2090 gactcggcgaagaagacggcgaagaagtcgcgcgtcaagtgcttcctcaagctcgtcaac 2149 Query: 315 ttcacccacctcatgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctcc 374 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | Sbjct: 2150 ttcacccacctcatgcccacccgctacaccctcgacgtcgacctcaaggaggtcgccgcg 2209 Query: 375 ggcgcccccgactccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaag 434 || |||||| | ||| |||||| |||||||||| || ||||| ||||||||||||| Sbjct: 2210 gg---gcccgacgcgctcgccaccagggacaagaaggtcgccgcctgcaagtccgccaag 2266 Query: 435 gccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgc 494 || |||||||| | |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2267 gcgcgcctcgaggaccgcttcaagaccggcaagaacaggtggttcttcaccaagctccgc 2326 Query: 495 ttct 498 |||| Sbjct: 2327 ttct 2330
>gb|AY104535.1| Zea mays PCO094675 mRNA sequence Length = 995 Score = 392 bits (198), Expect = e-106 Identities = 363/418 (86%) Strand = Plus / Plus Query: 83 gaagatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgc 142 ||||||||||||||||||||||||||| ||||| || ||||| || |||||| | | ||| Sbjct: 61 gaagatggtgaagttcctcaagcccggcaaggccgttatcctcctccagggccgcttcgc 120 Query: 143 ggggaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacgg 202 || | |||||| || ||||| ||||| ||||||||||||||||||||||||||||| || Sbjct: 121 cggcaggaaggcagttatcgtgcgcgtgttcgaggagggcacccgcgaccgcccctatgg 180 Query: 203 ccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggc 262 ||||||||||||||| ||||| || |||||||| ||||||||||||||||||||||| || Sbjct: 181 ccactgcctcgtcgcaggcctcgccaagtacccaaagaaggtgatccgcaaggactccgc 240 Query: 263 gaagaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcaccca 322 |||||||| || |||||||||||||||||| |||| ||||||||||||||||||| || Sbjct: 241 caagaagactgcgaagaagtcgcgcgtcaagtgcttcatcaagctcgtcaacttcactca 300 Query: 323 cctcatgcccacccgctacaccctcgacgtcgacctcaaggaggtggcctccggcgcccc 382 ||||||||||||||||||||||||||||||||| ||||||| || ||| |||| | || Sbjct: 301 cctcatgcccacccgctacaccctcgacgtcgatttcaaggatgtcgccaccggtgggcc 360 Query: 383 cgactccctcaccaccaaggacaagaagctcaccgccgccaagtccgccaaggccaagct 442 |||| | ||| | ||| | ||||||||| || ||||| |||| | ||||| || || Sbjct: 361 cgacgcactctctacccacgacaagaaggtcgccgcctgcaagacggccaaagcgcgcct 420 Query: 443 cgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctag 500 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 421 tgaggagaggttcaagaccggcaagaacaggtggttctttaccaagctccgcttctag 478
>gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA sequence Length = 537 Score = 357 bits (180), Expect = 4e-95 Identities = 291/328 (88%) Strand = Plus / Plus Query: 174 gaggagggcacccgcgaccgcccctacggccactgcctcgtcgccggcctggcgaagtac 233 |||||||||||||||||||| ||||| || ||||||||||||||||||||||| |||||| Sbjct: 9 gaggagggcacccgcgaccgtccctatgggcactgcctcgtcgccggcctggccaagtac 68 Query: 234 cccaagaaggtgatccgcaaggactcggcgaagaagacggccaagaagtcgcgcgtcaag 293 |||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||| Sbjct: 69 cccaagaaggtgatccgcaaggactccgccaagaagacggccaagaagtcccgcgtcaag 128 Query: 294 gtcttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcgacgtc 353 |||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct: 129 tgcttcatcaagctcgtcaatttcactcacctcatgcccacccgctacaccctcgacgtc 188 Query: 354 gacctcaaggaggtggcctccggcgcccccgactccctcaccaccaaggacaagaagctc 413 ||| ||||||| || || || |||| |||||| | ||| ||||| |||||||||| || Sbjct: 189 gacttcaaggacgtcgcatcgggcgggcccgacgcgctctccacccgggacaagaaggtc 248 Query: 414 accgccgccaagtccgccaaggccaagctcgaggagaggttcaagaccggcaagaacagg 473 ||| |||| |||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 249 gaagcctgcaaggccgccaaggcgcgcctcgaggagaggttcaagaccggcaagaacagg 308 Query: 474 tggttcttcaccaagctccgcttctagg 501 |||||||| |||||||||||||| |||| Sbjct: 309 tggttctttaccaagctccgcttttagg 336
>emb|CT983933.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 810 Score = 210 bits (106), Expect = 6e-51 Identities = 238/282 (84%) Strand = Plus / Plus Query: 83 gaagatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgc 142 |||||||||||||||||| ||||||||||||||||||||| |||| |||||| ||||||| Sbjct: 214 gaagatggtgaagttcctgaagcccgggaaggcggtgatcgtgctccagggccggtacgc 273 Query: 143 ggggaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacgg 202 || |||||| || ||| |||| |||||| || ||||| || |||||||||||||| Sbjct: 274 cggccggaaggccgtcatcatccggaacttcgacgacggcacgcgggaccgcccctacgg 333 Query: 203 ccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggc 262 |||||||||||||||||| | ||||||||| | ||||| ||| ||||||||||| Sbjct: 334 ccactgcctcgtcgccgggatcaagaagtacccgagcaaggtcatcaagaaggactcggc 393 Query: 263 gaagaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcaccca 322 ||||||||||||||||||||||| || ||| ||| | ||||||||||||| | || Sbjct: 394 caagaagacggccaagaagtcgcgggtgaagacgttcgtgaagctcgtcaactaccggca 453 Query: 323 cctcatgcccacccgctacaccctcgacgtcgacctcaagga 364 ||| |||||||||||||||||||||||||| ||||||||||| Sbjct: 454 cctgatgcccacccgctacaccctcgacgtggacctcaagga 495 Score = 99.6 bits (50), Expect = 2e-17 Identities = 83/94 (88%) Strand = Plus / Plus Query: 398 caaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgaggagaggttcaa 457 ||||||||||||| |||||||||||||| ||||| | |||||||||||||||||| Sbjct: 523 caaggacaagaaggtcaccgccgccaaggagaccaagaagaggctcgaggagaggttcaa 582 Query: 458 gaccggcaagaacaggtggttcttcaccaagctc 491 ||| |||||||||||||||||||| ||||||||| Sbjct: 583 gacgggcaagaacaggtggttctttaccaagctc 616
>emb|CT983771.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 665 Score = 210 bits (106), Expect = 6e-51 Identities = 238/282 (84%) Strand = Plus / Plus Query: 83 gaagatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgc 142 |||||||||||||||||| ||||||||||||||||||||| |||| |||||| ||||||| Sbjct: 72 gaagatggtgaagttcctgaagcccgggaaggcggtgatcgtgctccagggccggtacgc 131 Query: 143 ggggaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacgg 202 || |||||| || ||| |||| |||||| || ||||| || |||||||||||||| Sbjct: 132 cggccggaaggccgtcatcatccggaacttcgacgacggcacgcgggaccgcccctacgg 191 Query: 203 ccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggc 262 |||||||||||||||||| | ||||||||| | ||||| ||| ||||||||||| Sbjct: 192 ccactgcctcgtcgccgggatcaagaagtacccgagcaaggtcatcaagaaggactcggc 251 Query: 263 gaagaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcaccca 322 ||||||||||||||||||||||| || ||| ||| | ||||||||||||| | || Sbjct: 252 caagaagacggccaagaagtcgcgggtgaagacgttcgtgaagctcgtcaactaccggca 311 Query: 323 cctcatgcccacccgctacaccctcgacgtcgacctcaagga 364 ||| |||||||||||||||||||||||||| ||||||||||| Sbjct: 312 cctgatgcccacccgctacaccctcgacgtggacctcaagga 353 Score = 83.8 bits (42), Expect = 9e-13 Identities = 81/94 (86%) Strand = Plus / Plus Query: 398 caaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgaggagaggttcaa 457 ||||||||||||| |||||||||||||| ||||| | |||||||||||||||||| Sbjct: 381 caaggacaagaaggtcaccgccgccaaggagaccaagaagaggctcgaggagaggttcaa 440 Query: 458 gaccggcaagaacaggtggttcttcaccaagctc 491 ||| |||||||||| |||||||| ||||||||| Sbjct: 441 gacgagcaagaacagatggttctttaccaagctc 474
