| Clone Name | FLbaf86i11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ245885.1| Zea mays clone 21709 mRNA sequence Length = 756 Score = 172 bits (87), Expect = 1e-39 Identities = 219/263 (83%) Strand = Plus / Plus Query: 508 aatcatggttattggcttgatatgtgcatgccttagcgtgttcatgtatgggtccccact 567 ||||||||| || || |||||||||| ||||| | ||| ||||||| ||||| || || Sbjct: 127 aatcatggtgataggaatgatatgtgcctgcctcaatgtgctcatgtacgggtcacccct 186 Query: 568 cgctgccgtgagaacggtgatcacttcaaagagcgtggagtacatgcccttcttcctctc 627 |||||| ||| |||||||||||| ||||||||||||||| |||||| |||||||| || Sbjct: 187 tgctgccatgaaaacggtgatcacgacaaagagcgtggagttcatgccattcttcctgtc 246 Query: 628 cttcttcctcttcctcaacggaggagtctgggccacgtatgcaatactcgacggagacgt 687 |||||||||||||||||||||||| |||||||| ||||| || | || ||| | ||| | Sbjct: 247 cttcttcctcttcctcaacggaggcgtctgggcaacgtacgcggtgcttgaccgcgacat 306 Query: 688 cttcctcggggtcccaaatgggataggctgcttcttgggcgccatccagctggttatcta 747 |||||||||| |||| ||||||||||||| | | | ||| ||||||||||| | |||| Sbjct: 307 cttcctcgggatccccaatgggataggcttcgtgcttggcaccatccagctgatcgtcta 366 Query: 748 tgcggtgtacatgaacagcaagg 770 ||| | |||||||||||||||| Sbjct: 367 cgcgatctacatgaacagcaagg 389
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 123 bits (62), Expect = 1e-24 Identities = 113/130 (86%) Strand = Plus / Plus Query: 253 gccatacgtgctcacgctgctcaacacgctgctatggctctactacggcctcaccaagcc 312 |||||||||| ||||||| |||||| |||| || ||||||||||| ||| ||| |||| Sbjct: 11828845 gccatacgtgttcacgctactcaacgcgctcctctggctctactatggcgtcagtaagca 11828904 Query: 313 cgacggcctgctcatcgccaccgtcaacggcttcggtgccgtcatggagaccatctacat 372 | ||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||| | Sbjct: 11828905 caacggccttctcatcgccaccatcaacggcttcgggaccgtcatggaggccatctacgt 11828964 Query: 373 cgtgctcttc 382 |||||||||| Sbjct: 11828965 cgtgctcttc 11828974 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttct 620 ||||||||||||||||||||||||| Sbjct: 19957415 aagagcgtggagtacatgcccttct 19957439 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcct 624 |||||||||||||||||||| |||||||| Sbjct: 23876055 aagagcgtggagtacatgccgttcttcct 23876083 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 632 ttcctcttcctcaacggaggagtctgg 658 |||||||||||||||||||| |||||| Sbjct: 11832799 ttcctcttcctcaacggaggcgtctgg 11832825 Score = 44.1 bits (22), Expect = 0.90 Identities = 28/30 (93%) Strand = Plus / Minus Query: 611 atgcccttcttcctctccttcttcctcttc 640 |||| ||||||||||||| ||||||||||| Sbjct: 8133572 atgctcttcttcctctccctcttcctcttc 8133543 Score = 42.1 bits (21), Expect = 3.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcct 624 |||||||| ||||||||||| |||||||| Sbjct: 23862868 aagagcgtagagtacatgccgttcttcct 23862896
>dbj|AP003535.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1012D10 Length = 168267 Score = 123 bits (62), Expect = 1e-24 Identities = 113/130 (86%) Strand = Plus / Plus Query: 253 gccatacgtgctcacgctgctcaacacgctgctatggctctactacggcctcaccaagcc 312 |||||||||| ||||||| |||||| |||| || ||||||||||| ||| ||| |||| Sbjct: 41130 gccatacgtgttcacgctactcaacgcgctcctctggctctactatggcgtcagtaagca 41189 Query: 313 cgacggcctgctcatcgccaccgtcaacggcttcggtgccgtcatggagaccatctacat 372 | ||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||| | Sbjct: 41190 caacggccttctcatcgccaccatcaacggcttcgggaccgtcatggaggccatctacgt 41249 Query: 373 cgtgctcttc 382 |||||||||| Sbjct: 41250 cgtgctcttc 41259 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 632 ttcctcttcctcaacggaggagtctgg 658 |||||||||||||||||||| |||||| Sbjct: 45084 ttcctcttcctcaacggaggcgtctgg 45110
>ref|NM_001056606.1| Oryza sativa (japonica cultivar-group) Os03g0341300 (Os03g0341300) mRNA, complete cds Length = 1077 Score = 97.6 bits (49), Expect = 7e-17 Identities = 58/61 (95%) Strand = Plus / Plus Query: 598 gagcgtggagtacatgcccttcttcctctccttcttcctcttcctcaacggaggagtctg 657 ||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||| Sbjct: 555 gagcgtggagtacatgcccttctccctctccttcttcctcttcctcaacggcggcgtctg 614 Query: 658 g 658 | Sbjct: 615 g 615 Score = 63.9 bits (32), Expect = 1e-06 Identities = 83/100 (83%) Strand = Plus / Plus Query: 295 ctacggcctcaccaagcccgacggcctgctcatcgccaccgtcaacggcttcggtgccgt 354 |||||||||| |||||||| ||| || ||||||| |||||||||||||| ||| |||| Sbjct: 226 ctacggcctccacaagcccggcggtctcctcatcgtcaccgtcaacggctccggcgccgc 285 Query: 355 catggagaccatctacatcgtgctcttcctcgtctacgcc 394 | | ||| |||||||| || ||||| ||||| ||||||| Sbjct: 286 cctcgaggccatctacgtcacgctctacctcgcctacgcc 325
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3 Length = 36192742 Score = 97.6 bits (49), Expect = 7e-17 Identities = 58/61 (95%) Strand = Plus / Plus Query: 598 gagcgtggagtacatgcccttcttcctctccttcttcctcttcctcaacggaggagtctg 657 ||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||| Sbjct: 12701917 gagcgtggagtacatgcccttctccctctccttcttcctcttcctcaacggcggcgtctg 12701976 Query: 658 g 658 | Sbjct: 12701977 g 12701977 Score = 63.9 bits (32), Expect = 1e-06 Identities = 83/100 (83%) Strand = Plus / Plus Query: 295 ctacggcctcaccaagcccgacggcctgctcatcgccaccgtcaacggcttcggtgccgt 354 |||||||||| |||||||| ||| || ||||||| |||||||||||||| ||| |||| Sbjct: 12700888 ctacggcctccacaagcccggcggtctcctcatcgtcaccgtcaacggctccggcgccgc 12700947 Query: 355 catggagaccatctacatcgtgctcttcctcgtctacgcc 394 | | ||| |||||||| || ||||| ||||| ||||||| Sbjct: 12700948 cctcgaggccatctacgtcacgctctacctcgcctacgcc 12700987 Score = 60.0 bits (30), Expect = 2e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 12978063 aagagcgtggagttcatgcccttctggctctccttcttcctc 12978022
>gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0050D18, complete sequence Length = 126350 Score = 97.6 bits (49), Expect = 7e-17 Identities = 58/61 (95%) Strand = Plus / Plus Query: 598 gagcgtggagtacatgcccttcttcctctccttcttcctcttcctcaacggaggagtctg 657 ||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||| Sbjct: 59607 gagcgtggagtacatgcccttctccctctccttcttcctcttcctcaacggcggcgtctg 59666 Query: 658 g 658 | Sbjct: 59667 g 59667 Score = 63.9 bits (32), Expect = 1e-06 Identities = 83/100 (83%) Strand = Plus / Plus Query: 295 ctacggcctcaccaagcccgacggcctgctcatcgccaccgtcaacggcttcggtgccgt 354 |||||||||| |||||||| ||| || ||||||| |||||||||||||| ||| |||| Sbjct: 58578 ctacggcctccacaagcccggcggtctcctcatcgtcaccgtcaacggctccggcgccgc 58637 Query: 355 catggagaccatctacatcgtgctcttcctcgtctacgcc 394 | | ||| |||||||| || ||||| ||||| ||||||| Sbjct: 58638 cctcgaggccatctacgtcacgctctacctcgcctacgcc 58677
>ref|NM_001056634.1| Oryza sativa (japonica cultivar-group) Os03g0347500 (Os03g0347500) mRNA, complete cds Length = 1492 Score = 60.0 bits (30), Expect = 2e-05 Identities = 39/42 (92%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 624 aagagcgtggagttcatgcccttctggctctccttcttcctc 665
>gb|AC134231.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0006D11, complete sequence Length = 176637 Score = 60.0 bits (30), Expect = 2e-05 Identities = 39/42 (92%) Strand = Plus / Minus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 58986 aagagcgtggagttcatgcccttctggctctccttcttcctc 58945
>dbj|AK109114.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-C05, full insert sequence Length = 1492 Score = 60.0 bits (30), Expect = 2e-05 Identities = 39/42 (92%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 624 aagagcgtggagttcatgcccttctggctctccttcttcctc 665
>gb|BT018599.1| Zea mays clone EL01N0449A02.d mRNA sequence Length = 1762 Score = 58.0 bits (29), Expect = 6e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcct 636 ||||||||||||| ||||||||||| |||||||||||||| Sbjct: 727 aagagcgtggagttcatgcccttctcgctctccttcttcct 767
>gb|AC116730.7| Mus musculus chromosome 1, clone RP23-346J11, complete sequence Length = 208503 Score = 58.0 bits (29), Expect = 6e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||||||||||||| Sbjct: 197222 ccttcttcctctccttcttcctcttcctc 197250 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 197211 cttcttcctctccttcttcctct 197233
>gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, complete sequence Length = 250957 Score = 58.0 bits (29), Expect = 6e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||||||||||||| Sbjct: 20695 ccttcttcctctccttcttcctcttcctc 20723 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 20684 cttcttcctctccttcttcctct 20706
>dbj|AK242853.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J090073D19, full insert sequence Length = 1656 Score = 54.0 bits (27), Expect = 0.001 Identities = 30/31 (96%) Strand = Plus / Plus Query: 598 gagcgtggagtacatgcccttcttcctctcc 628 ||||||||||||||||||||||| ||||||| Sbjct: 678 gagcgtggagtacatgcccttctccctctcc 708
>ref|NM_001073287.1| Oryza sativa (japonica cultivar-group) Os12g0476200 (Os12g0476200) mRNA, complete cds Length = 891 Score = 54.0 bits (27), Expect = 0.001 Identities = 30/31 (96%) Strand = Plus / Plus Query: 598 gagcgtggagtacatgcccttcttcctctcc 628 ||||||||||||||||||||||| ||||||| Sbjct: 483 gagcgtggagtacatgcccttctccctctcc 513
>gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence Length = 1159 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 598 gagcgtggagtacatgcccttcttcctctccttct 632 ||||||||||| ||||||||||| ||||||||||| Sbjct: 359 gagcgtggagttcatgcccttctccctctccttct 393
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12 Length = 27566993 Score = 54.0 bits (27), Expect = 0.001 Identities = 30/31 (96%) Strand = Plus / Minus Query: 598 gagcgtggagtacatgcccttcttcctctcc 628 ||||||||||||||||||||||| ||||||| Sbjct: 17344102 gagcgtggagtacatgcccttctccctctcc 17344072
>gb|AC115062.13| Mus musculus chromosome 3, clone RP24-399B3, complete sequence Length = 198727 Score = 54.0 bits (27), Expect = 0.001 Identities = 27/27 (100%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcc 641 ||||||||||||||||||||||||||| Sbjct: 73322 ccttcttcctctccttcttcctcttcc 73296
>emb|AL713927.3|CNS07YP4 Oryza sativa chromosome 12, . BAC OSJNBa0021B03 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 154826 Score = 54.0 bits (27), Expect = 0.001 Identities = 30/31 (96%) Strand = Plus / Plus Query: 598 gagcgtggagtacatgcccttcttcctctcc 628 ||||||||||||||||||||||| ||||||| Sbjct: 59267 gagcgtggagtacatgcccttctccctctcc 59297
>ref|NM_001063010.1| Oryza sativa (japonica cultivar-group) Os05g0588500 (Os05g0588500) mRNA, complete cds Length = 1362 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Plus Query: 594 caaagagcgtggagtacatgcccttc 619 |||||||||||||||||||||||||| Sbjct: 814 caaagagcgtggagtacatgcccttc 839
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcctcttcctc 643 ||||||||||||| |||||||||||||||| Sbjct: 27257 cccttcttcctcttcttcttcctcttcctc 27228
>gb|AC102176.8| Mus musculus chromosome 15, clone RP23-480E14, complete sequence Length = 181577 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 |||||||||||||||||||||||||| Sbjct: 127920 tcttcctctccttcttcctcttcctc 127945
>gb|AC098598.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1007_H05, complete sequence Length = 108479 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Minus Query: 594 caaagagcgtggagtacatgcccttc 619 |||||||||||||||||||||||||| Sbjct: 103490 caaagagcgtggagtacatgcccttc 103465
>gb|AC105260.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_D04, complete sequence Length = 100800 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Minus Query: 594 caaagagcgtggagtacatgcccttc 619 |||||||||||||||||||||||||| Sbjct: 19659 caaagagcgtggagtacatgcccttc 19634
>gb|AC159807.2| Mus musculus BAC clone RP24-399D3 from chromosome 12, complete sequence Length = 131785 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttcctc 643 |||||||||||||||||||||||||| Sbjct: 7712 tcttcctctccttcttcctcttcctc 7687
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5 Length = 29737217 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Minus Query: 594 caaagagcgtggagtacatgcccttc 619 |||||||||||||||||||||||||| Sbjct: 29093435 caaagagcgtggagtacatgcccttc 29093410 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 19075660 cttcttcctcttcttcttcctcttcctc 19075687
>dbj|AK069614.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023023E05, full insert sequence Length = 1363 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Plus Query: 594 caaagagcgtggagtacatgcccttc 619 |||||||||||||||||||||||||| Sbjct: 815 caaagagcgtggagtacatgcccttc 840
>gb|AY855168.1| Rattus norvegicus RPGR mRNA, partial cds Length = 1719 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcctcttcctc 643 |||||||||||||||||| ||||||||||| Sbjct: 888 cccttcttcctctccttcctcctcttcctc 859 Score = 44.1 bits (22), Expect = 0.90 Identities = 28/30 (93%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcctcttcctc 643 |||||||||||||||||| |||||||||| Sbjct: 711 cccttcttcctctccttccccctcttcctc 682 Score = 44.1 bits (22), Expect = 0.90 Identities = 28/30 (93%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcctcttcctc 643 ||||||||||||||| || ||||||||||| Sbjct: 816 cccttcttcctctccctcctcctcttcctc 787
>gb|AC127270.4| Mus musculus BAC clone RP23-453E16 from 12, complete sequence Length = 181004 Score = 52.0 bits (26), Expect = 0.004 Identities = 26/26 (100%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 |||||||||||||||||||||||||| Sbjct: 31754 tcttcctctccttcttcctcttcctc 31779
>ref|NM_001050058.1| Oryza sativa (japonica cultivar-group) Os01g0606000 (Os01g0606000) mRNA, complete cds Length = 810 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcct 624 |||||||||||||||||||| |||||||| Sbjct: 508 aagagcgtggagtacatgccgttcttcct 536
>ref|NM_001049805.1| Oryza sativa (japonica cultivar-group) Os01g0541800 (Os01g0541800) mRNA, complete cds Length = 1212 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttct 620 ||||||||||||||||||||||||| Sbjct: 670 aagagcgtggagtacatgcccttct 694
>gb|AC114150.5| Rattus norvegicus BAC CH230-145N21 () complete sequence Length = 197180 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| |||||||||||||||| Sbjct: 174624 ccttcttcctcttcttcttcctcttcctc 174596
>ref|XR_007627.1| PREDICTED: Rattus norvegicus hypothetical protein LOC681697 (LOC681697), mRNA Length = 734 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| |||||||||||||||| Sbjct: 520 ccttcttcctcttcttcttcctcttcctc 492 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 499 tcttcctcttcttcttcctcttcctc 474
>gb|AC168212.7| Mus musculus chromosome 18, clone RP23-290N19, complete sequence Length = 197719 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 ||||||||||||||||| ||||||||||| Sbjct: 188058 ccttcttcctctccttcctcctcttcctc 188030
>gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosome 6, complete sequence Length = 218586 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||||||||||||||||| Sbjct: 217132 cttcttcctctccttcttcctcttc 217108
>gb|AC167405.5| Mus musculus chromosome 18, clone wi1-977A17, complete sequence Length = 41204 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctcttcctc 643 ||||||||||||||||| ||||||||||| Sbjct: 14842 ccttcttcctctccttcctcctcttcctc 14870
>gb|AC102567.8| Mus musculus chromosome 9, clone RP23-224F1, complete sequence Length = 198097 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| ||||| Sbjct: 147294 ccttcttcctctccttcttcctcctcctc 147322 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 147282 ccttcttcctctccttcttcctct 147305 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 147271 cttcttcctctccttcttcctct 147293
>gb|AC111111.11| Mus musculus chromosome 3, clone RP23-201A9, complete sequence Length = 233326 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||| |||||||||||||||||||||| Sbjct: 159537 ccttctccctctccttcttcctcttcctc 159509
>gb|AC138270.12| Mus musculus chromosome 7, clone RP23-323F17, complete sequence Length = 213855 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||||||||||||||||| Sbjct: 41982 cttcttcctctccttcttcctcttc 42006
>gb|AC020931.6| Homo sapiens chromosome 19 clone CTD-2240E14, complete sequence Length = 129048 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| |||||||||||||||| Sbjct: 34662 ccttcttcctcttcttcttcctcttcctc 34634
>gb|AC006055.1| Homo sapiens 3p22 Contig 7 PAC RPCI4-672N11 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 91885 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||| |||||||||||||||||||| Sbjct: 34291 ccttcttcttctccttcttcctcttcctc 34263
>ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507049.179) partial mRNA Length = 3402 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||||||||||||||||| Sbjct: 1144 cttcttcctctccttcttcctcttc 1120
>ref|XM_810894.1| Trypanosoma cruzi strain CL Brener histone deacetylase (Tc00.1047053506821.140) partial mRNA Length = 1536 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctca 644 ||||||||||| ||||||||||||||||| Sbjct: 1450 cttcttcctcttcttcttcctcttcctca 1422 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1462 cttcttcctcttcttcttcctcttc 1438 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1474 cttcttcctcttcttcttcctcttc 1450 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1486 cttcttcctcttcttcttcctcttc 1462
>gb|AC121565.4| Mus musculus BAC clone RP23-223J11 from chromosome 6, complete sequence Length = 170000 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||||||||||||||||| Sbjct: 105197 cttcttcctctccttcttcctcttc 105221
>dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0062A24 Length = 148362 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttct 620 ||||||||||||||||||||||||| Sbjct: 60324 aagagcgtggagtacatgcccttct 60348
>dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0704D04 Length = 147638 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcct 624 |||||||||||||||||||| |||||||| Sbjct: 22459 aagagcgtggagtacatgccgttcttcct 22487 Score = 42.1 bits (21), Expect = 3.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcct 624 |||||||| ||||||||||| |||||||| Sbjct: 9272 aagagcgtagagtacatgccgttcttcct 9300
