ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf84c13 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_001050173.1| Oryza sativa (japonica cultivar-group) Os01g0628900 (Os01g0628900) mRNA, complete cds Length = 1752 Score = 289 bits (146), Expect = 8e-75 Identities = 465/570 (81%), Gaps = 1/570 (0%) Strand = Plus / Plus Query: 58 tggagtccaacataaaagaaagccaagaagccggaagctccacgccgacgatgaccaccg 117 ||||| ||||||| || || ||||||||||| |||||||||| ||| || |||||||| Sbjct: 936 tggagaccaacatcaaggagagccaagaagctggaagctccaagccaaccatgaccacga 995 Query: 118 aggacattgtaggggagctgaagctcttctatttcgcgggcatggagaccaccgcggtgc 177 ||||||| | | |||||||||||| |||| || || || ||| || ||||||||| Sbjct: 996 aggacatcatcgaggagctgaagctgctctactttgcaggatcggatacaaccgcggtgt 1055 Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| Sbjct: 1056 tgctcacatggacaatggtcctcctaagcatgcaccccgagtggcaggaccgtgccaggg 1115 Query: 238 aggaggttctacgggtcttcggagacaaacaacctgattatgagggcatgaaccggctga 297 ||||||| || || || |||||| | || || |||| |||||||| |||| || | Sbjct: 1116 aggaggtgctgcgcgttttcggaaagaacagtccagatttcgagggcataaaccatctca 1175 Query: 298 aagttgtgacaatgatacttcatgaggttcttaggctatacccaccaattctactactta 357 |||| ||||| |||||| | || |||||||||||||| || ||||| || || || ||| Sbjct: 1176 aagtcgtgaccatgatattacacgaggttcttaggctgtatccaccgatcctgctgcttg 1235 Query: 358 gccgggaggcgtatgaggagacggagctgggaggg-tcacatatccagccggcgtaacat 416 |||| ||||| || || ||||| ||||| |||||| |||| |||||| | || || |||| Sbjct: 1236 gccgagaggcatacgaagagaccgagctcggaggggtcacgtatccaccgggggtgacat 1295 Query: 417 ttgccttgccaattgtgtgcattcaccatgatccagacgtgtggggagaagatgtggatg 476 | || ||||| || | | |||| ||||| ||||||||||||||||||||||| || | | Sbjct: 1296 tcgcgttgccgatcgcgggcatccaccacgatccagacgtgtggggagaagacgtcggcg 1355 Query: 477 aatttaagccggagaggtttgctgagggtatcgccggcgcgtccaagatctcgccggcgt 536 | || |||||||||||||| || ||||| || || | ||||||||| ||| ||||||| Sbjct: 1356 agttcaagccggagaggttcgcggagggcgtctccagggcgtccaaggactcaccggcgt 1415 Query: 537 tctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgagg 596 | |||| ||| ||||||| || |||||||||||||| |||||||| |||||||| |||| Sbjct: 1416 tggttcccttcagttgggggccacggatctgtgtcggccagaacttcgcgttgctggagg 1475 Query: 597 ccaagatgggattgagcgtgatcctgcaac 626 ||||||||| ||||| |||||||||||| Sbjct: 1476 ccaagatggcgctgagcatgatcctgcaac 1505
>dbj|AK060213.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-C03, full insert sequence Length = 1758 Score = 289 bits (146), Expect = 8e-75 Identities = 465/570 (81%), Gaps = 1/570 (0%) Strand = Plus / Plus Query: 58 tggagtccaacataaaagaaagccaagaagccggaagctccacgccgacgatgaccaccg 117 ||||| ||||||| || || ||||||||||| |||||||||| ||| || |||||||| Sbjct: 936 tggagaccaacatcaaggagagccaagaagctggaagctccaagccaaccatgaccacga 995 Query: 118 aggacattgtaggggagctgaagctcttctatttcgcgggcatggagaccaccgcggtgc 177 ||||||| | | |||||||||||| |||| || || || ||| || ||||||||| Sbjct: 996 aggacatcatcgaggagctgaagctgctctactttgcaggatcggatacaaccgcggtgt 1055 Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| Sbjct: 1056 tgctcacatggacaatggtcctcctaagcatgcaccccgagtggcaggaccgtgccaggg 1115 Query: 238 aggaggttctacgggtcttcggagacaaacaacctgattatgagggcatgaaccggctga 297 ||||||| || || || |||||| | || || |||| |||||||| |||| || | Sbjct: 1116 aggaggtgctgcgcgttttcggaaagaacagtccagatttcgagggcataaaccatctca 1175 Query: 298 aagttgtgacaatgatacttcatgaggttcttaggctatacccaccaattctactactta 357 |||| ||||| |||||| | || |||||||||||||| || ||||| || || || ||| Sbjct: 1176 aagtcgtgaccatgatattacacgaggttcttaggctgtatccaccgatcctgctgcttg 1235 Query: 358 gccgggaggcgtatgaggagacggagctgggaggg-tcacatatccagccggcgtaacat 416 |||| ||||| || || ||||| ||||| |||||| |||| |||||| | || || |||| Sbjct: 1236 gccgagaggcatacgaagagaccgagctcggaggggtcacgtatccaccgggggtgacat 1295 Query: 417 ttgccttgccaattgtgtgcattcaccatgatccagacgtgtggggagaagatgtggatg 476 | || ||||| || | | |||| ||||| ||||||||||||||||||||||| || | | Sbjct: 1296 tcgcgttgccgatcgcgggcatccaccacgatccagacgtgtggggagaagacgtcggcg 1355 Query: 477 aatttaagccggagaggtttgctgagggtatcgccggcgcgtccaagatctcgccggcgt 536 | || |||||||||||||| || ||||| || || | ||||||||| ||| ||||||| Sbjct: 1356 agttcaagccggagaggttcgcggagggcgtctccagggcgtccaaggactcaccggcgt 1415 Query: 537 tctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgagg 596 | |||| ||| ||||||| || |||||||||||||| |||||||| |||||||| |||| Sbjct: 1416 tggttcccttcagttgggggccacggatctgtgtcggccagaacttcgcgttgctggagg 1475 Query: 597 ccaagatgggattgagcgtgatcctgcaac 626 ||||||||| ||||| |||||||||||| Sbjct: 1476 ccaagatggcgctgagcatgatcctgcaac 1505
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 161 bits (81), Expect = 5e-36 Identities = 265/325 (81%), Gaps = 1/325 (0%) Strand = Plus / Plus Query: 303 gtgacaatgatacttcatgaggttcttaggctatacccaccaattctactacttagccgg 362 ||||| |||||| | || |||||||||||||| || ||||| || || || ||| |||| Sbjct: 25117459 gtgaccatgatattacacgaggttcttaggctgtatccaccgatcctgctgcttggccga 25117518 Query: 363 gaggcgtatgaggagacggagctgggaggg-tcacatatccagccggcgtaacatttgcc 421 ||||| || || ||||| ||||| |||||| |||| |||||| | || || ||||| || Sbjct: 25117519 gaggcatacgaagagaccgagctcggaggggtcacgtatccaccgggggtgacattcgcg 25117578 Query: 422 ttgccaattgtgtgcattcaccatgatccagacgtgtggggagaagatgtggatgaattt 481 ||||| || | | |||| ||||| ||||||||||||||||||||||| || | || || Sbjct: 25117579 ttgccgatcgcgggcatccaccacgatccagacgtgtggggagaagacgtcggcgagttc 25117638 Query: 482 aagccggagaggtttgctgagggtatcgccggcgcgtccaagatctcgccggcgttcttt 541 |||||||||||||| || ||||| || || | ||||||||| ||| |||||||| || Sbjct: 25117639 aagccggagaggttcgcggagggcgtctccagggcgtccaaggactcaccggcgttggtt 25117698 Query: 542 ccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaag 601 || ||| ||||||| || |||||||||||||| |||||||| |||||||| ||||||||| Sbjct: 25117699 cccttcagttgggggccacggatctgtgtcggccagaacttcgcgttgctggaggccaag 25117758 Query: 602 atgggattgagcgtgatcctgcaac 626 |||| ||||| |||||||||||| Sbjct: 25117759 atggcgctgagcatgatcctgcaac 25117783 Score = 157 bits (79), Expect = 8e-35 Identities = 160/187 (85%) Strand = Plus / Plus Query: 58 tggagtccaacataaaagaaagccaagaagccggaagctccacgccgacgatgaccaccg 117 ||||| ||||||| || || ||||||||||| |||||||||| ||| || |||||||| Sbjct: 25117138 tggagaccaacatcaaggagagccaagaagctggaagctccaagccaaccatgaccacga 25117197 Query: 118 aggacattgtaggggagctgaagctcttctatttcgcgggcatggagaccaccgcggtgc 177 ||||||| | | |||||||||||| |||| || || || ||| || ||||||||| Sbjct: 25117198 aggacatcatcgaggagctgaagctgctctactttgcaggatcggatacaaccgcggtgt 25117257 Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| Sbjct: 25117258 tgctcacatggacaatggtcctcctaagcatgcaccccgagtggcaggaccgtgccaggg 25117317 Query: 238 aggaggt 244 ||||||| Sbjct: 25117318 aggaggt 25117324 Score = 93.7 bits (47), Expect = 9e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| ||||| ||| ||||||| ||||||||||| Sbjct: 25039132 aagctgttctacttcgccgggatggagacaaccgccgtgttgctcacctggacaatggtt 25039191 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttctacgggtctt 256 ||| |||||||| || ||||||||||| ||||||||||||||| |||| | |||||| Sbjct: 25039192 gccctgagcatgcacccggagtggcaggatcgcgccagggaggagattctgcaggtctt 25039250 Score = 93.7 bits (47), Expect = 9e-16 Identities = 92/107 (85%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| |||||| Sbjct: 25113500 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgatggtc 25113559 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | || |||||| || |||||||||||||||||| |||||||||| Sbjct: 25113560 gtgctctccatgcacccggagtggcaggaccgcgcccgggaggaggt 25113606 Score = 77.8 bits (39), Expect = 6e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| | ||| Sbjct: 25058692 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgctcgtc 25058751 