| Clone Name | FLbaf103b01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_001056491.1| Oryza sativa (japonica cultivar-group) Os03g0320900 (Os03g0320900) mRNA, complete cds Length = 1343 Score = 684 bits (345), Expect = 0.0 Identities = 573/649 (88%) Strand = Plus / Plus Query: 307 ccgacaaggatcagctgttccgggggctggaggcggcgctgggcaccacgtttagctccg 366 |||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| | Sbjct: 290 ccgacaaggatcagctgttccgggggctggaggcggcgctcggcacgacgttcagctcgg 349 Query: 367 aaccgctggcgccgccgccggagccgatgatcctcgtcatcagtggccctagcggtgtcg 426 | ||||| |||||||||||| |||||||||||||||||||||| || || ||||| |||| Sbjct: 350 agccgctcgcgccgccgccgcagccgatgatcctcgtcatcagcgggcccagcggcgtcg 409 Query: 427 ggaaggatgcggtcatcaagaggctgcaagaggagagggaagagatccattttgtcatta 486 | ||||| || |||||| ||||||||||||| |||||||| | ||| ||||| || | | Sbjct: 410 gcaaggacgctgtcatccagaggctgcaagaagagagggaggggatgcatttcgttgtca 469 Query: 487 ccgcgacgagcagagcaattcggccaggtgaagttgatgggaaggactatcactttgtca 546 ||||||| |||||||| | ||||| |||||||||||||||||||||||| |||| |||| Sbjct: 470 ccgcgacaagcagagcgaagcggcccggtgaagttgatgggaaggactattacttcgtca 529 Query: 547 ccaaggaggcgttcctctccatgattgaaagggaggatttgcttgagtatgcgcttgttt 606 ||||||||| ||||||| | |||||||||||| |||| ||||| ||||| || ||||| | Sbjct: 530 ccaaggaggagttcctcacgatgattgaaaggaaggagttgctcgagtacgcacttgtct 589 Query: 607 atggggaatataaggggattcccaagcagcagatccgcgattacatggccaaaggacatg 666 ||||||| ||||||||||| ||||||||||||||||| ||||||||||| ||||| ||| Sbjct: 590 atggggagtataaggggatccccaagcagcagatccgtgattacatggcgaaaggttatg 649 Query: 667 acattgtcttgagggtggatattcaaggagcagcaactttgagagagatacttggcgaat 726 | ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||| Sbjct: 650 atattgtcttgagagtggacattcaaggagcagcaaccttgagagagattcttggcgaat 709 Query: 727 ctgcaattttcatctttctagttgcagagagcgaggaggcacttgtcaaaaggctcattc 786 | ||||||||||||||| | ||||||||||| || |||||||||||||||||||| |||| Sbjct: 710 cagcaattttcatctttttggttgcagagagtgaagaggcacttgtcaaaaggctaattc 769 Query: 787 accgtaaaactgaaacgacagacatgcttcttgtcagaattgcaacagccagagaggagg 846 |||| ||||| ||||| |||| ||||||||||||||| ||||||| |||||||| |||| Sbjct: 770 accgcaaaacagaaacatcagatatgcttcttgtcagagttgcaacggccagagaagagg 829 Query: 847 tgagacggatgaaatattttgactacgtagttgtcaatgctgaagggaagcttgaggatg 906 ||| ||| ||||| ||||||| || |||||||||||| |||||||||| ||||||| | Sbjct: 830 tgaaacgcatgaacaattttgattatgtagttgtcaattctgaagggaatcttgaggggg 889 Query: 907 ctgttaaacaggtggagtctatcattgatgctgagaaggcaaaagtcca 955 |||||||||||||||||||||||||||||||||||||||| || ||||| Sbjct: 890 ctgttaaacaggtggagtctatcattgatgctgagaaggctaaggtcca 938
>dbj|AK106255.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-100-E10, full insert sequence Length = 1343 Score = 676 bits (341), Expect = 0.0 Identities = 572/649 (88%) Strand = Plus / Plus Query: 307 ccgacaaggatcagctgttccgggggctggaggcggcgctgggcaccacgtttagctccg 366 |||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| | Sbjct: 290 ccgacaaggatcagctgttccgggggctggaggcggcgctcggcacgacgttcagctcgg 349 Query: 367 aaccgctggcgccgccgccggagccgatgatcctcgtcatcagtggccctagcggtgtcg 426 | ||||| |||||||||||| |||||||||||||||||||||| || || ||||| |||| Sbjct: 350 agccgctcgcgccgccgccgcagccgatgatcctcgtcatcagcgggcccagcggcgtcg 409 Query: 427 ggaaggatgcggtcatcaagaggctgcaagaggagagggaagagatccattttgtcatta 486 | ||||| || |||||| ||||||||||||| |||||||| | ||| ||||| || | | Sbjct: 410 gcaaggacgctgtcatccagaggctgcaagaagagagggaggggatgcatttcgttgtca 469 Query: 487 ccgcgacgagcagagcaattcggccaggtgaagttgatgggaaggactatcactttgtca 546 ||||||| |||||||| | ||||| |||||||||||||||||||||||| |||| |||| Sbjct: 470 ccgcgacaagcagagcgaagcggcccggtgaagttgatgggaaggactattacttcgtca 529 Query: 547 ccaaggaggcgttcctctccatgattgaaagggaggatttgcttgagtatgcgcttgttt 606 ||||||||| ||||||| | |||||||||||| |||| ||||| ||||| || ||||| | Sbjct: 530 ccaaggaggagttcctcacgatgattgaaaggaaggagttgctcgagtacgcacttgtct 589 Query: 607 atggggaatataaggggattcccaagcagcagatccgcgattacatggccaaaggacatg 666 ||||||| ||||||||||| ||||||||||||||||| ||||||||||| ||||| ||| Sbjct: 590 atggggagtataaggggatccccaagcagcagatccgtgattacatggcgaaaggttatg 649 Query: 667 acattgtcttgagggtggatattcaaggagcagcaactttgagagagatacttggcgaat 726 | ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||| Sbjct: 650 atattgtcttgagagtggacattcaaggagcagcaaccttgagagagattcttggcgaat 709 Query: 727 ctgcaattttcatctttctagttgcagagagcgaggaggcacttgtcaaaaggctcattc 786 | ||||| ||||||||| | ||||||||||| || |||||||||||||||||||| |||| Sbjct: 710 cagcaatcttcatctttttggttgcagagagtgaagaggcacttgtcaaaaggctaattc 769 Query: 787 accgtaaaactgaaacgacagacatgcttcttgtcagaattgcaacagccagagaggagg 846 |||| ||||| ||||| |||| ||||||||||||||| ||||||| |||||||| |||| Sbjct: 770 accgcaaaacagaaacatcagatatgcttcttgtcagagttgcaacggccagagaagagg 829 Query: 847 tgagacggatgaaatattttgactacgtagttgtcaatgctgaagggaagcttgaggatg 906 ||| ||| ||||| ||||||| || |||||||||||| |||||||||| ||||||| | Sbjct: 830 tgaaacgcatgaacaattttgattatgtagttgtcaattctgaagggaatcttgaggggg 889 Query: 907 ctgttaaacaggtggagtctatcattgatgctgagaaggcaaaagtcca 955 |||||||||||||||||||||||||||||||||||||||| || ||||| Sbjct: 890 ctgttaaacaggtggagtctatcattgatgctgagaaggctaaggtcca 938
>gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0042L15, from chromosome 3, complete sequence Length = 172475 Score = 357 bits (180), Expect = 7e-95 Identities = 285/320 (89%) Strand = Plus / Plus Query: 636 cagatccgcgattacatggccaaaggacatgacattgtcttgagggtggatattcaagga 695 |||||||| ||||||||||| ||||| |||| ||||||||||| ||||| ||||||||| Sbjct: 122030 cagatccgtgattacatggcgaaaggttatgatattgtcttgagagtggacattcaagga 122089 Query: 696 gcagcaactttgagagagatacttggcgaatctgcaattttcatctttctagttgcagag 755 |||||||| ||||||||||| ||||||||||| ||||||||||||||| | ||||||||| Sbjct: 122090 gcagcaaccttgagagagattcttggcgaatcagcaattttcatctttttggttgcagag 122149 Query: 756 agcgaggaggcacttgtcaaaaggctcattcaccgtaaaactgaaacgacagacatgctt 815 || || |||||||||||||||||||| |||||||| ||||| ||||| |||| |||||| Sbjct: 122150 agtgaagaggcacttgtcaaaaggctaattcaccgcaaaacagaaacatcagatatgctt 122209 Query: 816 cttgtcagaattgcaacagccagagaggaggtgagacggatgaaatattttgactacgta 875 ||||||||| ||||||| |||||||| ||||||| ||| ||||| ||||||| || ||| Sbjct: 122210 cttgtcagagttgcaacggccagagaagaggtgaaacgcatgaacaattttgattatgta 122269 Query: 876 gttgtcaatgctgaagggaagcttgaggatgctgttaaacaggtggagtctatcattgat 935 ||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 122270 gttgtcaattctgaagggaatcttgagggggctgttaaacaggtggagtctatcattgat 122329 Query: 936 gctgagaaggcaaaagtcca 955 ||||||||||| || ||||| Sbjct: 122330 gctgagaaggctaaggtcca 122349 Score = 178 bits (90), Expect = 3e-41 Identities = 168/194 (86%) Strand = Plus / Plus Query: 445 agaggctgcaagaggagagggaagagatccattttgtcattaccgcgacgagcagagcaa 