>dbj|AK104255.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D11, full insert sequence Length = 1168 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttct 620 ||||||||||||||||||||||||| Sbjct: 666 aagagcgtggagtacatgcccttct 690
>dbj|AK104143.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G10, full insert sequence Length = 1096 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttct 620 ||||||||||||||||||||||||| Sbjct: 670 aagagcgtggagtacatgcccttct 694
>dbj|AK066226.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013057K13, full insert sequence Length = 1213 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttct 620 ||||||||||||||||||||||||| Sbjct: 671 aagagcgtggagtacatgcccttct 695
>gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome 8, complete sequence Length = 249808 Score = 50.1 bits (25), Expect = 0.015 Identities = 25/25 (100%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||||||||||||||||| Sbjct: 232946 cttcttcctctccttcttcctcttc 232922 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttc 640 |||||||||||| ||||||||||||| Sbjct: 232935 ccttcttcctcttcttcttcctcttc 232910 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 232789 cttcttcctcttcttcttcctcttc 232765 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 232801 cttcttcctcttcttcttcctcttc 232777 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 233117 cttcttcctcttcttcttcctcttc 233093 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 233129 cttcttcctcttcttcttcctcttc 233105 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 233262 cttcttcctcttcttcttcctcttc 233238 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 233274 cttcttcctcttcttcttcctcttc 233250 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 233604 cttcttcctcttcttcttcctcttc 233580 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 233631 cttcttcctcttcttcttcctcttc 233607 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 234535 cttcttcctcttcttcttcctcttc 234511 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 234547 cttcttcctcttcttcttcctcttc 234523 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 234899 cttcttcctcttcttcttcctcttc 234875 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 234911 cttcttcctcttcttcttcctcttc 234887
>gb|AC155813.2| Mus musculus BAC clone RP24-167L2 from 9, complete sequence Length = 166097 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| ||||| Sbjct: 47694 ccttcttcctctccttcttcctcctcctc 47722 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 47682 ccttcttcctctccttcttcctct 47705 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 47671 cttcttcctctccttcttcctct 47693
>gb|AY105872.1| Zea mays PCO079046 mRNA sequence Length = 1346 Score = 50.1 bits (25), Expect = 0.015 Identities = 31/33 (93%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcctctcc 628 |||||||| |||||||||||||||| ||||||| Sbjct: 722 aagagcgtagagtacatgcccttctccctctcc 754
>gb|AC139333.4| Mus musculus BAC clone RP24-83F12 from 3, complete sequence Length = 162197 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| |||||||||||||||| Sbjct: 18554 ccttcttcctcttcttcttcctcttcctc 18526 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 18355 cttcttcctcttcttcttcctcttcctc 18328 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 18533 tcttcctcttcttcttcctcttcctc 18508 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 18367 cttcttcctcttcttcttcctcttc 18343
>gb|AC166173.3| Mus musculus BAC clone RP23-101K10 from chromosome 3, complete sequence Length = 196177 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| |||||||||||||||| Sbjct: 76098 ccttcttcctcttcttcttcctcttcctc 76126 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 76297 cttcttcctcttcttcttcctcttcctc 76324 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 76119 tcttcctcttcttcttcctcttcctc 76144 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 76285 cttcttcctcttcttcttcctcttc 76309
>gb|AC153841.1| Mus musculus 6 BAC RP23-260M5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190541 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||||||||||||||| |||| Sbjct: 153673 ccttcttcctctccttcttcctctccctc 153645
>emb|AL732485.8| Mouse DNA sequence from clone RP23-70G24 on chromosome 2, complete sequence Length = 92562 Score = 50.1 bits (25), Expect = 0.015 Identities = 28/29 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| |||||||||||||||| Sbjct: 48409 ccttcttcctcttcttcttcctcttcctc 48381
>emb|AM055942.3| Toxoplasma gondii RH, genomic DNA chromosome Ia Length = 1986653 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 1409131 ccttcttcctctccttcttcctct 1409108 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttc 640 ||||||||||||| |||||||||||| Sbjct: 1766867 ccttcttcctctctttcttcctcttc 1766842 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 371139 cttcttcctcttcttcttcctcttc 371163 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1388311 cttcttcctcttcttcttcctcttc 1388287 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1388323 cttcttcctcttcttcttcctcttc 1388299 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1388335 cttcttcctcttcttcttcctcttc 1388311 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1503859 cttcttcctcttcttcttcctcttc 1503835 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1503871 cttcttcctcttcttcttcctcttc 1503847 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1503892 cttcttcctcttcttcttcctcttc 1503868
>ref|XM_840607.1| Trypanosoma brucei TREU927 hypothetical protein, conserved (Tb927_7.760) mRNA, complete cds Length = 1710 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 85 cttcttcctcttcttcttcctcttcctc 58
>emb|CR848757.23| Zebrafish DNA sequence from clone CH211-207L3 in linkage group 15, complete sequence Length = 205827 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 621 tcctctccttcttcctcttcctca 644 |||||||||||||||||||||||| Sbjct: 94209 tcctctccttcttcctcttcctca 94232
>ref|XM_001140477.1| PREDICTED: Pan troglodytes similar to transcript Y 7 (LOC739223), mRNA Length = 888 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 355 cttcttcctcttcttcttcctcttcctc 328
>ref|XM_001138991.1| PREDICTED: Pan troglodytes similar to transcript Y 7 (LOC738248), mRNA Length = 894 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 361 cttcttcctcttcttcttcctcttcctc 334
>ref|XM_001137389.1| PREDICTED: Pan troglodytes similar to transcript Y 7 (LOC737176), mRNA Length = 894 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 361 cttcttcctcttcttcttcctcttcctc 334
>gb|AC185507.9| Mus musculus BAC RP24-186O7 () complete sequence Length = 44344 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 12889 cttcttcctcttcttcttcctcttcctc 12862 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 12748 cttcttcctcttcttcttcctcttc 12724
>ref|XM_001053229.1| PREDICTED: Rattus norvegicus hypothetical protein LOC678744 (LOC678744), mRNA Length = 390 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 291 cttcttcctcttcttcttcctcttcctc 264 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 303 cttcttcctcttcttcttcctcttc 279
>ref|XM_001072916.1| PREDICTED: Rattus norvegicus hypothetical protein LOC686214 (LOC686214), mRNA Length = 438 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 208 cttcttcctcttcttcttcctcttcctc 181 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 280 cttcttcctcttcttcttcctcttcctc 253 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 301 cttcttcctcttcttcttcctcttc 277
>ref|XM_001057439.1| PREDICTED: Rattus norvegicus hypothetical protein LOC681565 (LOC681565), mRNA Length = 510 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 259 cttcttcctcttcttcttcctcttcctc 232 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 142 cttcttcctcttcttcttcctcttc 118 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 355 cttcttcctcttcttcttcctcttc 331
>ref|XM_001075539.1| PREDICTED: Rattus norvegicus hypothetical protein LOC690765 (LOC690765), mRNA Length = 675 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 505 cttcttcctcttcttcttcctcttcctc 478
>ref|XM_001080603.1| PREDICTED: Rattus norvegicus hypothetical protein LOC687939 (LOC687939), mRNA Length = 732 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 595 cttcttcctcttcttcttcctcttcctc 568
>ref|XM_001070899.1| PREDICTED: Rattus norvegicus hypothetical protein LOC684541 (LOC684541), mRNA Length = 417 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 97 cttcttcctcttcttcttcctcttcctc 70 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 124 cttcttcctcttcttcttcctcttcctc 97
>ref|XM_001055005.1| PREDICTED: Rattus norvegicus hypothetical protein LOC679935 (LOC679935), mRNA Length = 417 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 97 cttcttcctcttcttcttcctcttcctc 70 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 124 cttcttcctcttcttcttcctcttcctc 97