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | ||| |||||| ||||| |||||| ||||||||||||| ||||| Sbjct: 25058752 gtgctatccatgcaccccgaatggcagcaccgcgccagggaagaggt 25058798 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 532 ggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgct 591 ||||||||| |||||||||||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 25059201 ggcgttcttcccgttcggttggggcccgaggatctgcattggccagaacttcgcgatgct 25059260 Query: 592 tgaggccaagatgg 605 |||||||||||||| Sbjct: 25059261 tgaggccaagatgg 25059274 Score = 73.8 bits (37), Expect = 9e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||||||||| ||||| |||| || ||||| ||||||||||||||||||||| Sbjct: 23669585 ttcggttggggaccgcgaatctgcatcggccaaaacttcgcgttgcttgaggccaagatg 23669526 Query: 605 g 605 | Sbjct: 23669525 g 23669525 Score = 69.9 bits (35), Expect = 1e-08 Identities = 68/79 (86%) Strand = Plus / Plus Query: 528 cgccggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgt 587 ||||||| ||||| |||||||| ||||| ||| ||||||| |||| |||||||| ||| Sbjct: 25113977 cgccggccttcttcccgttcgggtgggggccgaggatctgcatcggccagaacttcgcgc 25114036 Query: 588 tgcttgaggccaagatggg 606 |||| |||||||||||||| Sbjct: 25114037 tgctcgaggccaagatggg 25114055 Score = 67.9 bits (34), Expect = 5e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 540 ttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggcca 599 |||| ||||||||||||||||| ||||| |||| || ||||| || ||||||||||||| Sbjct: 23678710 ttccattcggttggggaccgcgaatctgcatcggccaaaacttcgcattgcttgaggcca 23678651 Query: 600 agatgg 605 |||||| Sbjct: 23678650 agatgg 23678645 Score = 67.9 bits (34), Expect = 5e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| || | ||||||||||||||||| ||||| Sbjct: 25073778 aagctgttctacttcgcaggaatggagacaacgtcagtgctgctcacatggaccatggtt 25073837 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttct 247 | || |||||||| || || ||||| ||||| || |||||||||||||| Sbjct: 25073838 gttctgagcatgcacccggaatggcaagaccgtgcaagggaggaggttct 25073887 Score = 58.0 bits (29), Expect = 5e-05 Identities = 83/101 (82%) Strand = Plus / Minus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 |||||||| || || |||||||| || ||| | || ||||||||||| ||||| | ||| Sbjct: 25052816 ttctattttgcagggatggagacgacagcgatactcctcacatggaccatggttgtgcta 25052757 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || || |||||| |||| || ||||||||||| Sbjct: 25052756 agcatgcacccagaatggcagcaccgtgcaagggaggaggt 25052716 Score = 54.0 bits (27), Expect = 8e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| |||||||| |||||||| || | ||||| ||||| ||||| || | |||||| Sbjct: 25063591 ttctacttcgcgggaatggagacaacgtcagtgctactcacctggactatcctgctccta 25063650 Query: 204 agcatgcatcccgagtggcaggaccgcgccaggga 238 |||||||| || |||||||| ||||| || ||||| Sbjct: 25063651 agcatgcacccagagtggcaagaccgtgcaaggga 25063685 Score = 54.0 bits (27), Expect = 8e-04 Identities = 75/91 (82%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| || | ||||| ||||||||||| ||| | Sbjct: 25068116 aagctgttctacttcgcaggaatggagacaacatcagtgctactcacatggaccatgctg 25068175 Query: 198 ctcctaagcatgcatcccgagtggcaggacc 228 || ||||||||||| || |||||||| |||| Sbjct: 25068176 ctgctaagcatgcacccagagtggcaagacc 25068206 Score = 50.1 bits (25), Expect = 0.013 Identities = 46/53 (86%) Strand = Plus / Minus Query: 174 gtgctgctcacatggacaatggtcctcctaagcatgcatcccgagtggcagga 226 ||||| ||||||||||| ||| | || |||||||||| |||||||||||||| Sbjct: 23679185 gtgcttctcacatggaccatgctgctattaagcatgcaccccgagtggcagga 23679133 Score = 50.1 bits (25), Expect = 0.013 Identities = 61/73 (83%) Strand = Plus / Minus Query: 533 gcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgctt 592 |||||||| ||||| || ||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 25052294 gcgttcttcccgtttggctggggcccgaggatctgcatgggccagaacttcgcgctgctc 25052235 Query: 593 gaggccaagatgg 605 ||||||||||||| Sbjct: 25052234 gaggccaagatgg 25052222 Score = 44.1 bits (22), Expect = 0.78 Identities = 55/66 (83%) Strand = Plus / Minus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||| || || ||||| |||| || ||||| ||| |||||||| |||||||| Sbjct: 23659570 ttcggttgggggccacgaatctgcatcggccaaaacttcgcgctgcttgagtccaagatg 23659511 Query: 605 ggattg 610 | |||| Sbjct: 23659510 gcattg 23659505 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 303 gtgacaatgatacttcatgaggttcttaggctatacccacc 343 ||||||||||| || |||||||||||||| | |||||||| Sbjct: 23669828 gtgacaatgatcctctatgaggttcttaggttgtacccacc 23669788 Score = 42.1 bits (21), Expect = 3.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 202 taagcatgcatcccgagtggcagga 226 |||||||||| |||||||||||||| Sbjct: 23670037 taagcatgcaccccgagtggcagga 23670013 Score = 42.1 bits (21), Expect = 3.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 578 aactttgcgttgcttgaggccaagatgggattg 610 ||||| || ||||||||||||||||||| |||| Sbjct: 25064133 aacttcgcattgcttgaggccaagatggcattg 25064165
>dbj|AP002839.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0688A04 Length = 143969 Score = 161 bits (81), Expect = 5e-36 Identities = 265/325 (81%), Gaps = 1/325 (0%) Strand = Plus / Plus Query: 303 gtgacaatgatacttcatgaggttcttaggctatacccaccaattctactacttagccgg 362 ||||| |||||| | || |||||||||||||| || ||||| || || || ||| |||| Sbjct: 117067 gtgaccatgatattacacgaggttcttaggctgtatccaccgatcctgctgcttggccga 117126 Query: 363 gaggcgtatgaggagacggagctgggaggg-tcacatatccagccggcgtaacatttgcc 421 ||||| || || ||||| ||||| |||||| |||| |||||| | || || ||||| || Sbjct: 117127 gaggcatacgaagagaccgagctcggaggggtcacgtatccaccgggggtgacattcgcg 117186 Query: 422 ttgccaattgtgtgcattcaccatgatccagacgtgtggggagaagatgtggatgaattt 481 ||||| || | | |||| ||||| ||||||||||||||||||||||| || | || || Sbjct: 117187 ttgccgatcgcgggcatccaccacgatccagacgtgtggggagaagacgtcggcgagttc 117246 Query: 482 aagccggagaggtttgctgagggtatcgccggcgcgtccaagatctcgccggcgttcttt 541 |||||||||||||| || ||||| || || | ||||||||| ||| |||||||| || Sbjct: 117247 aagccggagaggttcgcggagggcgtctccagggcgtccaaggactcaccggcgttggtt 117306 Query: 542 ccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaag 601 || ||| ||||||| || |||||||||||||| |||||||| |||||||| ||||||||| Sbjct: 117307 cccttcagttgggggccacggatctgtgtcggccagaacttcgcgttgctggaggccaag 117366 Query: 602 atgggattgagcgtgatcctgcaac 626 |||| ||||| |||||||||||| Sbjct: 117367 atggcgctgagcatgatcctgcaac 117391 Score = 157 bits (79), Expect = 8e-35 Identities = 160/187 (85%) Strand = Plus / Plus Query: 58 tggagtccaacataaaagaaagccaagaagccggaagctccacgccgacgatgaccaccg 117 ||||| ||||||| || || ||||||||||| |||||||||| ||| || |||||||| Sbjct: 116746 tggagaccaacatcaaggagagccaagaagctggaagctccaagccaaccatgaccacga 116805 Query: 118 aggacattgtaggggagctgaagctcttctatttcgcgggcatggagaccaccgcggtgc 177 ||||||| | | |||||||||||| |||| || || || ||| || ||||||||| Sbjct: 116806 aggacatcatcgaggagctgaagctgctctactttgcaggatcggatacaaccgcggtgt 116865 Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| Sbjct: 116866 tgctcacatggacaatggtcctcctaagcatgcaccccgagtggcaggaccgtgccaggg 116925 Query: 238 aggaggt 244 ||||||| Sbjct: 116926 aggaggt 116932 Score = 93.7 bits (47), Expect = 9e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| ||||| ||| ||||||| ||||||||||| Sbjct: 38740 aagctgttctacttcgccgggatggagacaaccgccgtgttgctcacctggacaatggtt 38799 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttctacgggtctt 256 ||| |||||||| || ||||||||||| ||||||||||||||| |||| | |||||| Sbjct: 38800 gccctgagcatgcacccggagtggcaggatcgcgccagggaggagattctgcaggtctt 38858 Score = 93.7 bits (47), Expect = 9e-16 Identities = 92/107 (85%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| |||||| Sbjct: 113108 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgatggtc 113167 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | || |||||| || |||||||||||||||||| |||||||||| Sbjct: 