504 ||||||||||||| |||||||| | ||| ||||| || | |||||||| |||||||| | Sbjct: 119770 agaggctgcaagaagagagggaggggatgcatttcgttgtcaccgcgacaagcagagcga 119829 Query: 505 ttcggccaggtgaagttgatgggaaggactatcactttgtcaccaaggaggcgttcctct 564 ||||| |||||||||||||||||||||||| |||| ||||||||||||| ||||||| Sbjct: 119830 agcggcccggtgaagttgatgggaaggactattacttcgtcaccaaggaggagttcctca 119889 Query: 565 ccatgattgaaagggaggatttgcttgagtatgcgcttgtttatggggaatataagggga 624 | |||||||||||| |||| ||||| ||||| || ||||| |||||||| |||||||||| Sbjct: 119890 cgatgattgaaaggaaggagttgctcgagtacgcacttgtctatggggagtataagggga 119949 Query: 625 ttcccaagcagcag 638 | |||||||||||| Sbjct: 119950 tccccaagcagcag 119963 Score = 149 bits (75), Expect = 3e-32 Identities = 117/131 (89%) Strand = Plus / Plus Query: 313 aggatcagctgttccgggggctggaggcggcgctgggcaccacgtttagctccgaaccgc 372 |||||||||||||||||||||||||||||||||| ||||| ||||| ||||| || |||| Sbjct: 119538 aggatcagctgttccgggggctggaggcggcgctcggcacgacgttcagctcggagccgc 119597 Query: 373 tggcgccgccgccggagccgatgatcctcgtcatcagtggccctagcggtgtcgggaagg 432 | |||||||||||| |||||||||||||||||||||| || || ||||| ||||| |||| Sbjct: 119598 tcgcgccgccgccgcagccgatgatcctcgtcatcagcgggcccagcggcgtcggcaagg 119657 Query: 433 atgcggtcatc 443 | || |||||| Sbjct: 119658 acgctgtcatc 119668
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3 Length = 36192742 Score = 357 bits (180), Expect = 7e-95 Identities = 285/320 (89%) Strand = Plus / Plus Query: 636 cagatccgcgattacatggccaaaggacatgacattgtcttgagggtggatattcaagga 695 |||||||| ||||||||||| ||||| |||| ||||||||||| ||||| ||||||||| Sbjct: 11568221 cagatccgtgattacatggcgaaaggttatgatattgtcttgagagtggacattcaagga 11568280 Query: 696 gcagcaactttgagagagatacttggcgaatctgcaattttcatctttctagttgcagag 755 |||||||| ||||||||||| ||||||||||| ||||||||||||||| | ||||||||| Sbjct: 11568281 gcagcaaccttgagagagattcttggcgaatcagcaattttcatctttttggttgcagag 11568340 Query: 756 agcgaggaggcacttgtcaaaaggctcattcaccgtaaaactgaaacgacagacatgctt 815 || || |||||||||||||||||||| |||||||| ||||| ||||| |||| |||||| Sbjct: 11568341 agtgaagaggcacttgtcaaaaggctaattcaccgcaaaacagaaacatcagatatgctt 11568400 Query: 816 cttgtcagaattgcaacagccagagaggaggtgagacggatgaaatattttgactacgta 875 ||||||||| ||||||| |||||||| ||||||| ||| ||||| ||||||| || ||| Sbjct: 11568401 cttgtcagagttgcaacggccagagaagaggtgaaacgcatgaacaattttgattatgta 11568460 Query: 876 gttgtcaatgctgaagggaagcttgaggatgctgttaaacaggtggagtctatcattgat 935 ||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 11568461 gttgtcaattctgaagggaatcttgagggggctgttaaacaggtggagtctatcattgat 11568520 Query: 936 gctgagaaggcaaaagtcca 955 ||||||||||| || ||||| Sbjct: 11568521 gctgagaaggctaaggtcca 11568540 Score = 178 bits (90), Expect = 3e-41 Identities = 168/194 (86%) Strand = Plus / Plus Query: 445 agaggctgcaagaggagagggaagagatccattttgtcattaccgcgacgagcagagcaa 504 ||||||||||||| |||||||| | ||| ||||| || | |||||||| |||||||| | Sbjct: 11565961 agaggctgcaagaagagagggaggggatgcatttcgttgtcaccgcgacaagcagagcga 11566020 Query: 505 ttcggccaggtgaagttgatgggaaggactatcactttgtcaccaaggaggcgttcctct 564 ||||| |||||||||||||||||||||||| |||| ||||||||||||| ||||||| Sbjct: 11566021 agcggcccggtgaagttgatgggaaggactattacttcgtcaccaaggaggagttcctca 11566080 Query: 565 ccatgattgaaagggaggatttgcttgagtatgcgcttgtttatggggaatataagggga 624 | |||||||||||| |||| ||||| ||||| || ||||| |||||||| |||||||||| Sbjct: 