>ref|XM_001070896.1| PREDICTED: Rattus norvegicus hypothetical protein LOC689461 (LOC689461), mRNA Length = 492 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 193 cttcttcctcttcttcttcctcttcctc 166 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 283 cttcttcctcttcttcttcctcttcctc 256 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 236 tcttcctcttcttcttcctcttcctc 211 Score = 42.1 bits (21), Expect = 3.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| | |||||||||||||| Sbjct: 122 ccttcttcctcttcctcttcctcttcctc 94 Score = 42.1 bits (21), Expect = 3.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||| | |||||||||||||||||||| Sbjct: 134 ccttctccttctccttcttcctcttcctc 106 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 322 cttcttcctcttcttcttcctcttc 298
>ref|XM_001060498.1| PREDICTED: Rattus norvegicus hypothetical protein LOC681149 (LOC681149), mRNA Length = 222 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 67 cttcttcctcttcttcttcctcttcctc 40
>ref|XR_006617.1| PREDICTED: Rattus norvegicus hypothetical protein LOC689318 (LOC689318), mRNA Length = 290 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 231 cttcttcctcttcttcttcctcttcctc 204 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 211 tcttcctcttcttcttcctcttcctc 186
>ref|XM_001056093.1| PREDICTED: Rattus norvegicus hypothetical protein LOC679382 (LOC679382), mRNA Length = 591 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 346 cttcttcctcttcttcttcctcttcctc 319
>ref|XM_001068645.1| PREDICTED: Rattus norvegicus hypothetical protein LOC688870 (LOC688870), mRNA Length = 582 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 337 cttcttcctcttcttcttcctcttcctc 310
>ref|XR_006495.1| PREDICTED: Rattus norvegicus hypothetical protein LOC688855 (LOC688855), mRNA Length = 306 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 58 cttcttcctcttcttcttcctcttcctc 31
>ref|XM_001056403.1| PREDICTED: Rattus norvegicus hypothetical protein LOC680269 (LOC680269), mRNA Length = 666 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 556 cttcttcctcttcttcttcctcttcctc 529 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 373 cttcttcctcttcttcttcctcttc 349
>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib Length = 2013089 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 1348392 cttcttcctcttcttcttcctcttcctc 1348419 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||| ||||||||||||||||||| Sbjct: 1348293 cttctgcctctccttcttcctcttc 1348317 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1348314 cttcttcctcttcttcttcctcttc 1348338 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 1549523 cttcttcctcttcttcttcctcttc 1549547
>gb|AC123298.4| Rattus norvegicus BAC CH230-352N4 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 175621 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 60825 cttcttcctcttcttcttcctcttcctc 60852
>gb|AC137843.15| Mus musculus chromosome 9, clone RP23-413J12, complete sequence Length = 197907 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 47517 cttcttcctcttcttcttcctcttcctc 47544
>gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, complete sequence Length = 218156 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 114597 ccttcttcctctccttcttcctct 114574 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 114609 ccttcttcctctccttcttcctct 114586 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 114621 ccttcttcctctccttcttcctct 114598 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 114632 cttcttcctctccttcttcctct 114610
>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence Length = 196951 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 164403 cttcttcctcttcttcttcctcttcctc 164430 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 164379 cttcttcctcttcttcttcctcttc 164403 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 164391 cttcttcctcttcttcttcctcttc 164415 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 164553 cttcttcctcttcttcttcctcttc 164577
>gb|AC159437.1| Trypanosoma brucei chromosome 7 clone RPCI93-29K4, complete sequence Length = 159858 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 99548 cttcttcctcttcttcttcctcttcctc 99521
>gb|AC113469.9| Mus musculus chromosome 8, clone RP23-261B5, complete sequence Length = 198937 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 83050 cttcttcctcttcttcttcctcttcctc 83023
>gb|AC132483.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0014C03, complete sequence Length = 143739 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 88303 cttcttcctcttcttcttcctcttcctc 88330
>gb|AC129775.4| Mus musculus BAC clone RP23-174N20 from chromosome 3, complete sequence Length = 225505 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 92556 cttcttcctcttcttcttcctcttcctc 92583
>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence Length = 110310 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 40238 cttcttcctcttcttcttcctcttcctc 40211 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 40100 cttcttcctcttcttcttcctcttc 40076 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 40199 cttcttcctcttcttcttcctcttc 40175
>gb|AC147661.2| Pan troglodytes BAC clone CH251-336D20 from Y, complete sequence Length = 160602 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 34125 cttcttcctcttcttcttcctcttcctc 34152
>gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, complete sequence Length = 241654 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 218908 cttcttcctcttcttcttcctcttcctc 218935
>gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, complete sequence Length = 196240 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 73935 cttcttcctcttcttcttcctcttcctc 73908
>gb|AC130529.2| Mus musculus BAC clone RP23-124O11 from chromosome 16, complete sequence Length = 231967 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 20672 cttcttcctcttcttcttcctcttcctc 20699 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 619 cttcctctccttcttcctcttcctc 643 |||||| |||||||||||||||||| Sbjct: 207288 cttcctttccttcttcctcttcctc 207312
>gb|AC144651.2| Mus musculus BAC clone RP24-251O18 from chromosome Y, complete sequence Length = 144831 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 116532 cttcttcctcttcttcttcctcttcctc 116505
>gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosome 16, complete sequence Length = 206486 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 143336 cttcttcttctccttcttcctcttcctc 143309
>gb|AC144932.6| Mus musculus BAC clone RP24-462H2 from chromosome 6, complete sequence Length = 140840 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 24205 cttcttcttctccttcttcctcttcctc 24178
>gb|AC102388.7| Mus musculus chromosome 3, clone RP24-298F19, complete sequence Length = 166620 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 13423 cttcttcctcttcttcttcctcttcctc 13450
>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence Length = 243671 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||||| Sbjct: 80789 cttcttcctttccttcttcctcttcctc 80816 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 59822 tcttcctcttcttcttcctcttcctc 59847
>gb|AC137742.3| Mus musculus BAC clone RP24-345F6 from chromosome 16, complete sequence Length = 170248 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 100618 cttcttcctcttcttcttcctcttcctc 100645
>gb|AC115948.12| Mus musculus chromosome 16, clone RP24-568J12, complete sequence Length = 212604 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 10846 cttcttcttctccttcttcctcttcctc 10819
>gb|AY288070.1| Ictalurus punctatus calnexin mRNA, complete cds Length = 2197 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 1663 cttcttcctcttcttcttcctcttcctc 1636
>gb|AC113198.15| Mus musculus chromosome 14, clone RP23-248E15, complete sequence Length = 236220 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 110623 cttcttcctcttcttcttcctcttcctc 110650 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 110760 cttcttcttctccttcttcctcttcctc 110787 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 110611 cttcttcctcttcttcttcctcttc 110635
>gb|AC145474.2| Rattus norvegicus chromosome 1 clone RP32-113N8 map q32, complete sequence Length = 137003 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 103098 cttcttcctcttcttcttcctcttcctc 103071
>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence Length = 236274 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 127051 cttcttcctcttcttcttcctcttcctc 127078
>gb|AC107454.12| Mus musculus chromosome 3, clone RP23-339P23, complete sequence Length = 199324 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 52849 cttcttcctcttcttcttcctcttcctc 52822
>gb|AC132116.3| Mus musculus BAC clone RP24-158K7 from chromosome 2, complete sequence Length = 165307 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 144467 cttcttcctcttcttcttcctcttcctc 144494