113168 gtgctctccatgcacccggagtggcaggaccgcgcccgggaggaggt 113214 Score = 77.8 bits (39), Expect = 6e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| | ||| Sbjct: 58300 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgctcgtc 58359 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | ||| |||||| ||||| |||||| ||||||||||||| ||||| Sbjct: 58360 gtgctatccatgcaccccgaatggcagcaccgcgccagggaagaggt 58406 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 532 ggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgct 591 ||||||||| |||||||||||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 58809 ggcgttcttcccgttcggttggggcccgaggatctgcattggccagaacttcgcgatgct 58868 Query: 592 tgaggccaagatgg 605 |||||||||||||| Sbjct: 58869 tgaggccaagatgg 58882 Score = 69.9 bits (35), Expect = 1e-08 Identities = 68/79 (86%) Strand = Plus / Plus Query: 528 cgccggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgt 587 ||||||| ||||| |||||||| ||||| ||| ||||||| |||| |||||||| ||| Sbjct: 113585 cgccggccttcttcccgttcgggtgggggccgaggatctgcatcggccagaacttcgcgc 113644 Query: 588 tgcttgaggccaagatggg 606 |||| |||||||||||||| Sbjct: 113645 tgctcgaggccaagatggg 113663 Score = 67.9 bits (34), Expect = 5e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| || | ||||||||||||||||| ||||| Sbjct: 73386 aagctgttctacttcgcaggaatggagacaacgtcagtgctgctcacatggaccatggtt 73445 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttct 247 | || |||||||| || || ||||| ||||| || |||||||||||||| Sbjct: 73446 gttctgagcatgcacccggaatggcaagaccgtgcaagggaggaggttct 73495 Score = 58.0 bits (29), Expect = 5e-05 Identities = 83/101 (82%) Strand = Plus / Minus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 |||||||| || || |||||||| || ||| | || ||||||||||| ||||| | ||| Sbjct: 52424 ttctattttgcagggatggagacgacagcgatactcctcacatggaccatggttgtgcta 52365 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || || |||||| |||| || ||||||||||| Sbjct: 52364 agcatgcacccagaatggcagcaccgtgcaagggaggaggt 52324 Score = 54.0 bits (27), Expect = 8e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| |||||||| |||||||| || | ||||| ||||| ||||| || | |||||| Sbjct: 63199 ttctacttcgcgggaatggagacaacgtcagtgctactcacctggactatcctgctccta 63258 Query: 204 agcatgcatcccgagtggcaggaccgcgccaggga 238 |||||||| || |||||||| ||||| || ||||| Sbjct: 63259 agcatgcacccagagtggcaagaccgtgcaaggga 63293 Score = 54.0 bits (27), Expect = 8e-04 Identities = 75/91 (82%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| || | ||||| ||||||||||| ||| | Sbjct: 67724 aagctgttctacttcgcaggaatggagacaacatcagtgctactcacatggaccatgctg 67783 Query: 198 ctcctaagcatgcatcccgagtggcaggacc 228 || ||||||||||| || |||||||| |||| Sbjct: 67784 ctgctaagcatgcacccagagtggcaagacc 67814 Score = 50.1 bits (25), Expect = 0.013 Identities = 61/73 (83%) Strand = Plus / Minus Query: 533 gcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgctt 592 |||||||| ||||| || ||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 51902 gcgttcttcccgtttggctggggcccgaggatctgcatgggccagaacttcgcgctgctc 51843 Query: 593 gaggccaagatgg 605 ||||||||||||| Sbjct: 51842 gaggccaagatgg 51830 Score = 42.1 bits (21), Expect = 3.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 578 aactttgcgttgcttgaggccaagatgggattg 610 ||||| || ||||||||||||||||||| |||| Sbjct: 63741 aacttcgcattgcttgaggccaagatggcattg 63773
>gb|AY107534.1| Zea mays PCO060976 mRNA sequence Length = 861 Score = 125 bits (63), Expect = 3e-25 Identities = 96/107 (89%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||||||||| ||||| |||||||||||||| ||||||||||||| ||||| | ||| Sbjct: 173 aagctcttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgctcgtc 232 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 ||||| ||||||| |||||||||||||||||||||||||||||||| Sbjct: 233 atcctaggcatgcaccccgagtggcaggaccgcgccagggaggaggt 279 Score = 73.8 bits (37), Expect = 9e-10 Identities = 67/77 (87%) Strand = Plus / Plus Query: 529 gccggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgtt 588 |||||||||||| |||||||| ||||| ||| ||||||| |||| |||||||| ||| | Sbjct: 571 gccggcgttcttcccgttcggctggggcccgaggatctgcatcggccagaacttcgcgct 630 Query: 589 gcttgaggccaagatgg 605 ||| ||||||||||||| Sbjct: 631 gctcgaggccaagatgg 647
>gb|AY108071.1| Zea mays PCO074412 mRNA sequence Length = 608 Score = 105 bits (53), Expect = 2e-19 Identities = 89/101 (88%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| ||||| || |||||||||||||| ||||||||||| |||||| ||| | | ||| Sbjct: 184 ttctacttcgcagggatggagaccaccgccgtgctgctcacttggacagtggccgtgcta 243 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || |||||||||||||| |||||||||||||| Sbjct: 244 agcatgcacccggagtggcaggaccgtgccagggaggaggt 284
>gb|AY071866.1| Zea mays cytochrome P450 monooxygenase CYP72A26 gene, complete cds Length = 3467 Score = 97.6 bits (49), Expect = 6e-17 Identities = 88/101 (87%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| |||||||| ||||||||||| ||||||||||||| ||||| ||||| | || Sbjct: 2396 ttctacttcgcggggatggagaccacgtcggtgctgctcacgtggacgatggtggtgctc 2455 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || ||||||||||||||||| ||||||||||| Sbjct: 2456 agcatgcacccggagtggcaggaccgcgcgagggaggaggt 2496 Score = 50.1 bits (25), Expect = 0.013 Identities = 52/61 (85%) Strand = Plus / Plus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||| ||||| ||||| ||||| |||| |||||||| ||| |||| |||||||||||| Sbjct: 2944 ttcggctggggcccgcgcatctgcatcggccagaacttcgcgctgctagaggccaagatg 3003 Query: 605 g 605 | Sbjct: 3004 g 3004
>dbj|AK243026.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J100002I07, full insert sequence Length = 2049 Score = 93.7 bits (47), Expect = 9e-16 Identities = 92/107 (85%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| |||||| Sbjct: 1167 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgatggtc 1226 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | || |||||| || |||||||||||||||||| |||||||||| Sbjct: 1227 gtgctctccatgcacccggagtggcaggaccgcgcccgggaggaggt 1273 Score = 69.9 bits (35), Expect = 1e-08 Identities = 68/79 (86%) Strand = Plus / Plus Query: 528 cgccggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgt 587 ||||||| ||||| |||||||| ||||| ||| ||||||| |||| |||||||| ||| Sbjct: 1558 cgccggccttcttcccgttcgggtgggggccgaggatctgcatcggccagaacttcgcgc 1617 Query: 588 tgcttgaggccaagatggg 606 |||| |||||||||||||| Sbjct: 1618 tgctcgaggccaagatggg 1636
>ref|NM_001050172.1| Oryza sativa (japonica cultivar-group) Os01g0628700 (Os01g0628700) mRNA, complete cds Length = 1596 Score = 93.7 bits (47), Expect = 9e-16 Identities = 92/107 (85%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| |||||| Sbjct: 1003 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgatggtc 1062 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | || |||||| || |||||||||||||||||| |||||||||| Sbjct: 1063 gtgctctccatgcacccggagtggcaggaccgcgcccgggaggaggt 1109 Score = 69.9 bits (35), Expect = 1e-08 Identities = 68/79 (86%) Strand = Plus / Plus Query: 528 cgccggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgt 587 ||||||| ||||| |||||||| ||||| ||| ||||||| |||| |||||||| ||| Sbjct: 1394 cgccggccttcttcccgttcgggtgggggccgaggatctgcatcggccagaacttcgcgc 1453 Query: 588 tgcttgaggccaagatggg 606 |||| |||||||||||||| Sbjct: 1454 tgctcgaggccaagatggg 1472
>ref|NM_001050166.1| Oryza sativa (japonica cultivar-group) Os01g0627400 (Os01g0627400) mRNA, complete cds Length = 1900 Score = 93.7 bits (47), Expect = 9e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| ||||| ||| ||||||| ||||||||||| Sbjct: 1113 aagctgttctacttcgccgggatggagacaaccgccgtgttgctcacctggacaatggtt 1172 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttctacgggtctt 256 ||| |||||||| || ||||||||||| ||||||||||||||| |||| | |||||| Sbjct: 1173 gccctgagcatgcacccggagtggcaggatcgcgccagggaggagattctgcaggtctt 1231
