| Clone Name | FLbaf95n19 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC161463.3| Gallus gallus BAC clone CH261-127J9 from chromosome ul, complete sequence Length = 213261 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Minus Query: 222 cgaacagattgcagcaaatgtaa 244 ||||||||||||||||||||||| Sbjct: 9457 cgaacagattgcagcaaatgtaa 9435
>ref|XM_001212806.1| Aspergillus terreus NIH2624 predicted protein (ATEG_03628) mRNA, complete cds Length = 945 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 292 acggacaggcaacaagatgcagtt 315 ||||||||| |||||||||||||| Sbjct: 285 acggacaggtaacaagatgcagtt 308
>ref|XM_001143632.1| PREDICTED: Pan troglodytes SRB7 suppressor of RNA polymerase B homolog, transcript variant 1 (SURB7), mRNA Length = 2767 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 1550 aacagattgcagcaaatgta 1531
>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence Length = 21146708 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 ttgccaccgttctcgcattcgcct 337 |||||||||||||||| ||||||| Sbjct: 19867891 ttgccaccgttctcgccttcgcct 19867914
>ref|XM_001099368.1| PREDICTED: Macaca mulatta similar to SRB7 suppressor of RNA polymerase B homolog (LOC710699), mRNA Length = 2766 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 1563 aacagattgcagcaaatgta 1544
>ref|NM_004264.2| Homo sapiens SRB7 suppressor of RNA polymerase B homolog (yeast) (SURB7), mRNA gb|BC008380.1| Homo sapiens SRB7 suppressor of RNA polymerase B homolog (yeast), mRNA (cDNA clone MGC:12425 IMAGE:4041267), complete cds Length = 1783 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 1524 aacagattgcagcaaatgta 1505
>ref|NM_134290.1| Drosophila melanogaster Sox box protein 14 CG3090-RB, transcript variant B (Sox14), mRNA Length = 2485 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 ttgccaccgttctcgcattcgcct 337 |||||||||||||||| ||||||| Sbjct: 474 ttgccaccgttctcgccttcgcct 497
>ref|NM_057546.2| Drosophila melanogaster Sox box protein 14 CG3090-RA, transcript variant A (Sox14), mRNA Length = 3159 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 ttgccaccgttctcgcattcgcct 337 |||||||||||||||| ||||||| Sbjct: 1148 ttgccaccgttctcgccttcgcct 1171
>dbj|AB169149.1| Macaca fascicularis testis cDNA, clone: QtsA-17555, similar to human SRB7 suppressor of RNA polymerase B homolog (yeast)(SURB7), mRNA, RefSeq: NM_004264.2 Length = 1802 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 1539 aacagattgcagcaaatgta 1520
>gb|AC092747.10| Homo sapiens 12p BAC RP11-582E3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 162400 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 146967 aacagattgcagcaaatgta 146986
>emb|AL121987.34|HSBA536C5 Human DNA sequence from clone RP11-536C5 on chromosome 1q23.1-24.1 Contains the 5' end of the KCNJ10 gene for potassium inwardly-rectifying channel subfamily J member 10, a novel gene, the KCNJ9 gene for potassium inwardly-rectifying channel subfamily J member 9, the IGSF8 gene for immunoglobulin superfamily member 8, the ATP1A2 gene for Na+/K+ transporting ATPase alpha 2 (+) polypeptide, the ATP1A4 gene for Na+/K+ transporting ATPase alpha 4 (+) polypeptide, the CASQ1 gene for calsequestrin 1 (fast-twitch, skeletal muscle), a novel gene, the PEA15 gene for phosphoprotein enriched in astrocytes 15 and four CpG islands, complete sequence Length = 170834 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 gattgcagcaaatgtaacac 247 |||||||||||||||||||| Sbjct: 73842 gattgcagcaaatgtaacac 73861
>gb|AC099018.1| Drosophila melanogaster, chromosome 2R, region 60A-60B, BAC clone BACR28M05, complete sequence Length = 154840 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 ttgccaccgttctcgcattcgcct 337 |||||||||||||||| ||||||| Sbjct: 71758 ttgccaccgttctcgccttcgcct 71781
>emb|AJ252125.1|DME252125 Drosophila melanogaster mRNA for Sox14 protein (Sox14 gene) Length = 1876 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 ttgccaccgttctcgcattcgcct 337 |||||||||||||||| ||||||| Sbjct: 415 ttgccaccgttctcgccttcgcct 438
>emb|CR857692.1| Pongo pygmaeus mRNA; cDNA DKFZp468J0220 (from clone DKFZp468J0220) Length = 1740 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 1502 aacagattgcagcaaatgta 1483
>emb|CR621668.1| full-length cDNA clone CS0DI014YH17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1700 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 1501 aacagattgcagcaaatgta 1482
>emb|CR593127.1| full-length cDNA clone CS0DL010YB14 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 681 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 aacagattgcagcaaatgta 243 |||||||||||||||||||| Sbjct: 451 aacagattgcagcaaatgta 432
>emb|BX511000.12| Zebrafish DNA sequence from clone DKEY-217F4 in linkage group 2, complete sequence Length = 191671 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 238 aatgtaacaccacagactgt 257 |||||||||||||||||||| Sbjct: 165351 aatgtaacaccacagactgt 165332
>gb|AE016830.1| Enterococcus faecalis V583, complete genome Length = 3218031 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 aatgcgtgctgctgatgtag 70 |||||||||||||||||||| Sbjct: 1270414 aatgcgtgctgctgatgtag 1270433
>gb|AC004642.1|AC004642 Drosophila melanogaster DNA sequence (P1s DS00543 (D193) and DS02867 (D200)), complete sequence Length = 148432 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 314 ttgccaccgttctcgcattcgcct 337 |||||||||||||||| ||||||| Sbjct: 111464 ttgccaccgttctcgccttcgcct 111441
>gb|J05096.1|HUMATP1A2 Human Na,K-ATPase subunit alpha 2 (ATP1A2) gene, complete cds Length = 26668 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 gattgcagcaaatgtaacac 247 |||||||||||||||||||| Sbjct: 4887 gattgcagcaaatgtaacac 4906 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 59,533,177 Number of extensions: 2808331 Number of successful extensions: 178609 Number of sequences better than 10.0: 20 Number of HSP's gapped: 178609 Number of HSP's successfully gapped: 20 Length of query: 436 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 414 Effective length of database: 18,508,616,841 Effective search space: 7662567372174 Effective search space used: 7662567372174 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 13 (26.3 bits)