>gb|AC121971.3| Mus musculus BAC clone RP24-275H22 from chromosome 7, complete sequence Length = 195611 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 93015 cttcttcctcttcttcttcctcttcctc 92988 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 92907 cttcttcctcttcttcttcctcttc 92883 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 93136 cttcttcctcttcttcttcctcttc 93112 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 93166 cttcttcctcttcttcttcctcttc 93142 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 93208 cttcttcctcttcttcttcctcttc 93184
>gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome 1, complete sequence Length = 207475 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 141871 cttcttcctcttcttcttcctcttcctc 141898
>gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosome 14, complete sequence Length = 178501 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 98132 cttcttcctcttcttcttcctcttcctc 98159
>gb|AC121793.3| Mus musculus BAC clone RP23-407B23 from chromosome 9, complete sequence Length = 194815 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 5395 cttcttcctcttcttcttcctcttcctc 5422
>gb|U95743.1|HUU95743 Homo sapiens chromosome 16 BAC clone CIT987-SK65D3, complete sequence Length = 192730 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||| |||||||||||||| Sbjct: 89616 cttcttcctctccctcttcctcttcctc 89589
>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence Length = 189936 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 9472 cttcttcctcttcttcttcctcttcctc 9445
>gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, complete sequence Length = 211521 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 951 cttcttcctctacttcttcctcttcctc 978
>gb|AC163105.5| Mus musculus BAC clone RP23-259A11 from chromosome 14, complete sequence Length = 227806 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 210786 cttcttcctcttcttcttcctcttcctc 210759 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 210681 cttcttcctcttcttcttcctcttc 210657 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 210693 cttcttcctcttcttcttcctcttc 210669 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 210705 cttcttcctcttcttcttcctcttc 210681 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 210717 cttcttcctcttcttcttcctcttc 210693 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 210744 cttcttcctcttcttcttcctcttc 210720 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 210756 cttcttcctcttcttcttcctcttc 210732 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 210798 cttcttcctcttcttcttcctcttc 210774
>gb|AC142310.1| Pan troglodytes BAC clone RP43-45P13 from 7, complete sequence Length = 197471 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 169780 cttcttcctcttcttcttcctcttcctc 169807
>gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chromosome y, complete sequence Length = 196802 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 105084 cttcttcctcttcttcttcctcttcctc 105057
>gb|AC123687.20| Mus musculus chromosome 5, clone RP23-314A12, complete sequence Length = 189230 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 37082 cttcttcctcttcttcttcctcttcctc 37055
>gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, complete sequence Length = 191133 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 172310 cttcttcctcttcttcttcctcttcctc 172337
>gb|AC093479.13| Mus musculus chromosome 16, clone RP23-61K2, complete sequence Length = 243771 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 97997 cttcttcctcttcttcttcctcttcctc 97970
>ref|XM_819408.1| Trypanosoma brucei TREU927 clone RPCI93-29K4 hypothetical protein (Tb927.7.760) partial mRNA Length = 1710 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 85 cttcttcctcttcttcttcctcttcctc 58
>gb|AC134407.6| Homo sapiens chromosome 17, clone RP11-855A2, complete sequence Length = 199875 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 144723 cttcttcctcttcttcttcctcttcctc 144696
>ref|XM_661458.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.70508) partial mRNA Length = 1068 Score = 48.1 bits (24), Expect = 0.058 Identities = 30/32 (93%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctcaac 646 |||||||||||||||||||| |||||||||| Sbjct: 776 ccttcttcctctccttcttcgccttcctcaac 745
>gb|AC133618.3| Rattus norvegicus 18 BAC CH230-71N8 (Children's Hospital Oakland Research Institute) complete sequence Length = 234684 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 103336 cttcttcctcttcttcttcctcttcctc 103309
>gb|AC158238.2| Mus musculus BAC clone RP23-106F10 from chromosome 9, complete sequence Length = 242356 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||| |||||||||||||| Sbjct: 200686 cttcttcctctccctcttcctcttcctc 200659
>gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosome 9, complete sequence Length = 215002 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 175894 cttcttcctcttcttcttcctcttcctc 175867 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 175744 cttcttcctcttcttcttcctcttc 175720 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 175906 cttcttcctcttcttcttcctcttc 175882 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 175918 cttcttcctcttcttcttcctcttc 175894
>ref|XM_628608.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd7_4610), partial mRNA Length = 1068 Score = 48.1 bits (24), Expect = 0.058 Identities = 30/32 (93%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctcaac 646 |||||||||||||||||||| |||||||||| Sbjct: 776 ccttcttcctctccttcttcaccttcctcaac 745
>gb|AC159188.2| Mus musculus BAC clone RP24-247J24 from chromosome 13, complete sequence Length = 197018 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 78327 cttcttcctcttcttcttcctcttcctc 78300
>gb|AC023102.6| Homo sapiens chromosome 8, clone RP11-414L17, complete sequence Length = 175263 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 7438 ccttcttcctctccttcttcctct 7461 Score = 42.1 bits (21), Expect = 3.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctct 638 ||||||||||||||||||||| Sbjct: 7429 tcttcctctccttcttcctct 7449
>gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, complete sequence Length = 142645 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 118749 cttcttcctcttcttcttcctcttcctc 118722
>ref|NM_001034484.1| Bos taurus eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa (EIF3S7), mRNA gb|BC102156.1| Bos taurus eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa, mRNA (cDNA clone MGC:127237 IMAGE:7946041), complete cds Length = 1904 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 1740 cttcttcctcttcttcttcctcttcctc 1713
>ref|XM_814675.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508641.90) partial mRNA Length = 3627 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 77 cacctcttcttcctcctcgtcccttcca 104 ||||||||||||||||||||| |||||| Sbjct: 2970 cacctcttcttcctcctcgtcgcttcca 2943
>emb|CR388124.15| Zebrafish DNA sequence from clone CH211-72C8 in linkage group 15, complete sequence Length = 173535 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 621 tcctctccttcttcctcttcctca 644 |||||||||||||||||||||||| Sbjct: 60016 tcctctccttcttcctcttcctca 60039
>gb|AC147674.5| Pan troglodytes BAC clone CH251-28I8 from chromosome y, complete sequence Length = 193266 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 90140 cttcttcctcttcttcttcctcttcctc 90167
>gb|AC090985.6| Homo sapiens chromosome 15, clone RP11-763K15, complete sequence Length = 186078 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 124159 cttcttcctcttcttcttcctcttcctc 124186
>emb|AL611922.7| Human DNA sequence from clone RP11-633N4 on chromosome 9, complete sequence Length = 176612 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 620 ttcctctccttcttcctcttcctc 643 |||||||||||||||||||||||| Sbjct: 167479 ttcctctccttcttcctcttcctc 167502
>emb|AL391832.10| Human DNA sequence from clone RP11-443B7 on chromosome 1 Contains two novel genes (LOC284527), complete sequence Length = 144648 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 21363 cttcttcctcttcttcttcctcttcctc 21336
>emb|AL445604.9| Human DNA sequence from clone RP11-661D17 on chromosome 13 Contains a CpG island, complete sequence Length = 174615 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 123899 cttcttcctcttcttcttcctcttcctc 123872
>gb|AC024996.6| Homo sapiens chromosome 8, clone RP11-697C18, complete sequence Length = 177864 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 122306 cttcttcctcttcttcttcctcttcctc 122333 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 122326 tcttcctcttcttcttcctcttcctc 122351
>emb|AL354692.23| Human DNA sequence from clone RP11-361M4 on chromosome 9 Contains a novel pseudogene, complete sequence Length = 110443 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 73638 cttcttcctcttcttcttcctcttcctc 73665