>dbj|AP002744.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0006C01 Length = 153865 Score = 93.7 bits (47), Expect = 9e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| ||||| ||| ||||||| ||||||||||| Sbjct: 111655 aagctgttctacttcgccgggatggagacaaccgccgtgttgctcacctggacaatggtt 111714 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttctacgggtctt 256 ||| |||||||| || ||||||||||| ||||||||||||||| |||| | |||||| Sbjct: 111715 gccctgagcatgcacccggagtggcaggatcgcgccagggaggagattctgcaggtctt 111773 Score = 77.8 bits (39), Expect = 6e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| | ||| Sbjct: 131215 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgctcgtc 131274 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | ||| |||||| ||||| |||||| ||||||||||||| ||||| Sbjct: 131275 gtgctatccatgcaccccgaatggcagcaccgcgccagggaagaggt 131321 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 532 ggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgct 591 ||||||||| |||||||||||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 131724 ggcgttcttcccgttcggttggggcccgaggatctgcattggccagaacttcgcgatgct 131783 Query: 592 tgaggccaagatgg 605 |||||||||||||| Sbjct: 131784 tgaggccaagatgg 131797 Score = 67.9 bits (34), Expect = 5e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| || | ||||||||||||||||| ||||| Sbjct: 146301 aagctgttctacttcgcaggaatggagacaacgtcagtgctgctcacatggaccatggtt 146360 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttct 247 | || |||||||| || || ||||| ||||| || |||||||||||||| Sbjct: 146361 gttctgagcatgcacccggaatggcaagaccgtgcaagggaggaggttct 146410 Score = 58.0 bits (29), Expect = 5e-05 Identities = 83/101 (82%) Strand = Plus / Minus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 |||||||| || || |||||||| || ||| | || ||||||||||| ||||| | ||| Sbjct: 125339 ttctattttgcagggatggagacgacagcgatactcctcacatggaccatggttgtgcta 125280 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || || |||||| |||| || ||||||||||| Sbjct: 125279 agcatgcacccagaatggcagcaccgtgcaagggaggaggt 125239 Score = 54.0 bits (27), Expect = 8e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| |||||||| |||||||| || | ||||| ||||| ||||| || | |||||| Sbjct: 136114 ttctacttcgcgggaatggagacaacgtcagtgctactcacctggactatcctgctccta 136173 Query: 204 agcatgcatcccgagtggcaggaccgcgccaggga 238 |||||||| || |||||||| ||||| || ||||| Sbjct: 136174 agcatgcacccagagtggcaagaccgtgcaaggga 136208 Score = 54.0 bits (27), Expect = 8e-04 Identities = 75/91 (82%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| || | ||||| ||||||||||| ||| | Sbjct: 140639 aagctgttctacttcgcaggaatggagacaacatcagtgctactcacatggaccatgctg 140698 Query: 198 ctcctaagcatgcatcccgagtggcaggacc 228 || ||||||||||| || |||||||| |||| Sbjct: 140699 ctgctaagcatgcacccagagtggcaagacc 140729 Score = 50.1 bits (25), Expect = 0.013 Identities = 61/73 (83%) Strand = Plus / Minus Query: 533 gcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgctt 592 |||||||| ||||| || ||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 124817 gcgttcttcccgtttggctggggcccgaggatctgcatgggccagaacttcgcgctgctc 124758 Query: 593 gaggccaagatgg 605 ||||||||||||| Sbjct: 124757 gaggccaagatgg 124745 Score = 42.1 bits (21), Expect = 3.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 578 aactttgcgttgcttgaggccaagatgggattg 610 ||||| || ||||||||||||||||||| |||| Sbjct: 136656 aacttcgcattgcttgaggccaagatggcattg 136688
>dbj|AK074025.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L02, full insert sequence Length = 1901 Score = 93.7 bits (47), Expect = 9e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || |||||||| ||||| ||| ||||||| ||||||||||| Sbjct: 1114 aagctgttctacttcgccgggatggagacaaccgccgtgttgctcacctggacaatggtt 1173 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggttctacgggtctt 256 ||| |||||||| || ||||||||||| ||||||||||||||| |||| | |||||| Sbjct: 1174 gccctgagcatgcacccggagtggcaggatcgcgccagggaggagattctgcaggtctt 1232
>gb|AF465267.1| Zea mays cytochrome P450 monooxygenase CYP72A28 gene, partial cds Length = 2742 Score = 85.7 bits (43), Expect = 2e-13 Identities = 91/107 (85%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| || ||||||||||| ||||||||||||| ||||| |||||| Sbjct: 1625 aagctgttctacttcgccgggatggagaccacgtcggtgctgctcacgtggaccatggtc 1684 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | || |||||| || |||||||||||||| |||||||||||||| Sbjct: 1685 gtgctctccatgcacccggagtggcaggaccgggccagggaggaggt 1731 Score = 46.1 bits (23), Expect = 0.20 Identities = 65/79 (82%) Strand = Plus / Plus Query: 528 cgccggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgt 587 ||||||| ||||| || ||||| ||||| ||||| | ||| |||| |||| ||| ||| Sbjct: 2133 cgccggccttcttccccttcggctggggcccgcgcacctgcatcggccagagcttcgcgc 2192 Query: 588 tgcttgaggccaagatggg 606 |||| |||||||||||||| Sbjct: 2193 tgctcgaggccaagatggg 2211
>gb|AY104671.1| Zea mays PCO144495 mRNA sequence Length = 1567 Score = 83.8 bits (42), Expect = 9e-13 Identities = 75/86 (87%) Strand = Plus / Plus Query: 159 atggagaccaccgcggtgctgctcacatggacaatggtcctcctaagcatgcatcccgag 218 ||||||||||| ||||||||||||| ||||| ||||| | || |||||||| || ||| Sbjct: 793 atggagaccacgtcggtgctgctcacgtggacgatggtggtgctcagcatgcacccggag 852 Query: 219 tggcaggaccgcgccagggaggaggt 244 |||||||||||||| ||||||||||| Sbjct: 853 tggcaggaccgcgcgagggaggaggt 878 Score = 52.0 bits (26), Expect = 0.003 Identities = 53/62 (85%) Strand = Plus / Plus Query: 544 gttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagat 603 |||||||||| | ||||| ||||| |||| |||||||| ||| |||| ||||||||||| Sbjct: 1182 gttcggttggagcccgcgcatctgcatcggccagaacttcgcgctgctggaggccaagat 1241 Query: 604 gg 605 || Sbjct: 1242 gg 1243
>gb|AF123607.1| Triticum aestivum clone CYP72C-TA cytochrome P450 mRNA, complete cds Length = 1892 Score = 83.8 bits (42), Expect = 9e-13 Identities = 66/74 (89%) Strand = Plus / Plus Query: 548 ggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatggga 607 |||||||| || ||||||||| |||| |||||||| |||||||||||||||||||||| | Sbjct: 1477 ggttgggggccacggatctgtatcggccagaacttcgcgttgcttgaggccaagatggca 1536 Query: 608 ttgagcgtgatcct 621 ||| || ||||||| Sbjct: 1537 ttgtgcatgatcct 1550 Score = 60.0 bits (30), Expect = 1e-05 Identities = 60/70 (85%) Strand = Plus / Plus Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||| |||||||||||| | | || |||||||| || |||||||||||||| || |||| Sbjct: 1106 tgcttacatggacaatgattgtgcttagcatgcacccagagtggcaggaccgtgcaaggg 1165 Query: 238 aggaggttct 247 |||||||||| Sbjct: 1166 aggaggttct 1175
>gb|AF123606.1| Triticum aestivum clone CYP72B-TA cytochrome P450 mRNA, complete cds Length = 1858 Score = 83.8 bits (42), Expect = 9e-13 Identities = 135/166 (81%) Strand = Plus / Plus Query: 440 caccatgatccagacgtgtggggagaagatgtggatgaatttaagccggagaggtttgct 499 |||||||| ||||| | ||||||||||||||| | |||| |||||||| |||||||| Sbjct: 1379 caccatgacacagacatctggggagaagatgtgcaccaattcaagccggataggtttgcc 1438 Query: 500 gagggtatcgccggcgcgtccaagatctcgccggcgttctttccgttcggttggggaccg 559 ||||| ||| || ||||||||| | || || || || || ||||||||||| || Sbjct: 1439 gaggggatctccaaggcgtccaaggacccgggcgcatttttcccattcggttgggggcca 1498 Query: 560 cggatctgtgtcgggcagaactttgcgttgcttgaggccaagatgg 605 ||||||||| |||| |||||||| || ||||||||||||||||||| Sbjct: 1499 cggatctgtatcggccagaacttcgcattgcttgaggccaagatgg 1544 Score = 60.0 bits (30), Expect = 1e-05 Identities = 60/70 (85%) Strand = Plus / Plus Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||| |||||||||||| | | || |||||||| || |||||||||||||| || |||| Sbjct: 1116 tgcttacatggacaatgattgtgcttagcatgcacccggagtggcaggaccgtgcaaggg 1175 Query: 238 aggaggttct 247 |||||||||| Sbjct: 1176 aggaggttct 1185