11566081 cgatgattgaaaggaaggagttgctcgagtacgcacttgtctatggggagtataagggga 11566140 Query: 625 ttcccaagcagcag 638 | |||||||||||| Sbjct: 11566141 tccccaagcagcag 11566154 Score = 149 bits (75), Expect = 3e-32 Identities = 117/131 (89%) Strand = Plus / Plus Query: 313 aggatcagctgttccgggggctggaggcggcgctgggcaccacgtttagctccgaaccgc 372 |||||||||||||||||||||||||||||||||| ||||| ||||| ||||| || |||| Sbjct: 11565729 aggatcagctgttccgggggctggaggcggcgctcggcacgacgttcagctcggagccgc 11565788 Query: 373 tggcgccgccgccggagccgatgatcctcgtcatcagtggccctagcggtgtcgggaagg 432 | |||||||||||| |||||||||||||||||||||| || || ||||| ||||| |||| Sbjct: 11565789 tcgcgccgccgccgcagccgatgatcctcgtcatcagcgggcccagcggcgtcggcaagg 11565848 Query: 433 atgcggtcatc 443 | || |||||| Sbjct: 11565849 acgctgtcatc 11565859 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ggcgccgccgccggagccgat 394 ||||||||||||||||||||| Sbjct: 23689453 ggcgccgccgccggagccgat 23689473
>gb|AC159125.12| Medicago truncatula clone mth2-189o22, complete sequence Length = 131601 Score = 60.0 bits (30), Expect = 2e-05 Identities = 69/82 (84%) Strand = Plus / Plus Query: 862 attttgactacgtagttgtcaatgctgaagggaagcttgaggatgctgttaaacaggtgg 921 ||||||| || || || ||||||||| | || ||||||||| ||||||| ||| | ||| Sbjct: 107338 attttgattatgttgtggtcaatgctaagggtaagcttgagaatgctgtgaaattgttgg 107397 Query: 922 agtctatcattgatgctgagaa 943 ||||||| |||||||||||||| Sbjct: 107398 agtctattattgatgctgagaa 107419
>gb|AC124960.26| Medicago truncatula clone mth2-26j24, complete sequence Length = 125894 Score = 60.0 bits (30), Expect = 2e-05 Identities = 69/82 (84%) Strand = Plus / Plus Query: 862 attttgactacgtagttgtcaatgctgaagggaagcttgaggatgctgttaaacaggtgg 921 ||||||| || || || ||||||||| | || ||||||||| ||||||| ||| | ||| Sbjct: 118872 attttgattatgttgtggtcaatgctaagggtaagcttgagaatgctgtgaaattgttgg 118931 Query: 922 agtctatcattgatgctgagaa 943 ||||||| |||||||||||||| Sbjct: 118932 agtctattattgatgctgagaa 118953
>ref|XM_981952.1| PREDICTED: Mus musculus centrosomal protein 110 (Cep110), mRNA Length = 7614 Score = 44.1 bits (22), Expect = 1.3 Identities = 25/26 (96%) Strand = Plus / Minus Query: 143 ctctgccctcgctcgctctgtctccc 168 |||||||||| ||||||||||||||| Sbjct: 5492 ctctgccctcactcgctctgtctccc 5467
>ref|NM_111495.2| Arabidopsis thaliana guanylate kinase (AT3G06200) mRNA, complete cds Length = 1225 Score = 44.1 bits (22), Expect = 1.3 Identities = 79/98 (80%) Strand = Plus / Plus Query: 600 cttgtttatggggaatataaggggattcccaagcagcagatccgcgattacatggccaaa 659 ||||||||||| ||||| || |||||||| ||| ||||||| | || | ||||||||| Sbjct: 556 cttgtttatggagaatacaaagggattccaaagaagcagattcaggaatttatggccaaa 615 Query: 660 ggacatgacattgtcttgagggtggatattcaaggagc 697 || | |||||||| | || || |||||||||||||| Sbjct: 616 ggggaagacattgttcttagagttgatattcaaggagc 653
>gb|AC018907.5|ATAC018907 Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequence Length = 93478 Score = 44.1 bits (22), Expect = 1.3 Identities = 79/98 (80%) Strand = Plus / Plus Query: 600 cttgtttatggggaatataaggggattcccaagcagcagatccgcgattacatggccaaa 659 ||||||||||| ||||| || |||||||| ||| ||||||| | || | ||||||||| Sbjct: 44342 cttgtttatggagaatacaaagggattccaaagaagcagattcaggaatttatggccaaa 44401 Query: 660 ggacatgacattgtcttgagggtggatattcaaggagc 697 || | |||||||| | || || |||||||||||||| Sbjct: 44402 ggggaagacattgttcttagagttgatattcaaggagc 44439