>emb|AL161791.15| Human DNA sequence from clone RP11-82L2 on chromosome 9 Contains the 5' end of the SMC2L1 gene for SMC2 structural maintenance of chromosomes 2-like 1 (yeast) (CAPE, CAP-E, hCAP-E) and a CpG island, complete sequence Length = 108821 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 33076 cttcttcttctccttcttcctcttcctc 33049
>emb|AL139081.21| Human DNA sequence from clone RP11-179A7 on chromosome 13 Contains parts of 2 novel genes and the RFC3 gene for replication factor C (activator 1) 3, 38kDa, complete sequence Length = 185602 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 617 ttcttcctctccttcttcctcttc 640 |||||||||||||||||||||||| Sbjct: 61350 ttcttcctctccttcttcctcttc 61373
>emb|AL136968.14| Human DNA sequence from clone RP1-182O16 on chromosome 6 Contains the 5' end of a novel protein, a ribosomal protein L34 pseudogene, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH) pseudogene and a CpG island, complete sequence Length = 70541 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 47593 cttcttcctcttcttcttcctcttcctc 47566
>gb|S47695.1| YBL03-16=basic motif/leucine zipper domain protein homolog, YBL03-23=multidrug resistance PDR1 protein homolog [Saccharomyces cerevisiae, S288C, Genomic, 10 genes, 12684 nt] Length = 12684 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 412 cttcttcctcttcttcttcctcttcctc 385
>gb|AC134845.5| Mus musculus BAC clone RP24-424K5 from chromosome 1, complete sequence Length = 194449 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 81072 cttcttcctcttcttcttcctcttcctc 81099
>emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on chromosome 11 Contains the 5' end of the Lpo gene for lactoperoxidase, a novel gene, the Epx gene for eosinophil peroxidase, the Olfr462, Olfr463 and Olfr464 genes for olfactory receptors 462, 463 and 464, a novel gene, a cytochrome c oxidase subunit VIc (Cox6c) pseudogene, a ubiquitin-conjugating enzyme E2B (S. cerevisiae RAD6 homology) (Ube2b) pseudogene and the 3' end of the gene for dynein light chain 2 (6720463E02Rik), complete sequence Length = 184069 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 87461 cttcttcctcttcttcttcctcttcctc 87488 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 87499 tcttcctcttcttcttcctcttcctc 87524
>gb|AC064829.6|AC064829 Homo sapiens BAC clone RP11-375P13 from Y, complete sequence Length = 89684 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 16955 cttcttcctcttcttcttcctcttcctc 16982
>emb|AL672181.11| Mouse DNA sequence from clone RP23-223D16 on chromosome 11, complete sequence Length = 181460 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 3782 cttcttcctcttcttcttcctcttcctc 3809
>emb|CR933607.1| Homo sapiens mRNA; cDNA DKFZp686M17113 (from clone DKFZp686M17113) Length = 6217 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 726 cttcttcctcttcttcttcctcttcctc 699
>ref|NM_001017764.1| Danio rerio zgc:112083 (zgc:112083), mRNA gb|BC093191.1| Danio rerio zgc:112083, mRNA (cDNA clone MGC:112083 IMAGE:7416515), complete cds Length = 2245 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 621 tcctctccttcttcctcttcctca 644 |||||||||||||||||||||||| Sbjct: 1572 tcctctccttcttcctcttcctca 1595
>gb|AC155831.7| Mus musculus 10 BAC RP24-189B10 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 197153 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| |||| Sbjct: 142644 cttcttcctctccttcttcctctccctc 142617
>gb|AC068389.10| Homo sapiens chromosome 8, clone RP11-91I20, complete sequence Length = 171515 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 66550 ccttcttcctctccttcttcctct 66527 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 66562 ccttcttcctctccttcttcctct 66539 Score = 42.1 bits (21), Expect = 3.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctct 638 ||||||||||||||||||||| Sbjct: 66571 tcttcctctccttcttcctct 66551
>gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chromosome unknown, complete sequence Length = 184511 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 15446 cttcttcctcttcttcttcctcttcctc 15473
>gb|AC158510.2| Mus musculus BAC clone RP24-236E11 from chromosome 9, complete sequence Length = 178963 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||| |||||||||||||| Sbjct: 12998 cttcttcctctccctcttcctcttcctc 12971
>gb|AF369029.2| White spot syndrome virus, complete genome Length = 292967 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 175338 cttcttcctcttcttcttcctcttcctc 175311
>gb|AC152417.3| Mus musculus BAC clone RP23-56I21 from chromosome 10, complete sequence Length = 233783 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| |||| Sbjct: 228937 cttcttcctctccttcttcctctccctc 228910 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 228961 cttcttcctcttcttcttcctcttc 228937
>gb|AC132338.4| Mus musculus BAC clone RP24-158J16 from chromosome 5, complete sequence Length = 163304 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 92173 cttcttcctcttcttcttcctcttcctc 92146 Score = 42.1 bits (21), Expect = 3.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| | |||||||||||||| Sbjct: 92073 ccttcttcctcttcctcttcctcttcctc 92045
>gb|AC127279.3| Mus musculus BAC clone RP24-247K4 from chromosome 10, complete sequence Length = 185573 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| |||| Sbjct: 154130 cttcttcctctccttcttcctctccctc 154157 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 154106 cttcttcctcttcttcttcctcttc 154130
>gb|AC009058.10| Homo sapiens chromosome 16 clone RP11-292B23, complete sequence Length = 164844 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 88361 cttcttcttctccttcttcctcttcctc 88334
>gb|AC106870.4| Homo sapiens BAC clone RP11-223F18 from 2, complete sequence Length = 143441 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 34850 cttcttcctcttcttcttcctcttcctc 34823
>ref|NM_176075.2| Rattus norvegicus peroxisome proliferative activated receptor, gamma, coactivator 1 beta (Ppargc1b), mRNA gb|AY188951.1| Rattus norvegicus peroxisome proliferator-activated receptor gamma coactivator 1beta-2a mRNA, complete cds Length = 3163 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 1264 cttcttcctcttcttcttcctcttcctc 1237
>dbj|BS000547.1| Pan troglodytes chromosome Y clone:PTB-232N08, complete sequences Length = 219991 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 214596 cttcttcctcttcttcttcctcttcctc 214569
>gb|AC116162.5| Homo sapiens chromosome 15, clone RP11-268L17, complete sequence Length = 160580 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 14523 cttcttcctcttcttcttcctcttcctc 14550
>gb|AC115935.9| Mus musculus chromosome 3, clone RP24-545D23, complete sequence Length = 145137 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 47998 cttcttcctcttcttcttcctcttcctc 48025 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 48018 tcttcctcttcttcttcctcttcctc 48043
>emb|BX927223.9| Human DNA sequence from clone DAMA-380P17 on chromosome 6, complete sequence Length = 83649 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||| |||||||||||||| Sbjct: 62367 cttcttcctctccctcttcctcttcctc 62394 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 62405 tcttcctcttcttcttcctcttcctc 62430
>gb|AC018634.3|AC018634 Human Chromosome 7 clone RP11-243E12, complete sequence Length = 174241 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 145304 cttcttcctcttcttcttcctcttcctc 145331 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 146039 cttcttcctcttcttcttcctcttc 146063
>emb|AL772256.15| Mouse DNA sequence from clone RP23-141N19 on chromosome 2, complete sequence Length = 191321 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 65278 cttcttcctcttcttcttcctcttcctc 65305
>gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, complete sequence Length = 216692 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 24305 cttcttcctcttcttcttcctcttcctc 24332
>gb|AC102618.19| Mus musculus chromosome 18, clone RP23-426G16, complete sequence Length = 242449 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 129280 cttcttcctcttcttcttcctcttcctc 129253 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 129292 cttcttcctcttcttcttcctcttc 129268 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 129304 cttcttcctcttcttcttcctcttc 129280
>gb|AF440570.1| Shrimp white spot syndrome virus, complete genome Length = 307287 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 159980 cttcttcctcttcttcttcctcttcctc 159953
>gb|AC155244.2| Mus musculus BAC clone RP24-318B2 from 13, complete sequence Length = 198847 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 24690 cttcttcctcttcttcttcctcttcctc 24717
>dbj|AP005061.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-419P8, complete sequence Length = 186074 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 13307 cttcttcttctccttcttcctcttcctc 13280