>emb|CT983749.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 813 Score = 210 bits (106), Expect = 6e-51 Identities = 238/282 (84%) Strand = Plus / Plus Query: 83 gaagatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgc 142 |||||||||||||||||| ||||||||||||||||||||| |||| |||||| ||||||| Sbjct: 214 gaagatggtgaagttcctgaagcccgggaaggcggtgatcgtgctccagggccggtacgc 273 Query: 143 ggggaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacgg 202 || |||||| || ||| |||| |||||| || ||||| || |||||||||||||| Sbjct: 274 cggccggaaggccgtcatcatccggaacttcgacgacggcacgcgggaccgcccctacgg 333 Query: 203 ccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggc 262 |||||||||||||||||| | ||||||||| | ||||| ||| ||||||||||| Sbjct: 334 ccactgcctcgtcgccgggatcaagaagtacccgagcaaggtcatcaagaaggactcggc 393 Query: 263 gaagaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcaccca 322 ||||||||||||||||||||||| || ||| ||| | ||||||||||||| | || Sbjct: 394 caagaagacggccaagaagtcgcgggtgaagacgttcgtgaagctcgtcaactaccggca 453 Query: 323 cctcatgcccacccgctacaccctcgacgtcgacctcaagga 364 ||| |||||||||||||||||||||||||| ||||||||||| Sbjct: 454 cctgatgcccacccgctacaccctcgacgtggacctcaagga 495 Score = 99.6 bits (50), Expect = 2e-17 Identities = 83/94 (88%) Strand = Plus / Plus Query: 398 caaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgaggagaggttcaa 457 ||||||||||||| |||||||||||||| ||||| | |||||||||||||||||| Sbjct: 523 caaggacaagaaggtcaccgccgccaaggagaccaagaagaggctcgaggagaggttcaa 582 Query: 458 gaccggcaagaacaggtggttcttcaccaagctc 491 ||| |||||||||||||||||||| ||||||||| Sbjct: 583 gacgggcaagaacaggtggttctttaccaagctc 616
>emb|CT981203.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 665 Score = 210 bits (106), Expect = 6e-51 Identities = 238/282 (84%) Strand = Plus / Plus Query: 83 gaagatggtgaagttcctcaagcccgggaaggcggtgatcctgctgcagggcaggtacgc 142 |||||||||||||||||| ||||||||||||||||||||| |||| |||||| ||||||| Sbjct: 72 gaagatggtgaagttcctgaagcccgggaaggcggtgatcgtgctccagggccggtacgc 131 Query: 143 ggggaagaaggcggtgatcgtccgcgtcttcgaggagggcacccgcgaccgcccctacgg 202 || |||||| || ||| |||| |||||| || ||||| || |||||||||||||| Sbjct: 132 cggccggaaggccgtcatcatccggaacttcgacgacggcacgcgggaccgcccctacgg 191 Query: 203 ccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggactcggc 262 |||||||||||||||||| | ||||||||| | ||||| ||| ||||||||||| Sbjct: 192 ccactgcctcgtcgccgggatcaagaagtacccgagcaaggtcatcaagaaggactcggc 251 Query: 263 gaagaagacggccaagaagtcgcgcgtcaaggtcttcctcaagctcgtcaacttcaccca 322 ||||||||||||||||||||||| || ||| ||| | ||||||||||||| | || Sbjct: 252 caagaagacggccaagaagtcgcgggtgaagacgttcgtgaagctcgtcaactaccggca 311 Query: 323 cctcatgcccacccgctacaccctcgacgtcgacctcaagga 364 ||| |||||||||||||||||||||||||| ||||||||||| Sbjct: 312 cctgatgcccacccgctacaccctcgacgtggacctcaagga 353 Score = 91.7 bits (46), Expect = 4e-15 Identities = 82/94 (87%) Strand = Plus / Plus Query: 398 caaggacaagaagctcaccgccgccaagtccgccaaggccaagctcgaggagaggttcaa 457 ||||||||||||| |||||||||||||| ||||| | |||||||||||||||||| Sbjct: 381 caaggacaagaaggtcaccgccgccaaggagaccaagaagaggctcgaggagaggttcaa 440 Query: 458 gaccggcaagaacaggtggttcttcaccaagctc 491 ||| ||||||||||| |||||||| ||||||||| Sbjct: 441 gacgggcaagaacagatggttctttaccaagctc 474
>emb|X68202.1|CSL27 C.stellata mRNA for ribosomal protein L27 Length = 485 Score = 95.6 bits (48), Expect = 2e-16 Identities = 54/56 (96%) Strand = Plus / Plus Query: 444 gaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 372 gaggagaagttcaagaccggcaagaacaggtggttcttcaccaagctgcgcttcta 427 Score = 54.0 bits (27), Expect = 8e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 309 gtcaacttcacccacctcatgcccacccgctacaccctcgacgtcgacctcaagg 363 ||||||| || |||||| |||||||||||||||||||| || || ||| |||||| Sbjct: 246 gtcaactacaaccacctgatgcccacccgctacaccctggatgtggacttcaagg 300
>gb|DQ886845.1| Argas monolakensis 60S ribosomal protein L27 mRNA, complete cds Length = 411 Score = 73.8 bits (37), Expect = 9e-10 Identities = 61/69 (88%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||||||| |||||||| | | ||||| ||| ||||||| |||||||||||||||||| Sbjct: 343 aaggccaagttcgaggagcgctacaagagcgggaagaacaagtggttcttcaccaagctg 402 Query: 492 cgcttctag 500 ||||||||| Sbjct: 403 cgcttctag 411
>dbj|AK228394.1| Arabidopsis thaliana mRNA for ribosomal protein, complete cds, clone: RAFL14-88-C08 Length = 662 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 403 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 462 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 175 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 234 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 235 tcagctaagaagacagctaagaa 257
>gb|DQ226702.1| Boechera divaricarpa isolate SLW-A-H01 mRNA sequence Length = 379 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||| | |||||||| || ||||||||||||||||||||||||||| Sbjct: 156 aaggctaagcttgaggagcgtttcaagactgggaagaacaggtggttcttcaccaagctc 215
>ref|NM_117587.2| Arabidopsis thaliana structural constituent of ribosome (AT4G15000) mRNA, complete cds Length = 657 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 403 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 462 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 175 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 234 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 235 tcagctaagaagacagctaagaa 257
>gb|AY096731.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA, complete cds Length = 439 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 340 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 399 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 112 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 171 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 172 tcagctaagaagacagctaagaa 194
>gb|AY063987.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA, complete cds Length = 640 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 403 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 462 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 175 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 234 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 235 tcagctaagaagacagctaagaa 257
>emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 2 Length = 202860 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 137302 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 137361 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 137074 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 137133 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 137134 tcagctaagaagacagctaagaa 137156
>gb|AY085487.1| Arabidopsis thaliana clone 15384 mRNA, complete sequence Length = 631 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||||||||||||||| || |||||||| |||||||| ||||||||| Sbjct: 401 aaggctaagcttgaggagaggttcaagactggtaagaacagatggttctttaccaagctc 460 Score = 54.0 bits (27), Expect = 8e-04 Identities = 69/83 (83%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 173 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 232 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 233 tcagctaagaagacagctaagaa 255
>emb|BX827228.1|CNS0A2SV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS23ZG03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 625 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 379 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 438 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 151 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 210 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 211 tcagctaagaagacagctaagaa 233
>emb|BX827216.1|CNS0A2RL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS22ZD04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 625 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 379 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 438 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 151 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 210 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 211 tcagctaagaagacagctaagaa 233
>emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 40 Length = 197405 Score = 71.9 bits (36), Expect = 3e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||| Sbjct: 82756 aaggctaagcttgaggagaggttcaaaaccggtaagaacagatggttctttaccaagctc 82815 Score = 46.1 bits (23), Expect = 0.19 Identities = 68/83 (81%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| || ||||||||| | || || |||||||| ||| Sbjct: 82528 tacggacactgcctcgtcgccggactcaagaagtacccgagcaaagtcatccgcaaagac 82587 Query: 258 tcggcgaagaagacggccaagaa 280 || || |||||||| || ||||| Sbjct: 82588 tcagctaagaagacagctaagaa 82610
>ref|NM_113120.2| Arabidopsis thaliana structural constituent of ribosome (AT3G22230) mRNA, complete cds Length = 631 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 166 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 225 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 226 tcagcgaagaagacggcgaagaa 248 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 394 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 453
>gb|AY091218.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 439 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 112 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 171 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 172 tcagcgaagaagacggcgaagaa 194 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 340 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 399
>gb|AY063860.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 577 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 128 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 187 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 188 tcagcgaagaagacggcgaagaa 210 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 356 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 415
>gb|AY136321.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 631 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 166 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 225 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 226 tcagcgaagaagacggcgaagaa 248 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 394 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 453
>gb|AY093389.1| Arabidopsis thaliana 60S ribosomal protein L27 (MKA23.13) mRNA, complete cds Length = 503 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 112 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 171 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 172 tcagcgaagaagacggcgaagaa 194 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 340 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 399
>gb|AY062617.1| Arabidopsis thaliana 60S ribosomal protein L27 (MKA23.13) mRNA, complete cds Length = 567 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 128 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 187 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 188 tcagcgaagaagacggcgaagaa 210 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 356 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 415
>gb|AY086536.1| Arabidopsis thaliana clone 25631 mRNA, complete sequence Length = 577 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 128 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 187 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 188 tccgcgaagaagacggcgaagaa 210 Score = 46.1 bits (23), Expect = 0.19 Identities = 35/39 (89%) Strand = Plus / Plus Query: 453 ttcaagaccggcaagaacaggtggttcttcaccaagctc 491 |||||||| || ||||||||||||||||| || |||||| Sbjct: 377 ttcaagactggtaagaacaggtggttctttactaagctc 415
>dbj|AP001306.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MKA23 Length = 70100 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Minus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 52989 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 52930 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 52929 tcagcgaagaagacggcgaagaa 52907 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Minus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 52761 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 52702
>emb|BX822979.1|CNS0A73W Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZE05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 552 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 102 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 161 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 162 tcagcgaagaagacggcgaagaa 184 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 330 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 389
>gb|BT014180.1| Lycopersicon esculentum clone 133344F, mRNA sequence Length = 640 Score = 67.9 bits (34), Expect = 5e-08 Identities = 100/122 (81%) Strand = Plus / Plus Query: 228 aagtaccccaagaaggtgatccgcaaggactcggcgaagaagacggccaagaagtcgcgc 287 |||||||| |||||||||||||||||||| || || |||||| ||| ||||| || || Sbjct: 180 aagtacccgaagaaggtgatccgcaaggattcagcaaagaagcaggcgaagaaatctcgt 239 Query: 288 gtcaaggtcttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctc 347 || |||| ||| |||||||||| |||| || |||| ||||||| || || ||||| ||| Sbjct: 240 gttaaggctttcatcaagctcgtgaactacaaccacatcatgcctactcgttacacactc 299 Query: 348 ga 349 || Sbjct: 300 ga 301 Score = 50.1 bits (25), Expect = 0.012 Identities = 52/61 (85%) Strand = Plus / Plus Query: 430 ccaaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagc 489 ||||||| | ||| |||||||||||||||||||| || || | |||||||| ||||||| Sbjct: 376 ccaaggctaggcttgaggagaggttcaagaccgggaaaaatcgctggttctttaccaagc 435 Query: 490 t 490 | Sbjct: 436 t 436
>dbj|AB043975.1| Panax ginseng mRNA for ribosomal protein L27, complete cds Length = 649 Score = 67.9 bits (34), Expect = 5e-08 Identities = 94/114 (82%) Strand = Plus / Plus Query: 171 ttcgaggagggcacccgcgaccgcccctacggccactgcctcgtcgccggcctggcgaag 230 ||||| ||||| ||||| |||||||| ||||| ||||| | || ||||| | | ||| Sbjct: 97 ttcgacgagggaacccgagaccgcccgtacggacactgtttggttgccggaatatccaag 156 Query: 231 taccccaagaaggtgatccgcaaggactcggcgaagaagacggccaagaagtcg 284 ||||| ||||||||||| | || |||||||||||||||||||| ||||||||| Sbjct: 157 tacccgaagaaggtgataaggaaagactcggcgaagaagacggcgaagaagtcg 210
>gb|AF401581.1| Ictalurus punctatus ribosomal protein L27 mRNA, complete cds Length = 469 Score = 65.9 bits (33), Expect = 2e-07 Identities = 63/73 (86%) Strand = Plus / Plus Query: 429 gccaaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaag 488 ||||||| |||| | |||||||||| ||||||||||||||||| ||||||||| ||| Sbjct: 359 gccaaggtcaagtttgaggagaggtacaagaccggcaagaacaaatggttcttccagaag 418 Query: 489 ctccgcttctagg 501 ||||| ||||||| Sbjct: 419 ctccgattctagg 431
>ref|NM_128781.2| Arabidopsis thaliana structural constituent of ribosome (AT2G32220) mRNA, complete cds Length = 605 Score = 63.9 bits (32), Expect = 8e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagct 490 |||||||| ||||| ||||||||||| ||||||||||||||||| Sbjct: 381 gagaggtttaagactggcaagaacagatggttcttcaccaagct 424 Score = 56.0 bits (28), Expect = 2e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||| ||||||||||| || ||||||||| | || || || |||||||| Sbjct: 138 tacggtcactgtctcgtcgccggattgaagaagtacccaagcaaagtcattcgcaaggat 197 Query: 258 tcggcgaagaagacggccaagaagtcgcgcgt 289 ||||| ||||||||||| ||||| |||||||| Sbjct: 198 tcggcaaagaagacggctaagaaatcgcgcgt 229
>gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 map TEn5, complete sequence Length = 103194 Score = 63.9 bits (32), Expect = 8e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagct 490 |||||||| ||||| ||||||||||| ||||||||||||||||| Sbjct: 10111 gagaggtttaagactggcaagaacagatggttcttcaccaagct 10068 Score = 56.0 bits (28), Expect = 2e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||| ||||||||||| || ||||||||| | || || || |||||||| Sbjct: 10354 tacggtcactgtctcgtcgccggattgaagaagtacccaagcaaagtcattcgcaaggat 10295 Query: 258 tcggcgaagaagacggccaagaagtcgcgcgt 289 ||||| ||||||||||| ||||| |||||||| Sbjct: 10294 tcggcaaagaagacggctaagaaatcgcgcgt 10263