>gb|BC079536.1| Mus musculus centrosomal protein 110, mRNA (cDNA clone IMAGE:6409873) Length = 5687 Score = 44.1 bits (22), Expect = 1.3 Identities = 25/26 (96%) Strand = Plus / Minus Query: 143 ctctgccctcgctcgctctgtctccc 168 |||||||||| ||||||||||||||| Sbjct: 3522 ctctgccctcactcgctctgtctccc 3497
>gb|BC023035.1| Mus musculus centrosomal protein 110, mRNA (cDNA clone IMAGE:5356741), with apparent retained intron Length = 1215 Score = 44.1 bits (22), Expect = 1.3 Identities = 25/26 (96%) Strand = Plus / Minus Query: 143 ctctgccctcgctcgctctgtctccc 168 |||||||||| ||||||||||||||| Sbjct: 756 ctctgccctcactcgctctgtctccc 731
>gb|AF446862.1|AF446862 Arabidopsis thaliana AT3g06200/F28L1_14 mRNA, complete cds Length = 849 Score = 44.1 bits (22), Expect = 1.3 Identities = 79/98 (80%) Strand = Plus / Plus Query: 600 cttgtttatggggaatataaggggattcccaagcagcagatccgcgattacatggccaaa 659 ||||||||||| ||||| || |||||||| ||| ||||||| | || | ||||||||| Sbjct: 472 cttgtttatggagaatacaaagggattccaaagaagcagattcaggaatttatggccaaa 531 Query: 660 ggacatgacattgtcttgagggtggatattcaaggagc 697 || | |||||||| | || || |||||||||||||| Sbjct: 532 ggggaagacattgttcttagagttgatattcaaggagc 569
>dbj|AK131139.1| Mus musculus mRNA for mFLJ00150 protein Length = 3974 Score = 44.1 bits (22), Expect = 1.3 Identities = 25/26 (96%) Strand = Plus / Minus Query: 143 ctctgccctcgctcgctctgtctccc 168 |||||||||| ||||||||||||||| Sbjct: 1851 ctctgccctcactcgctctgtctccc 1826
>gb|AF378877.1|AF378877 Arabidopsis thaliana AT3g06200/F28L1_14 mRNA, complete cds Length = 1209 Score = 44.1 bits (22), Expect = 1.3 Identities = 79/98 (80%) Strand = Plus / Plus Query: 600 cttgtttatggggaatataaggggattcccaagcagcagatccgcgattacatggccaaa 659 ||||||||||| ||||| || |||||||| ||| ||||||| | || | ||||||||| Sbjct: 555 cttgtttatggagaatacaaagggattccaaagaagcagattcaggaatttatggccaaa 614 Query: 660 ggacatgacattgtcttgagggtggatattcaaggagc 697 || | |||||||| | || || |||||||||||||| Sbjct: 615 ggggaagacattgttcttagagttgatattcaaggagc 652
>emb|AL773523.4| Mouse DNA sequence from clone RP23-186B18 on chromosome 2, complete sequence Length = 198403 Score = 44.1 bits (22), Expect = 1.3 Identities = 25/26 (96%) Strand = Plus / Minus Query: 143 ctctgccctcgctcgctctgtctccc 168 |||||||||| ||||||||||||||| Sbjct: 9841 ctctgccctcactcgctctgtctccc 9816
>emb|CT831748.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN043G08, full insert sequence Length = 1393 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ggcgccgccgccggagccgat 394 ||||||||||||||||||||| Sbjct: 105 ggcgccgccgccggagccgat 125
>ref|XM_001229300.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_02785) mRNA, complete cds Length = 834 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 328 gggggctggaggcggcgctgg 348 ||||||||||||||||||||| Sbjct: 533 gggggctggaggcggcgctgg 553
>dbj|AK240855.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J065021H02, full insert sequence Length = 1930 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 ctggcgccgccgccggagccg 392 ||||||||||||||||||||| Sbjct: 118 ctggcgccgccgccggagccg 138
>ref|NM_001070359.1| Oryza sativa (japonica cultivar-group) Os09g0542800 (Os09g0542800) mRNA, complete cds Length = 1632 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 ctggcgccgccgccggagccg 392 ||||||||||||||||||||| Sbjct: 85 ctggcgccgccgccggagccg 105