>gb|AC154381.2| Mus musculus BAC clone RP23-42E2 from 16, complete sequence Length = 201052 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 24465 cttcttcttctccttcttcctcttcctc 24492
>gb|DQ331969.1| Synthetic construct Saccharomyces cerevisiae clone FLH202494.01X SCT1 gene, complete sequence Length = 2280 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 2236 cttcttcctcttcttcttcctcttcctc 2209
>gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, complete sequence Length = 240821 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 127196 cttcttcctctacttcttcctcttcctc 127169
>gb|AF174394.1|AF174394 Homo sapiens apoptotic-related protein PCAR mRNA, partial cds Length = 988 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 169 cttcttcctcttcttcttcctcttcctc 142
>emb|AJ314608.1|SCE314608 Saccharomyces cerevisiae GAT2 gene for glycerol-3-phosphate acyltransferase Length = 2253 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 2209 cttcttcctcttcttcttcctcttcctc 2182
>emb|Z35773.1|SCYBL012C S.cerevisiae chromosome II reading frame ORF YBL012c Length = 2874 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 2538 cttcttcctcttcttcttcctcttcctc 2511
>gb|AC156797.2| Mus musculus BAC clone RP24-88A16 from chromosome 14, complete sequence Length = 166341 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 135242 cttcttcctcttcttcttcctcttcctc 135269 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 135230 cttcttcctcttcttcttcctcttc 135254 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 135272 cttcttcctcttcttcttcctcttc 135296 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 135284 cttcttcctcttcttcttcctcttc 135308 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 135311 cttcttcctcttcttcttcctcttc 135335 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 135323 cttcttcctcttcttcttcctcttc 135347 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 135335 cttcttcctcttcttcttcctcttc 135359 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 135347 cttcttcctcttcttcttcctcttc 135371
>dbj|AP005136.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-715F3, complete sequence Length = 174547 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 78475 cttcttcttctccttcttcctcttcctc 78448
>emb|AL929577.9| Mouse DNA sequence from clone RP23-455B1 on chromosome 4, complete sequence Length = 152910 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 46385 cttcttcctcttcttcttcctcttcctc 46412
>emb|AL732551.8| Mouse DNA sequence from clone RP23-277K1 on chromosome 4, complete sequence Length = 127241 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 11283 cttcttcctcttcttcttcctcttcctc 11310
>gb|AC140195.3| Mus musculus BAC clone RP24-64A19 from 6, complete sequence Length = 156314 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 127072 cttcttcttctccttcttcctcttcctc 127045
>gb|AC127569.4| Mus musculus BAC clone RP24-216E20 from 9, complete sequence Length = 168588 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 23550 cttcttcctcttcttcttcctcttcctc 23577 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 23526 cttcttcctcttcttcttcctcttc 23550 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 23538 cttcttcctcttcttcttcctcttc 23562 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 23700 cttcttcctcttcttcttcctcttc 23724
>gb|AC140924.4| Mus musculus BAC clone RP24-249B5 from Y, complete sequence Length = 200241 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 63513 cttcttcctcttcttcttcctcttcctc 63486
>gb|AC122017.5| Mus musculus BAC clone RP24-361J4 from 7, complete sequence Length = 158807 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 77388 cttcttcctcttcttcttcctcttcctc 77415
>emb|CT025665.14| Mouse DNA sequence from clone RP24-340L11 on chromosome 9, complete sequence Length = 151896 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 10328 cttcttcctcttcttcttcctcttcctc 10301
>gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, complete sequence Length = 211064 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||||| Sbjct: 169454 cttcttcctttccttcttcctcttcctc 169481 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 148487 tcttcctcttcttcttcctcttcctc 148512
>gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, complete sequence Length = 209693 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 69139 ccttcttcctctccttcttcctct 69162 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 69151 ccttcttcctctccttcttcctct 69174 Score = 48.1 bits (24), Expect = 0.058 Identities = 24/24 (100%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctct 638 |||||||||||||||||||||||| Sbjct: 69163 ccttcttcctctccttcttcctct 69186 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 69128 cttcttcctctccttcttcctct 69150
>gb|AC140220.4| Mus musculus BAC clone RP23-279P6 from 5, complete sequence Length = 182156 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||| |||||||| Sbjct: 92223 cttcttcctctccttcttcttcttcctc 92250 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||||||||||| |||||||| Sbjct: 92241 cttcttcctctccttcttcttcttcctc 92268 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 175839 cttcttcctcttcttcttcctcttc 175863
>gb|AC145168.5| Mus musculus BAC clone RP23-398K14 from 3, complete sequence Length = 217058 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 43585 cttcttcctcttcttcttcctcttcctc 43558
>gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complete sequence Length = 174224 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 152705 cttcttcctcttcttcttcctcttcctc 152678
>emb|CT027693.11| Mouse DNA sequence from clone RP24-120H1 on chromosome 16, complete sequence Length = 186376 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 49624 cttcttcctcttcttcttcctcttcctc 49597
>emb|AL592225.17| Mouse DNA sequence from clone RP23-278M14 on chromosome 1, complete sequence Length = 183397 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 167843 cttcttcctcttcttcttcctcttcctc 167816
>emb|AL672293.14| Mouse DNA sequence from clone RP23-180D16 on chromosome X, complete sequence Length = 177087 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 43497 cttcttcctcttcttcttcctcttcctc 43470
>emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chromosome X, complete sequence Length = 193219 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 59486 cttcttcctcttcttcttcctcttcctc 59459 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 59348 cttcttcctcttcttcttcctcttc 59324
>emb|AL807815.3| Mouse DNA sequence from clone RP23-207H16 on chromosome 4, complete sequence Length = 206914 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 204923 cttcttcctcttcttcttcctcttcctc 204950
>emb|AL807773.7| Mouse DNA sequence from clone RP23-228L24 on chromosome X, complete sequence Length = 186645 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 |||| ||||||||||||||||||||||| Sbjct: 116117 cttcctcctctccttcttcctcttcctc 116144
>emb|AL772214.3| Mouse DNA sequence from clone RP23-370C18 on chromosome 2, complete sequence Length = 181349 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 65615 cttcttcctcttcttcttcctcttcctc 65588
>emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chromosome 11, complete sequence Length = 205030 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 25419 cttcttcctcttcttcttcctcttcctc 25392 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 25335 cttcttcctcttcttcttcctcttc 25311
>emb|AL671975.12| Mouse DNA sequence from clone RP23-25O15 on chromosome X, complete sequence Length = 231530 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 56565 cttcttcctcttcttcttcctcttcctc 56592 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 56532 cttcttcctcttcttcttcctcttc 56556 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 56553 cttcttcctcttcttcttcctcttc 56577
>emb|AL163195.5|CNS01RIH Human chromosome 14 DNA sequence BAC R-14J7 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 162209 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 112015 cttcttcctcttcttcttcctcttcctc 111988
>emb|AL034384.1|HSMTM0 Human chromosome Xq28, cosmid clones 7H3, 14D7, C1230, 11E7, F1096, A12197, 12G8, A09100; complete sequence bases 1..217657 Length = 217657 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 113749 cttcttcctcttcttcttcctcttcctc 113722
>dbj|D38256.1|YSCSCT1 Yeast gene for suppressor of ctr mutation Length = 3262 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 2861 cttcttcctcttcttcttcctcttcctc 2834
>gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, complete sequence Length = 146301 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||| |||||||||||||||||||| Sbjct: 83565 cttcttcttctccttcttcctcttcctc 83538