>gb|AF123605.1| Triticum aestivum clone CYP72B-NV-TA cytochrome P450 mRNA, complete cds Length = 1602 Score = 83.8 bits (42), Expect = 9e-13 Identities = 135/166 (81%) Strand = Plus / Plus Query: 440 caccatgatccagacgtgtggggagaagatgtggatgaatttaagccggagaggtttgct 499 |||||||| ||||| | ||||||||||||||| | |||| |||||||| |||||||| Sbjct: 1309 caccatgacacagacatctggggagaagatgtgcaccaattcaagccggataggtttgcc 1368 Query: 500 gagggtatcgccggcgcgtccaagatctcgccggcgttctttccgttcggttggggaccg 559 ||||| ||| || ||||||||| | || || || || || ||||||||||| || Sbjct: 1369 gaggggatctccaaggcgtccaaggacccgggcgcatttttcccattcggttgggggcca 1428 Query: 560 cggatctgtgtcgggcagaactttgcgttgcttgaggccaagatgg 605 ||||||||| |||| |||||||| || ||||||||||||||||||| Sbjct: 1429 cggatctgtatcggccagaacttcgcattgcttgaggccaagatgg 1474 Score = 60.0 bits (30), Expect = 1e-05 Identities = 60/70 (85%) Strand = Plus / Plus Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||| |||||||||||| | | || |||||||| || |||||||||||||| || |||| Sbjct: 1046 tgcttacatggacaatgattgtgcttagcatgcacccggagtggcaggaccgtgcaaggg 1105 Query: 238 aggaggttct 247 |||||||||| Sbjct: 1106 aggaggttct 1115
>gb|AF123604.1| Triticum aestivum clone CYP72A-TA cytochrome P450 mRNA, complete cds Length = 1836 Score = 83.8 bits (42), Expect = 9e-13 Identities = 72/82 (87%) Strand = Plus / Plus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||| || ||||||||| |||| |||||||| |||||||| |||||||||||| Sbjct: 1488 ttcggttgggggccacggatctgtatcggccagaacttcgcgttgctcgaggccaagatg 1547 Query: 605 ggattgagcgtgatcctgcaac 626 | |||| || ||||||| |||| Sbjct: 1548 gcattgtgcatgatccttcaac 1569 Score = 60.0 bits (30), Expect = 1e-05 Identities = 60/70 (85%) Strand = Plus / Plus Query: 178 tgctcacatggacaatggtcctcctaagcatgcatcccgagtggcaggaccgcgccaggg 237 |||| |||||||||||| | | || |||||||| || |||||||||||||| || |||| Sbjct: 1120 tgcttacatggacaatgattgtacttagcatgcacccggagtggcaggaccgtgcaaggg 1179 Query: 238 aggaggttct 247 |||||||||| Sbjct: 1180 aggaggttct 1189
>ref|NM_001050169.1| Oryza sativa (japonica cultivar-group) Os01g0627800 (Os01g0627800) mRNA, complete cds Length = 1962 Score = 77.8 bits (39), Expect = 6e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| | ||| Sbjct: 1092 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgctcgtc 1151 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | ||| |||||| ||||| |||||| ||||||||||||| ||||| Sbjct: 1152 gtgctatccatgcaccccgaatggcagcaccgcgccagggaagaggt 1198 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 532 ggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgct 591 ||||||||| |||||||||||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 1490 ggcgttcttcccgttcggttggggcccgaggatctgcattggccagaacttcgcgatgct 1549 Query: 592 tgaggccaagatgg 605 |||||||||||||| Sbjct: 1550 tgaggccaagatgg 1563
>dbj|AK101750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033063B21, full insert sequence Length = 1963 Score = 77.8 bits (39), Expect = 6e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| ||||| |||||||||||||| ||||||||||||| ||||| | ||| Sbjct: 1093 aagctgttctacttcgccggcatggagaccacgtcggtgctgctcacctggacgctcgtc 1152 Query: 198 ctcctaagcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 | ||| |||||| ||||| |||||| ||||||||||||| ||||| Sbjct: 1153 gtgctatccatgcaccccgaatggcagcaccgcgccagggaagaggt 1199 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 532 ggcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgct 591 ||||||||| |||||||||||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 1491 ggcgttcttcccgttcggttggggcccgaggatctgcattggccagaacttcgcgatgct 1550 Query: 592 tgaggccaagatgg 605 |||||||||||||| Sbjct: 1551 tgaggccaagatgg 1564
>ref|NM_001050033.1| Oryza sativa (japonica cultivar-group) Os01g0602400 (Os01g0602400) mRNA, complete cds Length = 1813 Score = 73.8 bits (37), Expect = 9e-10 Identities = 55/61 (90%) Strand = Plus / Plus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||||||||| ||||| |||| || ||||| ||||||||||||||||||||| Sbjct: 1517 ttcggttggggaccgcgaatctgcatcggccaaaacttcgcgttgcttgaggccaagatg 1576 Query: 605 g 605 | Sbjct: 1577 g 1577 Score = 46.1 bits (23), Expect = 0.20 Identities = 38/43 (88%) Strand = Plus / Plus Query: 301 ttgtgacaatgatacttcatgaggttcttaggctatacccacc 343 ||||||||||||| || |||||||||||||| | |||||||| Sbjct: 1272 ttgtgacaatgatcctctatgaggttcttaggttgtacccacc 1314 Score = 42.1 bits (21), Expect = 3.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 202 taagcatgcatcccgagtggcagga 226 |||||||||| |||||||||||||| Sbjct: 1173 taagcatgcaccccgagtggcagga 1197
>dbj|AP003330.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1085F01 Length = 163671 Score = 73.8 bits (37), Expect = 9e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||||||||| ||||| |||| || ||||| ||||||||||||||||||||| Sbjct: 47289 ttcggttggggaccgcgaatctgcatcggccaaaacttcgcgttgcttgaggccaagatg 47230 Query: 605 g 605 | Sbjct: 47229 g 47229 Score = 67.9 bits (34), Expect = 5e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 540 ttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggcca 599 |||| ||||||||||||||||| ||||| |||| || ||||| || ||||||||||||| Sbjct: 56414 ttccattcggttggggaccgcgaatctgcatcggccaaaacttcgcattgcttgaggcca 56355 Query: 600 agatgg 605 |||||| Sbjct: 56354 agatgg 56349 Score = 50.1 bits (25), Expect = 0.013 Identities = 46/53 (86%) Strand = Plus / Minus Query: 174 gtgctgctcacatggacaatggtcctcctaagcatgcatcccgagtggcagga 226 ||||| ||||||||||| ||| | || |||||||||| |||||||||||||| Sbjct: 56889 gtgcttctcacatggaccatgctgctattaagcatgcaccccgagtggcagga 56837 Score = 44.1 bits (22), Expect = 0.78 Identities = 55/66 (83%) Strand = Plus / Minus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||| || || ||||| |||| || ||||| ||| |||||||| |||||||| Sbjct: 37274 ttcggttgggggccacgaatctgcatcggccaaaacttcgcgctgcttgagtccaagatg 37215 Query: 605 ggattg 610 | |||| Sbjct: 37214 gcattg 37209 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 303 gtgacaatgatacttcatgaggttcttaggctatacccacc 343 ||||||||||| || |||||||||||||| | |||||||| Sbjct: 47532 gtgacaatgatcctctatgaggttcttaggttgtacccacc 47492 Score = 42.1 bits (21), Expect = 3.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 202 taagcatgcatcccgagtggcagga 226 |||||||||| |||||||||||||| Sbjct: 47741 taagcatgcaccccgagtggcagga 47717
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 73.8 bits (37), Expect = 9e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||||||||| ||||| |||| || ||||| ||||||||||||||||||||| Sbjct: 132284 ttcggttggggaccgcgaatctgcatcggccaaaacttcgcgttgcttgaggccaagatg 132225 Query: 605 g 605 | Sbjct: 132224 g 132224 Score = 67.9 bits (34), Expect = 5e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 540 ttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggcca 599 |||| ||||||||||||||||| ||||| |||| || ||||| || ||||||||||||| Sbjct: 141409 ttccattcggttggggaccgcgaatctgcatcggccaaaacttcgcattgcttgaggcca 141350 Query: 600 agatgg 605 |||||| Sbjct: 141349 agatgg 141344 Score = 50.1 bits (25), Expect = 0.013 Identities = 46/53 (86%) Strand = Plus / Minus Query: 174 gtgctgctcacatggacaatggtcctcctaagcatgcatcccgagtggcagga 226 ||||| ||||||||||| ||| | || |||||||||| |||||||||||||| Sbjct: 141884 gtgcttctcacatggaccatgctgctattaagcatgcaccccgagtggcagga 141832 Score = 44.1 bits (22), Expect = 0.78 Identities = 55/66 (83%) Strand = Plus / Minus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||| || || ||||| |||| || ||||| ||| |||||||| |||||||| Sbjct: 122269 ttcggttgggggccacgaatctgcatcggccaaaacttcgcgctgcttgagtccaagatg 122210 Query: 605 ggattg 610 | |||| Sbjct: 122209 gcattg 122204 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 303 gtgacaatgatacttcatgaggttcttaggctatacccacc 343 ||||||||||| || |||||||||||||| | |||||||| Sbjct: 132527 gtgacaatgatcctctatgaggttcttaggttgtacccacc 132487 Score = 42.1 bits (21), Expect = 3.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 202 taagcatgcatcccgagtggcagga 226 |||||||||| |||||||||||||| Sbjct: 132736 taagcatgcaccccgagtggcagga 132712