>ref|NM_001069730.1| Oryza sativa (japonica cultivar-group) Os09g0420200 (Os09g0420200) mRNA, partial cds Length = 1686 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ccgctggcgccgccgccggag 389 ||||||||||||||||||||| Sbjct: 271 ccgctggcgccgccgccggag 251
>ref|NM_001057239.1| Oryza sativa (japonica cultivar-group) Os03g0626800 (Os03g0626800) mRNA, complete cds Length = 1492 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ggcgccgccgccggagccgat 394 ||||||||||||||||||||| Sbjct: 149 ggcgccgccgccggagccgat 169
>ref|XM_001073857.1| PREDICTED: Rattus norvegicus similar to mKIAA2025 protein (predicted) (RGD1563512_predicted), mRNA Length = 4264 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 328 gggggctggaggcggcgctgg 348 ||||||||||||||||||||| Sbjct: 99 gggggctggaggcggcgctgg 119
>ref|XM_001057889.1| PREDICTED: Rattus norvegicus hypothetical protein LOC680586 (LOC680586), mRNA Length = 751 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 328 gggggctggaggcggcgctgg 348 ||||||||||||||||||||| Sbjct: 159 gggggctggaggcggcgctgg 179
>gb|AC167537.7| Mus musculus chromosome 8, clone RP23-99B10, complete sequence Length = 201791 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1253 aatttccattttgtattttca 1273 ||||||||||||||||||||| Sbjct: 194196 aatttccattttgtattttca 194176
>gb|AC091246.8| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0002I03 map E1419S, complete sequence Length = 150945 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ggcgccgccgccggagccgat 394 ||||||||||||||||||||| Sbjct: 144508 ggcgccgccgccggagccgat 144528
>gb|AC134443.3| Mus musculus BAC clone RP24-107B13 from chromosome 8, complete sequence Length = 182604 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1253 aatttccattttgtattttca 1273 ||||||||||||||||||||| Sbjct: 74261 aatttccattttgtattttca 74281
>gb|AY317098.1| Foot-and-mouth disease virus HKN/2002, complete genome Length = 8104 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 941 gaaggcaaaagtccagaagcg 961 ||||||||||||||||||||| Sbjct: 1618 gaaggcaaaagtccagaagcg 1638
>gb|AC149058.7| Mus musculus BAC clone RP23-338G5 from chromosome 7, complete sequence Length = 219369 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 751 cagagagcgaggaggcacttg 771 ||||||||||||||||||||| Sbjct: 144205 cagagagcgaggaggcacttg 144225
>gb|AC089993.2| Bos taurus clone RP42-553M7, complete sequence Length = 162859 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1250 tataatttccattttgtattt 1270 ||||||||||||||||||||| Sbjct: 85955 tataatttccattttgtattt 85975
>gb|AC121828.3| Mus musculus BAC clone RP23-478K4 from chromosome 1, complete sequence Length = 179626 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1256 ttccattttgtattttcagaa 1276 ||||||||||||||||||||| Sbjct: 128341 ttccattttgtattttcagaa 128361
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ccgctggcgccgccgccggag 389 ||||||||||||||||||||| Sbjct: 3787359 ccgctggcgccgccgccggag 3787339
>gb|AC008083.23| Homo sapiens 12 BAC RP11-493L12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192046 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1255 tttccattttgtattttcaga 1275 ||||||||||||||||||||| Sbjct: 10072 tttccattttgtattttcaga 10052