>gb|BT021972.1| Arabidopsis thaliana At2g32220 mRNA, complete cds Length = 509 Score = 63.9 bits (32), Expect = 8e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagct 490 |||||||| ||||| ||||||||||| ||||||||||||||||| Sbjct: 374 gagaggtttaagactggcaagaacagatggttcttcaccaagct 417 Score = 56.0 bits (28), Expect = 2e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||| ||||||||||| || ||||||||| | || || || |||||||| Sbjct: 131 tacggtcactgtctcgtcgccggattgaagaagtacccaagcaaagtcattcgcaaggat 190 Query: 258 tcggcgaagaagacggccaagaagtcgcgcgt 289 ||||| ||||||||||| ||||| |||||||| Sbjct: 191 tcggcaaagaagacggctaagaaatcgcgcgt 222
>gb|BT000418.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 502 Score = 61.9 bits (31), Expect = 3e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| |||||||| |||||||| ||| ||||||||| | || || |||||||| ||| Sbjct: 112 tacggacactgccttgtcgccggactgaagaagtacccgagcaaagtcatccgcaaagac 171 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 172 tcagcgaagaagacggcgaagaa 194 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 340 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 399
>emb|BX823175.1|CNS0A74P Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZD12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 545 Score = 61.9 bits (31), Expect = 3e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 198 tacggccactgcctcgtcgccggcctggcgaagtaccccaagaaggtgatccgcaaggac 257 ||||| ||||||||||||||||| ||| ||||||||| | || | |||||||| ||| Sbjct: 115 tacggacactgcctcgtcgccggactgaagaagtacccgagcaaactcatccgcaaagac 174 Query: 258 tcggcgaagaagacggccaagaa 280 || |||||||||||||| ||||| Sbjct: 175 tcagcgaagaagacggcgaagaa 197 Score = 48.1 bits (24), Expect = 0.049 Identities = 51/60 (85%) Strand = Plus / Plus Query: 432 aaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||| ||||| ||||| | |||||||| || ||||||||||||||||| || |||||| Sbjct: 343 aaggctaagcttgaggaacgtttcaagactgggaagaacaggtggttctttactaagctc 402
>gb|DQ848865.1| Scophthalmus maximus clone kbc35 60S ribosomal protein L27 mRNA, complete cds Length = 534 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Plus Query: 437 caagctcgaggagaggttcaagaccggcaagaacaggtggttcttc 482 |||| |||||||||||| |||||| |||||||||| |||||||||| Sbjct: 425 caagttcgaggagaggtacaagacaggcaagaacaagtggttcttc 470
>ref|XM_001225566.1| Chaetomium globosum CBS 148.51 conserved hypothetical protein (CHGG_07911) mRNA, complete cds Length = 408 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 296 cttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcga 349 |||| ||||| || |||||| || |||||| ||||||||||||||||||||||| Sbjct: 207 cttcatcaaggtcatcaactacaaccacctgatgcccacccgctacaccctcga 260
>ref|XM_370196.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein (MG06693.4) partial mRNA Length = 450 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 296 cttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcga 349 |||| ||||| | ||||||| || |||||||||||||||||||||||| ||||| Sbjct: 249 cttcgtcaaggttgtcaactacaaccacctcatgcccacccgctacactctcga 302
>gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete sequence Length = 136954 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Plus Query: 450 aggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 |||||||| ||||| |||||||| |||||||||||||||||| Sbjct: 110789 aggttcaaaaccgggaagaacagatggttcttcaccaagctc 110830 Score = 42.1 bits (21), Expect = 3.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 618 gactatgtttttagattggat 638 ||||||||||||||||||||| Sbjct: 23012 gactatgtttttagattggat 23032
>gb|AC131248.14| Medicago truncatula clone mth2-28n22, complete sequence Length = 136333 Score = 60.0 bits (30), Expect = 1e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 442 tcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctc 491 ||||||||||||| ||||| || ||||| ||||||||||| ||||||||| Sbjct: 38467 tcgaggagaggtttaagactggaaagaataggtggttctttaccaagctc 38418
>ref|XM_850644.1| PREDICTED: Canis familiaris similar to ribosomal protein L27, transcript variant 3 (LOC486183), mRNA Length = 464 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 429 gccaaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttc 482 ||||||| |||| |||||||||||| ||||||| ||||||| | |||||||||| Sbjct: 358 gccaaggtcaagttcgaggagaggtacaagaccagcaagaataagtggttcttc 411
>ref|XM_543309.2| PREDICTED: Canis familiaris similar to ribosomal protein L27, transcript variant 1 (LOC486183), mRNA Length = 483 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 429 gccaaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttc 482 ||||||| |||| |||||||||||| ||||||| ||||||| | |||||||||| Sbjct: 373 gccaaggtcaagttcgaggagaggtacaagaccagcaagaataagtggttcttc 426
>emb|CR733949.2|CNS0GT3G Tetraodon nigroviridis full-length cDNA Length = 479 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 429 gccaaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttc 482 |||||||||||| | |||||||||| |||||| ||||| |||| |||||||||| Sbjct: 369 gccaaggccaagtttgaggagaggtacaagacgggcaaaaacaagtggttcttc 422
>gb|AF266223.1|AF266223 Gillichthys mirabilis ribosomal protein L27 mRNA, complete cds Length = 474 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 429 gccaaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttc 482 ||||||| |||| | |||||||||| |||||| ||||| ||||||||||||||| Sbjct: 368 gccaaggtcaagtttgaggagaggtacaagacgggcaaaaacaggtggttcttc 421
>gb|AY610378.1| Sus scrofa clone relu1310b_k10.y1.abd, mRNA sequence Length = 483 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Plus Query: 429 gccaaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttc 482 ||||||| |||| |||||||||| | ||||||||||||||||| ||||||||| Sbjct: 360 gccaaggtcaagttcgaggagagatacaagaccggcaagaacaaatggttcttc 413
>gb|AF548324.1| Branchiostoma belcheri ribosomal protein L27 mRNA, complete cds Length = 514 Score = 58.0 bits (29), Expect = 5e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 444 gaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttctag 500 |||||||| | ||||||||||||||||| |||||||||| ||||| ||||||||| Sbjct: 386 gaggagagatacaagaccggcaagaacaagtggttcttccagaagctacgcttctag 442
>gb|AF003143.2| Caenorhabditis elegans cosmid C53H9, complete sequence Length = 7003 Score = 58.0 bits (29), Expect = 5e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 431 caaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaa 487 |||| ||||| |||||||| | | ||||||||| ||||||| ||||||||||||||| Sbjct: 3144 caagtccaagttcgaggagcgttacaagaccggaaagaacaagtggttcttcaccaa 3200
>ref|NM_058504.4| Caenorhabditis elegans Ribosomal Protein, Large subunit family member (rpl-27) (rpl-27) mRNA, complete cds Length = 463 Score = 58.0 bits (29), Expect = 5e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 431 caaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaa 487 |||| ||||| |||||||| | | ||||||||| ||||||| ||||||||||||||| Sbjct: 350 caagtccaagttcgaggagcgttacaagaccggaaagaacaagtggttcttcaccaa 406
>gb|U89308.1|CEU89308 Caenorhabditis elegans ribosomal protein L27 homolog mRNA, SL2 trans-spliced, complete cds Length = 506 Score = 58.0 bits (29), Expect = 5e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 431 caaggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaa 487 |||| ||||| |||||||| | | ||||||||| ||||||| ||||||||||||||| Sbjct: 370 caagtccaagttcgaggagcgttacaagaccggaaagaacaagtggttcttcaccaa 426
>gb|AY682471.1| Chara globularis 60S ribosomal protein L27 mRNA, complete cds Length = 830 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 441 ctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaag 488 |||||||||||||||||||| || |||||||| ||||| ||| ||||| Sbjct: 419 ctcgaggagaggttcaagacaggaaagaacagatggtttttctccaag 466