>dbj|AK107349.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-H03, full insert sequence Length = 1815 Score = 73.8 bits (37), Expect = 9e-10 Identities = 55/61 (90%) Strand = Plus / Plus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||||||||| ||||| |||| || ||||| ||||||||||||||||||||| Sbjct: 1519 ttcggttggggaccgcgaatctgcatcggccaaaacttcgcgttgcttgaggccaagatg 1578 Query: 605 g 605 | Sbjct: 1579 g 1579 Score = 46.1 bits (23), Expect = 0.20 Identities = 38/43 (88%) Strand = Plus / Plus Query: 301 ttgtgacaatgatacttcatgaggttcttaggctatacccacc 343 ||||||||||||| || |||||||||||||| | |||||||| Sbjct: 1274 ttgtgacaatgatcctctatgaggttcttaggttgtacccacc 1316
>gb|AF465266.1| Zea mays cytochrome P450 monooxygenase CYP72A27 gene, partial cds Length = 3319 Score = 67.9 bits (34), Expect = 5e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 159 atggagaccaccgcggtgctgctcacatggacaatggtcctcctaagcatgcatcccgag 218 ||||||||||| ||||||||||| ||||| ||||| | || |||||||| || ||| Sbjct: 2557 atggagaccacgttggtgctgctcatgtggacgatggtggtgctcagcatgcacccggag 2616 Query: 219 tggcaggaccgcgccagggaggaggt 244 |||||||||||||| ||||||||||| Sbjct: 2617 tggcaggaccgcgcgagggaggaggt 2642 Score = 58.0 bits (29), Expect = 5e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 533 gcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgctt 592 |||||| | |||||||||||| | ||||| ||||| |||| |||||||| ||| |||| Sbjct: 3079 gcgttcctcccgttcggttggagcccgcgcatctgcatcggccagaacttcgcgctgctg 3138 Query: 593 gaggccaagatgg 605 ||||||||||||| Sbjct: 3139 gaggccaagatgg 3151
>dbj|AK241873.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J065218D08, full insert sequence Length = 2105 Score = 58.0 bits (29), Expect = 5e-05 Identities = 83/101 (82%) Strand = Plus / Minus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 |||||||| || || |||||||| || ||| | || ||||||||||| ||||| | ||| Sbjct: 614 ttctattttgcagggatggagacgacagcgatactcctcacatggaccatggttgtgcta 555 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || || |||||| |||| || ||||||||||| Sbjct: 554 agcatgcacccagaatggcagcaccgtgcaagggaggaggt 514 Score = 50.1 bits (25), Expect = 0.013 Identities = 61/73 (83%) Strand = Plus / Minus Query: 533 gcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgctt 592 |||||||| ||||| || ||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 92 gcgttcttcccgtttggctggggcccgaggatctgcatgggccagaacttcgcgctgctc 33 Query: 593 gaggccaagatgg 605 ||||||||||||| Sbjct: 32 gaggccaagatgg 20
>ref|NM_001050168.1| Oryza sativa (japonica cultivar-group) Os01g0627600 (Os01g0627600) mRNA, complete cds Length = 1809 Score = 58.0 bits (29), Expect = 5e-05 Identities = 83/101 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 |||||||| || || |||||||| || ||| | || ||||||||||| ||||| | ||| Sbjct: 1087 ttctattttgcagggatggagacgacagcgatactcctcacatggaccatggttgtgcta 1146 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || || |||||| |||| || ||||||||||| Sbjct: 1147 agcatgcacccagaatggcagcaccgtgcaagggaggaggt 1187 Score = 50.1 bits (25), Expect = 0.013 Identities = 61/73 (83%) Strand = Plus / Plus Query: 533 gcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgctt 592 |||||||| ||||| || ||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 1476 gcgttcttcccgtttggctggggcccgaggatctgcatgggccagaacttcgcgctgctc 1535 Query: 593 gaggccaagatgg 605 ||||||||||||| Sbjct: 1536 gaggccaagatgg 1548
>dbj|AK101667.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033058A07, full insert sequence Length = 1811 Score = 58.0 bits (29), Expect = 5e-05 Identities = 83/101 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 |||||||| || || |||||||| || ||| | || ||||||||||| ||||| | ||| Sbjct: 1088 ttctattttgcagggatggagacgacagcgatactcctcacatggaccatggttgtgcta 1147 Query: 204 agcatgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||||| || || |||||| |||| || ||||||||||| Sbjct: 1148 agcatgcacccagaatggcagcaccgtgcaagggaggaggt 1188 Score = 50.1 bits (25), Expect = 0.013 Identities = 61/73 (83%) Strand = Plus / Plus Query: 533 gcgttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgctt 592 |||||||| ||||| || ||||| ||| ||||||| | || |||||||| ||| |||| Sbjct: 1477 gcgttcttcccgtttggctggggcccgaggatctgcatgggccagaacttcgcgctgctc 1536 Query: 593 gaggccaagatgg 605 ||||||||||||| Sbjct: 1537 gaggccaagatgg 1549
>dbj|AB038597.1| Oryza sativa CL-8904 mRNA for cytochrome P450, complete cds Length = 1587 Score = 56.0 bits (28), Expect = 2e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 138 aagctcttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtc 197 ||||| ||||| |||||||| |||||||| || | ||||| ||||| ||||| || | Sbjct: 997 aagctgttctacttcgcgggaatggagacaacgtcagtgctactcacctggactatcctg 1056 Query: 198 ctcctaagcatgcatcccgagtggcaggaccg 229 |||||||||||||| || |||||||| ||||| Sbjct: 1057 ctcctaagcatgcacccagagtggcaagaccg 1088
>ref|NM_001050170.1| Oryza sativa (japonica cultivar-group) Os01g0627900 (Os01g0627900) mRNA, complete cds Length = 1587 Score = 54.0 bits (27), Expect = 8e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| |||||||| |||||||| || | ||||| ||||| ||||| || | |||||| Sbjct: 1003 ttctacttcgcgggaatggagacaacgtcagtgctactcacctggactatcctgctccta 1062 Query: 204 agcatgcatcccgagtggcaggaccgcgccaggga 238 |||||||| || |||||||| ||||| || ||||| Sbjct: 1063 agcatgcacccagagtggcaagaccgtgcaaggga 1097 Score = 42.1 bits (21), Expect = 3.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 578 aactttgcgttgcttgaggccaagatgggattg 610 ||||| || ||||||||||||||||||| |||| Sbjct: 1438 aacttcgcattgcttgaggccaagatggcattg 1470
>dbj|AB237166.1| Oryza sativa (japonica cultivar-group) CYP72A21 mRNA for cytochrome P450 monooxygenase, complete cds Length = 1587 Score = 54.0 bits (27), Expect = 8e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| |||||||| |||||||| || | ||||| ||||| ||||| || | |||||| Sbjct: 1003 ttctacttcgcgggaatggagacaacgtcagtgctactcacctggactatcctgctccta 1062 Query: 204 agcatgcatcccgagtggcaggaccgcgccaggga 238 |||||||| || |||||||| ||||| || ||||| Sbjct: 1063 agcatgcacccagagtggcaagaccgtgcaaggga 1097 Score = 42.1 bits (21), Expect = 3.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 578 aactttgcgttgcttgaggccaagatgggattg 610 ||||| || ||||||||||||||||||| |||| Sbjct: 1438 aacttcgcattgcttgaggccaagatggcattg 1470
>dbj|AK063764.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-121-B03, full insert sequence Length = 2110 Score = 54.0 bits (27), Expect = 8e-04 Identities = 78/95 (82%) Strand = Plus / Plus Query: 144 ttctatttcgcgggcatggagaccaccgcggtgctgctcacatggacaatggtcctccta 203 ||||| |||||||| |||||||| || | ||||| ||||| ||||| || | |||||| Sbjct: 1310 ttctacttcgcgggaatggagacaacgtcagtgctactcacctggactatcctgctccta 1369 Query: 204 agcatgcatcccgagtggcaggaccgcgccaggga 238 |||||||| || |||||||| ||||| || ||||| Sbjct: 1370 agcatgcacccagagtggcaagaccgtgcaaggga 1404 Score = 42.1 bits (21), Expect = 3.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 578 aactttgcgttgcttgaggccaagatgggattg 610 ||||| || ||||||||||||||||||| |||| Sbjct: 1852 aacttcgcattgcttgaggccaagatggcattg 1884
>ref|NM_001050034.1| Oryza sativa (japonica cultivar-group) Os01g0602500 (Os01g0602500) mRNA, complete cds Length = 1208 Score = 50.1 bits (25), Expect = 0.013 Identities = 46/53 (86%) Strand = Plus / Plus Query: 174 gtgctgctcacatggacaatggtcctcctaagcatgcatcccgagtggcagga 226 ||||| ||||||||||| ||| | || |||||||||| |||||||||||||| Sbjct: 1026 gtgcttctcacatggaccatgctgctattaagcatgcaccccgagtggcagga 1078