>dbj|AK139648.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library, clone:B020008A02 product:weakly similar to Membrane-associated nucleic acid binding protein (Fragment) [Homo sapiens], full insert sequence Length = 4055 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 328 gggggctggaggcggcgctgg 348 ||||||||||||||||||||| Sbjct: 99 gggggctggaggcggcgctgg 119
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9 Length = 22696651 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ccgctggcgccgccgccggag 389 ||||||||||||||||||||| Sbjct: 15075260 ccgctggcgccgccgccggag 15075240 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 ctggcgccgccgccggagccg 392 ||||||||||||||||||||| Sbjct: 21081810 ctggcgccgccgccggagccg 21081790
>dbj|AK173335.1| Mus musculus mRNA for mKIAA2025 protein Length = 4076 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 328 gggggctggaggcggcgctgg 348 ||||||||||||||||||||| Sbjct: 73 gggggctggaggcggcgctgg 93
>emb|AL157701.2| Human DNA sequence from clone RP4-628F15 on chromosome X Contains part of a novel gene, complete sequence Length = 93008 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1026 tctagtgcgatgaaattagga 1046 ||||||||||||||||||||| Sbjct: 75022 tctagtgcgatgaaattagga 75002
>emb|AL122007.7|HSJ757N13 Human DNA sequence from clone RP4-757N13 on chromosome 1p13.1-13.3 Contains the 3' end of the GDAP2 gene for ganglioside induced differentiation associated protein 2, complete sequence Length = 69867 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 446 gaggctgcaagaggagaggga 466 ||||||||||||||||||||| Sbjct: 3726 gaggctgcaagaggagaggga 3746
>gb|AC092390.3| Oryza sativa chromosome 3 BAC OSJNBb0013K08 genomic sequence, complete sequence Length = 120116 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ggcgccgccgccggagccgat 394 ||||||||||||||||||||| Sbjct: 28479 ggcgccgccgccggagccgat 28499
>gb|AC026222.5| Homo sapiens chromosome 12 clone RP11-543D1, complete sequence Length = 168085 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1255 tttccattttgtattttcaga 1275 ||||||||||||||||||||| Sbjct: 43983 tttccattttgtattttcaga 44003
>emb|AL713987.7| Zebrafish DNA sequence from clone BUSM1-145B16 in linkage group 9, complete sequence Length = 113891 Score = 42.1 bits (21), Expect = 5.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 727 ctgcaattttcatctttctagttgc 751 ||||| ||||||||||||||||||| Sbjct: 11741 ctgcagttttcatctttctagttgc 11765
>emb|BX572097.1| Prochlorococcus marinus MIT9313 complete genome; segment 3/7 Length = 349823 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 429 aaggatgcggtcatcaagagg 449 ||||||||||||||||||||| Sbjct: 136861 aaggatgcggtcatcaagagg 136841
>gb|AC119204.7| Mus musculus chromosome 1, clone RP24-188H2, complete sequence Length = 178603 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 328 gggggctggaggcggcgctgg 348 ||||||||||||||||||||| Sbjct: 87134 gggggctggaggcggcgctgg 87114
>ref|NM_001024952.1| Mus musculus RING CCCH (C3H) domains 1 (Rc3h1), mRNA gb|AY948287.1| Mus musculus roquin (Rc3h1) mRNA, complete cds Length = 3830 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 328 gggggctggaggcggcgctgg 348 ||||||||||||||||||||| Sbjct: 68 gggggctggaggcggcgctgg 88
>emb|AL669907.6| Mouse DNA sequence from clone RP23-245A5 on chromosome 11 Contains part of a crumbs-like protein precursor pseudogene, complete sequence Length = 156193 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1252 taatttccattttgtattttc 1272 ||||||||||||||||||||| Sbjct: 90333 taatttccattttgtattttc 90353