>gb|U10046.1|PSU10046 Pisum sativum ribosomal protein L27 homolog (RPL27-5) mRNA, complete cds Length = 568 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 447 gagaggttcaagaccggcaagaacaggtggttcttcaccaagct 490 ||||||||||| || || |||||||||||||| ||||||||||| Sbjct: 393 gagaggttcaaaacagggaagaacaggtggtttttcaccaagct 436
>ref|XM_500549.1| Yarrowia lipolytica CLIB122, YALI0B05896g predicted mRNA Length = 396 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 465 aagaacaggtggttcttcaccaagctccgcttcta 499 ||||||| ||||||||||||||||||||| ||||| Sbjct: 361 aagaacaagtggttcttcaccaagctccgattcta 395 Score = 46.1 bits (23), Expect = 0.19 Identities = 47/55 (85%) Strand = Plus / Plus Query: 296 cttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcgac 350 |||| ||||| ||||||||| || |||| | |||||||| || |||||||||||| Sbjct: 192 cttcatcaaggtcgtcaactacaaccacatgatgcccactcgatacaccctcgac 246
>gb|AY508978.1| Pectinaria gouldii ribosomal protein L27 mRNA, complete cds Length = 519 Score = 54.0 bits (27), Expect = 8e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 465 aagaacaggtggttcttcaccaagctc 491 ||||||||||||||||||||||||||| Sbjct: 418 aagaacaggtggttcttcaccaagctc 444
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 465 aagaacaggtggttcttcaccaagctccgcttcta 499 ||||||| ||||||||||||||||||||| ||||| Sbjct: 790812 aagaacaagtggttcttcaccaagctccgattcta 790846 Score = 46.1 bits (23), Expect = 0.19 Identities = 47/55 (85%) Strand = Plus / Plus Query: 296 cttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcgac 350 |||| ||||| ||||||||| || |||| | |||||||| || |||||||||||| Sbjct: 790643 cttcatcaaggtcgtcaactacaaccacatgatgcccactcgatacaccctcgac 790697
>ref|XM_656734.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4222.2), mRNA Length = 408 Score = 52.0 bits (26), Expect = 0.003 Identities = 47/54 (87%) Strand = Plus / Plus Query: 296 cttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcga 349 |||| ||||| ||||||||| || |||||| ||||||||||| ||||| ||||| Sbjct: 207 cttcatcaaggtcgtcaactacaaccacctgatgcccacccgttacactctcga 260
>gb|AY292611.1| Oikopleura dioica 60S ribosomal protein RL27 (RL27) gene, complete cds Length = 691 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttctag 500 ||||||||||||||||| |||||||||| |||||||| |||||| Sbjct: 646 caagaccggcaagaacaagtggttcttccagaagctccgattctag 691
>emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 570 Score = 52.0 bits (26), Expect = 0.003 Identities = 29/30 (96%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcac 484 ||||||||||||||||| |||||||||||| Sbjct: 376 caagaccggcaagaacaagtggttcttcac 347
>emb|BX006453.1|CNS08D55 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 52.0 bits (26), Expect = 0.003 Identities = 56/66 (84%) Strand = Plus / Minus Query: 434 ggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccg 493 ||||||| |||||||| | ||||||||||||||||| |||||||||| |||||||| Sbjct: 537 ggccaagttcgaggagcgacacaagaccggcaagaacaagtggttcttccagaagctccg 478 Query: 494 cttcta 499 ||||| Sbjct: 477 tttcta 472
>emb|BX006452.1|CNS08D54 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 52.0 bits (26), Expect = 0.003 Identities = 56/66 (84%) Strand = Plus / Plus Query: 434 ggccaagctcgaggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccg 493 ||||||| |||||||| | ||||||||||||||||| |||||||||| |||||||| Sbjct: 344 ggccaagttcgaggagcgacacaagaccggcaagaacaagtggttcttccagaagctccg 403 Query: 494 cttcta 499 ||||| Sbjct: 404 tttcta 409
>emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BAC contig B23G1 Length = 106111 Score = 52.0 bits (26), Expect = 0.003 Identities = 47/54 (87%) Strand = Plus / Plus Query: 296 cttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcga 349 |||| ||||| || |||||| || |||| | ||||||||||||||||||||||| Sbjct: 94638 cttcatcaaggtcatcaactacaaccacttgatgcccacccgctacaccctcga 94691 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 460 ccggcaagaacaggtggttcttcacc 485 |||||||||||||||||||||||||| Sbjct: 94799 ccggcaagaacaggtggttcttcacc 94824
>ref|XM_951518.1| Neurospora crassa OR74A hypothetical protein (NCU01827.1) partial mRNA Length = 408 Score = 52.0 bits (26), Expect = 0.003 Identities = 47/54 (87%) Strand = Plus / Plus Query: 296 cttcctcaagctcgtcaacttcacccacctcatgcccacccgctacaccctcga 349 |||| ||||| || |||||| || |||| | ||||||||||||||||||||||| Sbjct: 207 cttcatcaaggtcatcaactacaaccacttgatgcccacccgctacaccctcga 260 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 460 ccggcaagaacaggtggttcttcacc 485 |||||||||||||||||||||||||| Sbjct: 368 ccggcaagaacaggtggttcttcacc 393
>emb|BX072103.1|CNS09RSR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 420 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 464
>emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 529 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 485
>emb|BX072101.1|CNS09RSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 428 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 472
>emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 893 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 514 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 470
>emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 416 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 460
>emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 537 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 493
>emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 405 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 449
>emb|BX071773.1|CNS09RJL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 531 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 487
>emb|BX071772.1|CNS09RJK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 408 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 452
>emb|BX071703.1|CNS09RHN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 515 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 471
>emb|BX071702.1|CNS09RHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 392 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 436
>emb|BX071484.1|CNS09RBK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 521 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 477
>emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 415 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 459
>emb|BX071294.1|CNS09R6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 390 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 434
>emb|BX071109.1|CNS09R15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 513 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 469
>emb|BX071108.1|CNS09R14 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 407 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 451
>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 799 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 843
>emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 488 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 382 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 426
>emb|BX070984.1|CNS09QXO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 528 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 484
>emb|BX070983.1|CNS09QXN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 436 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 480
>emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 522 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 478
>emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 394 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 438
>emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 523 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 479
>emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 421 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 465
>emb|BX070293.1|CNS09QEH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 400 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 444
>emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 518 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 474
>emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 411 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 455
>emb|BX070199.1|CNS09QBV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 517 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 473
>emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 513 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 469
>emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 408 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 452
>emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 704 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 514 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 470
>emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 391 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 435
>emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 530 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 486
>emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 707 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 412 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 456
>emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 535 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 491
>emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 430 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 474
>emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 518 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 474
>emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 361 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 405
>emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 344 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 388
>emb|BX069144.1|CNS09PIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 371 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 415
>emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 409 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 453
>emb|BX069070.1|CNS09PGI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 412 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 456
>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 539 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 495
>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 414 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 458
>emb|BX069033.1|CNS09PFH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 532 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 488
>emb|BX069032.1|CNS09PFG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 393 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 437
>emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 665 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 535 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 491
>emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 407 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 451
>emb|BX068777.1|CNS09P8D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 512 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 468
>emb|BX068776.1|CNS09P8C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 376 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 420
>emb|BX068480.1|CNS09P04 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 637 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 507 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 463
>emb|BX068479.1|CNS09P03 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 362 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 406
>emb|BX067447.1|CNS09O7F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 408 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 452
>emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 674 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 413 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 457
>emb|BX067898.1|CNS09OJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 532 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 488
>emb|BX067672.1|CNS09ODO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 383 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 427
>emb|BX067249.1|CNS09O1X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 513 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 469
>emb|BX067248.1|CNS09O1W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 383 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 427
>emb|BX067222.1|CNS09O16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 518 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 474
>emb|BX067221.1|CNS09O15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 409 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 453
>emb|BX067182.1|CNS09O02 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 517 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 473
>emb|BX067181.1|CNS09O01 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 417 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 461
>emb|BX067173.1|CNS09NZT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 348 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 392
>emb|BX067015.1|CNS09NVF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 514 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 470
>emb|BX067014.1|CNS09NVE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 401 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 445
>emb|BX066730.1|CNS09NNI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 550 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 540 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 496
>emb|BX066729.1|CNS09NNH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 428 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 472
>emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 408 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 452
>emb|BX066542.1|CNS09NIA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 523 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 479
>emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 409 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 453
>emb|BX066194.1|CNS09N8M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 387 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 431
>emb|BX066150.1|CNS09N7E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 412 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 456
>emb|BX066095.1|CNS09N5V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 389 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 433
>emb|BX065973.1|CNS09N2H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 347 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 391
>emb|BX065830.1|CNS09MYI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 402 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 446
>emb|BX065804.1|CNS09MXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 607 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 418 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 462
>emb|BX065733.1|CNS09MVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 344 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 388
>emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 397 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 441
>emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 530 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 486
>emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 409 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 453
>emb|BX065395.1|CNS09MMF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 500 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 456
>emb|BX065394.1|CNS09MME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 389 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 433
>emb|BX065267.1|CNS09MIV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 398 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 442
>emb|BX064786.1|CNS09M5I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 383 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 427
>emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 652 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 363 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 407
>emb|BX064318.1|CNS09LSI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 529 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 485
>emb|BX064317.1|CNS09LSH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 423 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 467
>emb|BX064256.1|CNS09LQS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 405 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 449
>emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 501 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 457
>emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 407 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 451
>emb|BX064097.1|CNS09LMD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 528 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 484
>emb|BX064096.1|CNS09LMC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 414 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 458
>emb|BX063197.1|CNS09KXD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 517 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 473
>emb|BX063196.1|CNS09KXC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 419 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 463
>emb|BX063195.1|CNS09KXB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 510 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 466
>emb|BX063194.1|CNS09KXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 418 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 462
>emb|BX063139.1|CNS09KVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 413 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 457
>emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1044 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 457 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 501
>emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 508 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 464
>emb|BX064001.1|CNS09LJP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 408 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 452
>emb|BX063528.1|CNS09L6K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 465 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 391 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 435
>emb|BX063517.1|CNS09L69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 720 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 358 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 314
>emb|BX063516.1|CNS09L68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 393 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 437
>emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 524 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 480
>emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 407 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 451
>emb|BX062248.1|CNS09K70 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 399 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 443
>emb|BX062217.1|CNS09K65 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 517 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 473
>emb|BX061945.1|CNS09JYL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 372 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 416
>emb|BX061917.1|CNS09JXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 509 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 465
>emb|BX061916.1|CNS09JXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 387 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 431
>emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 727 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 396 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 440
>emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 510 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 466
>emb|BX061094.1|CNS09JAY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 391 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 435
>emb|BX060930.1|CNS09J6E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 506 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 462
>emb|BX060929.1|CNS09J6D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 509 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 349 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 393
>emb|BX060671.1|CNS09IZ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 408 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 66 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 110
>emb|BX060630.1|CNS09IY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 114 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 3 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 47
>emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 503 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 459
>emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 401 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 445
>emb|BX060463.1|CNS09ITF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 513 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 469
>emb|BX060462.1|CNS09ITE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 402 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 446
>emb|BX060432.1|CNS09ISK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 519 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 475
>emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 402 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 446
>emb|BX060386.1|CNS09IRA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 526 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 482
>emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 423 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 467
>emb|BX060142.1|CNS09IKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 482 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 438
>emb|BX060141.1|CNS09IKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 386 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 430
>emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 407 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 451
>emb|BX059737.1|CNS09I99 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 392 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 436
>emb|BX059721.1|CNS09I8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 395 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 439
>emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 500 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 387 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 431
>emb|BX059325.1|CNS09HXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 536 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 492
>emb|BX059324.1|CNS09HXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 416 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 460
>emb|BX059251.1|CNS09HVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 401 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 445
>emb|BX059147.1|CNS09HSV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 530 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 486
>emb|BX059146.1|CNS09HSU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 420 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 464
>emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 401 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 445
>emb|BX059021.1|CNS09HPD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 502 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 458
>emb|BX059020.1|CNS09HPC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 395 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 439
>emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 544 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 500
>emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 427 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 471
>emb|BX058853.1|CNS09HKP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 385 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 429
>emb|BX058608.1|CNS09HDW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 449 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 392 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 436
>emb|BX058465.1|CNS09H9X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 420 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 464
>emb|BX057944.1|CNS09GVG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 406 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 450
>emb|BX057637.1|CNS09GMX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 544 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 500
>emb|BX057636.1|CNS09GMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 394 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 438
>emb|BX057549.1|CNS09GKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 533 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 489
>emb|BX057548.1|CNS09GKG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 396 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 440
>emb|BX057428.1|CNS09GH4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 499 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 455
>emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 403 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 447
>emb|BX057217.1|CNS09GB9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 583 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 402 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 446
>emb|BX057111.1|CNS09G8B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 405 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 449
>emb|BX057064.1|CNS09G70 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 654 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 425 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 469
>emb|BX056980.1|CNS09G4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 494 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 393 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 437
>emb|BX056911.1|CNS09G2R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 705 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 555 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 511
>emb|BX056910.1|CNS09G2Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 428 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 472
>emb|BX056816.1|CNS09G04 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 357 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 401
>emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 404 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 448
>emb|BX056561.1|CNS09FT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 524 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 480
>emb|BX056560.1|CNS09FT0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 409 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 453
>emb|BX056536.1|CNS09FSC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 350 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 394
>emb|BX056232.1|CNS09FJW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 547 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 398 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 442
>emb|BX056161.1|CNS09FHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 529 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 485
>emb|BX056160.1|CNS09FHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 408 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 452
>emb|BX055158.1|CNS09EQ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 341 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 385
>emb|BX054990.1|CNS09ELE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 180 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 224
>emb|BX054749.1|CNS09EEP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 410 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 454
>emb|BX054473.1|CNS09E71 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 769 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 313 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 357
>emb|BX054408.1|CNS09E58 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 733 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 314 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 358
>emb|BX054219.1|CNS09DZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Minus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 537 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 493
>emb|BX054218.1|CNS09DZY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 712 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 421 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 465
>emb|BX053917.1|CNS09DRL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31DE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 482 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 386 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 430
>emb|BX053763.1|CNS09DNB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 430 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 474
>emb|BX053650.1|CNS09DK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 50.1 bits (25), Expect = 0.012 Identities = 40/45 (88%) Strand = Plus / Plus Query: 455 caagaccggcaagaacaggtggttcttcaccaagctccgcttcta 499 ||||||||||||||||| |||||||||| |||||||| ||||| Sbjct: 392 caagaccggcaagaacaagtggttcttccagaagctccgtttcta 436 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 130,256,049 Number of extensions: 7259658 Number of successful extensions: 159447 Number of sequences better than 10.0: 668 Number of HSP's gapped: 159406 Number of HSP's successfully gapped: 727 Length of query: 808 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 786 Effective length of database: 18,508,616,841 Effective search space: 14547772837026 Effective search space used: 14547772837026 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