>dbj|AK099492.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013027D06, full insert sequence Length = 1211 Score = 50.1 bits (25), Expect = 0.013 Identities = 46/53 (86%) Strand = Plus / Plus Query: 174 gtgctgctcacatggacaatggtcctcctaagcatgcatcccgagtggcagga 226 ||||| ||||||||||| ||| | || |||||||||| |||||||||||||| Sbjct: 1029 gtgcttctcacatggaccatgctgctattaagcatgcaccccgagtggcagga 1081
>gb|DQ838490.1| Hordeum vulgare subsp. vulgare P450 monooxygenase (CYP72A39) mRNA, complete cds Length = 1817 Score = 46.1 bits (23), Expect = 0.20 Identities = 35/39 (89%) Strand = Plus / Plus Query: 206 catgcatcccgagtggcaggaccgcgccagggaggaggt 244 |||||| || |||||||||||||| || ||||||||||| Sbjct: 1106 catgcaccctgagtggcaggaccgtgcaagggaggaggt 1144
>ref|NM_001050032.1| Oryza sativa (japonica cultivar-group) Os01g0602200 (Os01g0602200) mRNA, complete cds Length = 906 Score = 44.1 bits (22), Expect = 0.78 Identities = 55/66 (83%) Strand = Plus / Plus Query: 545 ttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgaggccaagatg 604 ||||||||||| || || ||||| |||| || ||||| ||| |||||||| |||||||| Sbjct: 739 ttcggttgggggccacgaatctgcatcggccaaaacttcgcgctgcttgagtccaagatg 798 Query: 605 ggattg 610 | |||| Sbjct: 799 gcattg 804
>gb|AY641449.1| Triticum aestivum cultivar Darius cytochrome P450 CYP709C1 (CYP709C1) mRNA, complete cds Length = 1798 Score = 44.1 bits (22), Expect = 0.78 Identities = 43/50 (86%) Strand = Plus / Plus Query: 177 ctgctcacatggacaatggtcctcctaagcatgcatcccgagtggcagga 226 |||||||||||||| ||| || | || |||| ||| |||||||||||||| Sbjct: 1076 ctgctcacatggaccatgttcttgctgagcacgcaccccgagtggcagga 1125
>ref|XM_657370.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4858.2), mRNA Length = 2496 Score = 44.1 bits (22), Expect = 0.78 Identities = 28/30 (93%) Strand = Plus / Plus Query: 557 ccgcggatctgtgtcgggcagaactttgcg 586 |||||||||||| |||||||||| |||||| Sbjct: 2311 ccgcggatctgtatcgggcagaattttgcg 2340
>gb|DQ335783.1| Medicago truncatula cytochrome P450 monooxygenase CYP72A59 (CYP72A59) mRNA, complete cds Length = 1802 Score = 44.1 bits (22), Expect = 0.78 Identities = 25/26 (96%) Strand = Plus / Plus Query: 319 atgaggttcttaggctatacccacca 344 |||||||||||||| ||||||||||| Sbjct: 1214 atgaggttcttaggttatacccacca 1239
>gb|U35226.3|NPU35226 Nicotiana plumbaginifolia putative cytochrome P-450 mRNA, complete cds Length = 1767 Score = 44.1 bits (22), Expect = 0.78 Identities = 34/38 (89%) Strand = Plus / Plus Query: 186 tggacaatggtcctcctaagcatgcatcccgagtggca 223 ||||||||||| || | |||||||||||||||||||| Sbjct: 1119 tggacaatggtggtcttgagcatgcatcccgagtggca 1156
>gb|AY735970.1| Hordeum vulgare subsp. vulgare clone cLN26-69-161B51 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735968.1| Hordeum vulgare subsp. vulgare clone cLN25-27-1D17 cytochrome P450 (CYP P450) gene, partial cds Length = 102 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735967.1| Hordeum vulgare subsp. vulgare clone cLN25-27-3C204 cytochrome P450 (CYP P450) gene, partial cds Length = 102 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735966.1| Hordeum vulgare subsp. vulgare clone cLN25-27-3C206 cytochrome P450 (CYP P450) gene, partial cds Length = 102 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735965.1| Hordeum vulgare subsp. vulgare clone cLN25-27-3C40 cytochrome P450 (CYP P450) gene, partial cds Length = 102 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735962.1| Hordeum vulgare subsp. vulgare clone hLN24-35-41.1C135 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735961.1| Hordeum vulgare subsp. vulgare clone cLN24-08-153A61 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735896.1| Hordeum vulgare subsp. vulgare clone cLN17-24--31-D29 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735895.1| Hordeum vulgare subsp. vulgare clone cLN17-27-1B186 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735894.1| Hordeum vulgare subsp. vulgare clone cLN17-27-1B187 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735893.1| Hordeum vulgare subsp. vulgare clone cLN17-27-1B6 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735892.1| Hordeum vulgare subsp. vulgare clone cLN17-27-1C193 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735879.1| Hordeum vulgare subsp. vulgare clone cLN17-27-1D200 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735878.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3C205 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735877.1| Hordeum vulgare subsp. vulgare clone cLN17-27-1D24 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735876.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3A190 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735875.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3C207 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735874.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3B191 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735868.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3C34 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735863.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3D212 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735862.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3D214 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735861.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3D215 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735860.1| Hordeum vulgare subsp. vulgare clone cLN17-27-3D46 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735857.1| Hordeum vulgare subsp. vulgare clone hLN17-28-43-1D29 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735854.1| Hordeum vulgare subsp. vulgare clone hLN23-41-41.1D.144 cytochrome P450 (CYP P450) gene, partial cds Length = 93 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735853.1| Hordeum vulgare subsp. vulgare clone hLN23-38-44.1D.140 cytochrome P450 (CYP P450) gene, partial cds Length = 93 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735850.1| Hordeum vulgare subsp. vulgare clone hLN23-34-41.1C.134 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735848.1| Hordeum vulgare subsp. vulgare clone hLN23-36-41.1C.136 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735842.1| Hordeum vulgare subsp. vulgare clone cLN23-27-1A.177 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735837.1| Hordeum vulgare subsp. vulgare clone hLN23-78-43.3C.61 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735835.1| Hordeum vulgare subsp. vulgare clone hLN23-76-43.3C.58 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735834.1| Hordeum vulgare subsp. vulgare clone hLN23-77-43.3C.59 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>gb|AY735833.1| Hordeum vulgare subsp. vulgare clone hLN23-51-42.1B.45 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 44.1 bits (22), Expect = 0.78 Identities = 22/22 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggtttg 497 |||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggtttg 22
>ref|NM_001066009.1| Oryza sativa (japonica cultivar-group) Os07g0419100 (Os07g0419100) mRNA, complete cds Length = 1011 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 733 gtgtggggggaggatgcggatgagtttaggccggagaggtt 773
>ref|NM_001066006.1| Oryza sativa (japonica cultivar-group) Os07g0418500 (Os07g0418500) mRNA, complete cds Length = 1837 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 1393 gtgtggggggaggatgcggatgagtttaggccggagaggtt 1433
>ref|NM_113795.2| Arabidopsis thaliana heme binding / iron ion binding / monooxygenase/ oxygen binding (AT3G28740) mRNA, complete cds Length = 1597 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 aatttaagccggagaggtttg 497 ||||||||||||||||||||| Sbjct: 1251 aatttaagccggagaggtttg 1271