>dbj|AP005426.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0668D04 Length = 148848 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ccgctggcgccgccgccggag 389 ||||||||||||||||||||| Sbjct: 66903 ccgctggcgccgccgccggag 66883
>dbj|AP005429.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0701F11 Length = 154950 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ccgctggcgccgccgccggag 389 ||||||||||||||||||||| Sbjct: 144706 ccgctggcgccgccgccggag 144686
>dbj|AK112092.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-B01, full insert sequence Length = 1492 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ggcgccgccgccggagccgat 394 ||||||||||||||||||||| Sbjct: 149 ggcgccgccgccggagccgat 169
>dbj|AK111916.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133I20, full insert sequence Length = 1393 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ggcgccgccgccggagccgat 394 ||||||||||||||||||||| Sbjct: 68 ggcgccgccgccggagccgat 88
>dbj|AK068903.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170N17, full insert sequence Length = 1690 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ccgctggcgccgccgccggag 389 ||||||||||||||||||||| Sbjct: 275 ccgctggcgccgccgccggag 255
>emb|BX294131.7| Zebrafish DNA sequence from clone CH211-254O18, complete sequence Length = 164141 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 834 gccagagaggaggtgagacgg 854 ||||||||||||||||||||| Sbjct: 90149 gccagagaggaggtgagacgg 90169
>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone: P0478E02 Length = 140715 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 ctggcgccgccgccggagccg 392 ||||||||||||||||||||| Sbjct: 103110 ctggcgccgccgccggagccg 103090
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ccgctggcgccgccgccggag 389 ||||||||||||||||||||| Sbjct: 3787965 ccgctggcgccgccgccggag 3787945
>gb|AC116556.14| Mus musculus strain C57BL/6J chromosome 8 clone rp23-184i13, complete sequence Length = 239958 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1256 ttccattttgtattttcagaa 1276 ||||||||||||||||||||| Sbjct: 235945 ttccattttgtattttcagaa 235925
>gb|AC003670.1|AC003670 Homo sapiens 12q13.1 PAC RPCI1-130F5 (Roswell Park Cancer Institute Human PAC library) complete sequence Length = 88945 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1255 tttccattttgtattttcaga 1275 ||||||||||||||||||||| Sbjct: 38923 tttccattttgtattttcaga 38943
>gb|AC168046.7| Mus musculus chromosome 8, clone RP24-335A7, complete sequence Length = 160659 Score = 42.1 bits (21), Expect = 5.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1253 aatttccattttgtattttca 1273 ||||||||||||||||||||| Sbjct: 102075 aatttccattttgtattttca 102055 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 219,200,637 Number of extensions: 12835895 Number of successful extensions: 303074 Number of sequences better than 10.0: 55 Number of HSP's gapped: 303070 Number of HSP's successfully gapped: 61 Length of query: 1341 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 1318 Effective length of database: 18,503,978,556 Effective search space: 24388243736808 Effective search space used: 24388243736808 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)