>ref|NM_113794.2| Arabidopsis thaliana ATHMG (HIGH MOBILITY GROUP); transcription factor (ATHMG) mRNA, complete cds Length = 2657 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 477 aatttaagccggagaggtttg 497 ||||||||||||||||||||| Sbjct: 2552 aatttaagccggagaggtttg 2532
>ref|NM_112325.1| Arabidopsis thaliana CYP72A10; heme binding / iron ion binding / monooxygenase/ oxygen binding (CYP72A10) mRNA, complete cds Length = 1545 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 297 aaagttgtgacaatgatacttcatgaggttcttaggctata 337 |||||| ||||||||||| | |||||||||| |||||||| Sbjct: 1114 aaagttatgacaatgatattatatgaggttctcaggctata 1154
>gb|AY072300.1| Zea mays cytochrome P450 monooxygenase CYP72A5 gene, complete cds Length = 6588 Score = 42.1 bits (21), Expect = 3.1 Identities = 57/69 (82%) Strand = Plus / Plus Query: 536 ttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgag 595 |||||||||||||| |||| || | ||||| |||| |||| |||||||||||| || Sbjct: 5415 ttctttccgttcggaggggggcctagaatctgcatcggccagagctttgcgttgctggaa 5474 Query: 596 gccaagatg 604 ||||||||| Sbjct: 5475 gccaagatg 5483
>gb|AY072296.1| Zea mays cytochrome P450 monooxygenase CYP72A5 mRNA, partial cds Length = 1179 Score = 42.1 bits (21), Expect = 3.1 Identities = 57/69 (82%) Strand = Plus / Plus Query: 536 ttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgag 595 |||||||||||||| |||| || | ||||| |||| |||| |||||||||||| || Sbjct: 754 ttctttccgttcggaggggggcctagaatctgcatcggccagagctttgcgttgctggaa 813 Query: 596 gccaagatg 604 ||||||||| Sbjct: 814 gccaagatg 822
>gb|AY113869.1| Arabidopsis thaliana putative cytochrome P450 protein (At3g28740) mRNA, complete cds Length = 1561 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 aatttaagccggagaggtttg 497 ||||||||||||||||||||| Sbjct: 1250 aatttaagccggagaggtttg 1270
>gb|AY050849.1| Arabidopsis thaliana putative cytochrome P450 protein (At3g28740) mRNA, complete cds Length = 1612 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 aatttaagccggagaggtttg 497 ||||||||||||||||||||| Sbjct: 1251 aatttaagccggagaggtttg 1271
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7 Length = 29644043 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 13272206 gtgtggggggaggatgcggatgagtttaggccggagaggtt 13272246 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 13329530 gtgtggggggaggatgcggatgagtttaggccggagaggtt 13329490
>dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1123_B01 Length = 105736 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 43968 gtgtggggggaggatgcggatgagtttaggccggagaggtt 43928
>dbj|AP004264.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0025D09 Length = 142593 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 60069 gtgtggggggaggatgcggatgagtttaggccggagaggtt 60109 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 117393 gtgtggggggaggatgcggatgagtttaggccggagaggtt 117353
>dbj|AP002057.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8 Length = 73391 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 477 aatttaagccggagaggtttg 497 ||||||||||||||||||||| Sbjct: 8721 aatttaagccggagaggtttg 8701
>dbj|AK119557.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-106-A06, full insert sequence Length = 1945 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 1488 gtgtggggggaggatgcggatgagtttaggccggagaggtt 1528
>emb|BX824113.1|CNS0A6QK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH23ZC06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1538 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 aatttaagccggagaggtttg 497 ||||||||||||||||||||| Sbjct: 1240 aatttaagccggagaggtttg 1260
>emb|BX823880.1|CNS0A6JU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS88ZD05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1554 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 aatttaagccggagaggtttg 497 ||||||||||||||||||||| Sbjct: 1246 aatttaagccggagaggtttg 1266
>dbj|AK072220.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013166A09, full insert sequence Length = 1838 Score = 42.1 bits (21), Expect = 3.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 455 gtgtggggagaagatgtggatgaatttaagccggagaggtt 495 |||||||| || |||| |||||| |||| |||||||||||| Sbjct: 1394 gtgtggggggaggatgcggatgagtttaggccggagaggtt 1434
>gb|AY107315.1| Zea mays PCO091556 mRNA sequence Length = 691 Score = 42.1 bits (21), Expect = 3.1 Identities = 57/69 (82%) Strand = Plus / Plus Query: 536 ttctttccgttcggttggggaccgcggatctgtgtcgggcagaactttgcgttgcttgag 595 |||||||||||||| |||| || | ||||| |||| |||| |||||||||||| || Sbjct: 206 ttctttccgttcggaggggggcctagaatctgcatcggccagagctttgcgttgctggaa 265 Query: 596 gccaagatg 604 ||||||||| Sbjct: 266 gccaagatg 274
>gb|AY735953.1| Hordeum vulgare subsp. vulgare clone hLN27-06-441B56 cytochrome P450 (CYP P450) gene, partial cds Length = 93 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735943.1| Hordeum vulgare subsp. vulgare clone hLN14-07-441B57 cytochrome P450 (CYP P450) gene, partial cds Length = 93 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735942.1| Hordeum vulgare subsp. vulgare clone cLN14-09-153A62 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735937.1| Hordeum vulgare subsp. vulgare clone hLN14-17-423D10 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735936.1| Hordeum vulgare subsp. vulgare clone hLN14-27-421D26 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735934.1| Hordeum vulgare subsp. vulgare clone hLN14--41-413D48 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735933.1| Hordeum vulgare subsp. vulgare clone hLN14-21-411D114 cytochrome P450 (CYP P450) gene, partial cds Length = 87 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735789.1| Hordeum vulgare subsp. vulgare clone cLN4-11-15.3A64 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735785.1| Hordeum vulgare subsp. vulgare clone cLN4--271C14 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735780.1| Hordeum vulgare subsp. vulgare clone cLN4-13-16.3A7 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735779.1| Hordeum vulgare subsp. vulgare clone cLN4-19-17.3A75 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735778.1| Hordeum vulgare subsp. vulgare clone cLN4-17-16.3A67 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735771.1| Hordeum vulgare subsp. vulgare clone cLN4-39-17.3B110 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735770.1| Hordeum vulgare subsp. vulgare clone cLN4-40-17.3B125 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735768.1| Hordeum vulgare subsp. vulgare clone cLN4-41-17.3B127 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735766.1| Hordeum vulgare subsp. vulgare clone cLN4-58-15.1A133 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21
>gb|AY735765.1| Hordeum vulgare subsp. vulgare clone cLN4-59-15.1A134 cytochrome P450 (CYP P450) gene, partial cds Length = 99 Score = 42.1 bits (21), Expect = 3.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gaatttaagccggagaggttt 496 ||||||||||||||||||||| Sbjct: 1 gaatttaagccggagaggttt 21 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 133,009,328 Number of extensions: 6627754 Number of successful extensions: 149879 Number of sequences better than 10.0: 108 Number of HSP's gapped: 149858 Number of HSP's successfully gapped: 188 Length of query: 820 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 798 Effective length of database: 18,508,616,841 Effective search space: 14769876239118 Effective search space used: 14769876239118 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