>emb|AL833802.4| Mouse DNA sequence from clone RP23-17A4 on chromosome 4, complete sequence Length = 8077 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 9 cttcttcctcttcttcttcctcttcctc 36
>emb|AL645824.12| Mouse DNA sequence from clone RP23-200O20 on chromosome 4, complete sequence Length = 145443 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 22415 cttcttcctcttcttcttcctcttcctc 22388 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 22427 cttcttcctcttcttcttcctcttc 22403 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 22439 cttcttcctcttcttcttcctcttc 22415
>emb|AL670319.4| Mouse DNA sequence from clone RP23-315E18 on chromosome 4, complete sequence Length = 40107 Score = 48.1 bits (24), Expect = 0.058 Identities = 27/28 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||||| Sbjct: 11146 cttcttcctcttcttcttcctcttcctc 11173
>ref|XR_026834.1| PREDICTED: Gallus gallus similar to retinoblastoma protein-binding zinc finger protein (LOC419478), mRNA Length = 6066 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctca 644 ||||||||| ||||||||||||||||| Sbjct: 3256 tcttcctcttcttcttcctcttcctca 3282
>ref|NM_001074487.1| Oryza sativa (japonica cultivar-group) Os11g0508600 (Os11g0508600) mRNA, complete cds Length = 1492 Score = 46.1 bits (23), Expect = 0.23 Identities = 38/43 (88%) Strand = Plus / Plus Query: 352 cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394 |||||| |||||||||||||||| ||| ||||||||||||| Sbjct: 471 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 513 Score = 44.1 bits (22), Expect = 0.90 Identities = 37/42 (88%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| |||||| |||| |||||||||| |||| Sbjct: 709 aagagcgtggagttcatgccgttctcgctctccttctccctc 750
>gb|AC189568.1| Brassica rapa subsp. pekinensis clone KBrH009I04, complete sequence Length = 162363 Score = 46.1 bits (23), Expect = 0.23 Identities = 29/31 (93%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctcaacgg 648 ||||||||| ||||||| ||||||||||||| Sbjct: 108659 tcttcctcttcttcttcttcttcctcaacgg 108689
>gb|AC189201.1| Brassica rapa subsp. pekinensis clone KBrB005N03, complete sequence Length = 166828 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 621 tcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| Sbjct: 46286 tcctctccttcttcctcttcctc 46308
>gb|DQ537336.1| Triticum aestivum clones BAC 1289J04; BAC 1001P20, complete sequence Length = 206063 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 117662 ttcttcctcttcttcttcctcttcctc 117688 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||| ||||||||||||||||| Sbjct: 119066 cttcttcttctccttcttcctcttc 119090
>gb|BT025997.1| Arabidopsis thaliana At1g24120 mRNA, complete cds Length = 1311 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 1197 ttcttcctcttcttcttcctcttcctc 1171
>ref|NM_102258.3| Arabidopsis thaliana ARL1; heat shock protein binding / unfolded protein binding (ARL1) mRNA, complete cds Length = 1699 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 1445 ttcttcctcttcttcttcctcttcctc 1419
>ref|XM_632536.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0187101) mRNA, complete cds Length = 3414 Score = 46.1 bits (23), Expect = 0.23 Identities = 29/31 (93%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctcaac 646 ||||||||||| ||||||||||||| ||||| Sbjct: 1294 cttcttcctcttcttcttcctcttcttcaac 1264
>ref|XM_642384.1| Dictyostelium discoideum AX4 putative non-transporter ABC protein (abcF4) mRNA, complete cds Length = 3429 Score = 46.1 bits (23), Expect = 0.23 Identities = 29/31 (93%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctcaac 646 ||||||||||| ||||||||||||| ||||| Sbjct: 721 cttcttcctcttcttcttcctcttcttcaac 691
>gb|AC119870.17| Mus musculus chromosome 3, clone RP24-261K17, complete sequence Length = 144502 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 621 tcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| Sbjct: 59872 tcctctccttcttcctcttcctc 59894
>gb|AC137759.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0008H02, complete sequence Length = 143438 Score = 46.1 bits (23), Expect = 0.23 Identities = 38/43 (88%) Strand = Plus / Minus Query: 352 cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394 |||||| |||||||||||||||| ||| ||||||||||||| Sbjct: 82412 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 82370 Score = 44.1 bits (22), Expect = 0.90 Identities = 37/42 (88%) Strand = Plus / Minus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| |||||| |||| |||||||||| |||| Sbjct: 82075 aagagcgtggagttcatgccgttctcgctctccttctccctc 82034
>gb|AC140389.3| Mus musculus BAC clone RP24-202H2 from chromosome 18, complete sequence Length = 169195 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcct 642 ||||||||||| ||||||||||||||| Sbjct: 107605 cttcttcctcttcttcttcctcttcct 107631 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcct 642 ||||||||||| ||||||||||||||| Sbjct: 107668 cttcttcctcttcttcttcctcttcct 107694
>gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, complete sequence Length = 171023 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 30964 ttcttcctcttcttcttcctcttcctc 30990
>gb|AC157944.2| Mus musculus BAC clone RP23-456N8 from chromosome 15, complete sequence Length = 179092 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 614 cccttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||||| Sbjct: 60634 cccttcttcctttccttcttcctcttc 60660
>gb|AC153594.15| Mus musculus 10 BAC RP23-98N14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 208555 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttc 640 ||||||||||||||||||||||| Sbjct: 172088 tcttcctctccttcttcctcttc 172066
>gb|AC090437.62| Mus musculus strain C57BL/6J clone rp23-11f20 map 6, complete sequence Length = 227127 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcctcttc 640 ||||||||||||| ||||||||||||| Sbjct: 170719 cccttcttcctcttcttcttcctcttc 170693
>gb|AC124978.19| Mus musculus chromosome 5, clone RP24-107D19, complete sequence Length = 182405 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcct 642 ||||||| ||||||||||||||||||| Sbjct: 40875 cttcttcttctccttcttcctcttcct 40849
>gb|AC113476.20| Mus musculus chromosome 17, clone RP23-304J1, complete sequence Length = 227026 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 621 tcctctccttcttcctcttcctc 643 ||||||||||||||||||||||| Sbjct: 76917 tcctctccttcttcctcttcctc 76939 Score = 42.1 bits (21), Expect = 3.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||||||| | |||||||||||||| Sbjct: 76923 ccttcttcctcttcctcttcctcttcctc 76951
>gb|AC132349.3| Mus musculus BAC clone RP24-82B7 from chromosome 16, complete sequence Length = 216783 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 51377 ttcttcctcttcttcttcctcttcctc 51351
>gb|AC123803.4| Mus musculus BAC clone RP24-492I15 from chromosome 10, complete sequence Length = 169964 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 102760 ttcttcctcttcttcttcctcttcctc 102734 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcctcttc 640 ||||||||||||| ||||||||||||| Sbjct: 102790 cccttcttcctcttcttcttcctcttc 102764
>gb|AC132427.4| Mus musculus BAC clone RP23-326N11 from chromosome 18, complete sequence Length = 192806 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcct 642 |||||||||||||||||| |||||||| Sbjct: 154912 cttcttcctctccttctttctcttcct 154886
>gb|AC122911.4| Mus musculus BAC clone RP23-60K16 from 8, complete sequence Length = 150400 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 126727 ttcttcctcttcttcttcctcttcctc 126701
>gb|AC115356.5| Mus musculus BAC clone RP23-47E9 from 15, complete sequence Length = 212177 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 614 cccttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||||| Sbjct: 187112 cccttcttcctttccttcttcctcttc 187138
>gb|AY226825.1| Arabidopsis thaliana ARG1-like protein 1 (ARL1) mRNA, complete cds Length = 1626 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 1445 ttcttcctcttcttcttcctcttcctc 1419
>gb|AC090647.6| Genomic sequence for Mus musculus, clone RP23-252I12, complete sequence Length = 139891 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcct 636 ||||||||||||||||||||||| Sbjct: 45111 cccttcttcctctccttcttcct 45089
>emb|BX571713.11| Zebrafish DNA sequence from clone DKEY-19H21 in linkage group 9, complete sequence Length = 103882 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 ||||||||| ||||||||||||||||| Sbjct: 29495 ttcttcctcgccttcttcctcttcctc 29469
>gb|AF479256.1| Dictyostelium discoideum non-transporter ABC protein AbcF4 (abcF4) gene, complete cds; and unknown gene Length = 5003 Score = 46.1 bits (23), Expect = 0.23 Identities = 29/31 (93%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcctcaac 646 ||||||||||| ||||||||||||| ||||| Sbjct: 2003 cttcttcctcttcttcttcctcttcttcaac 1973
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11 Length = 28386948 Score = 46.1 bits (23), Expect = 0.23 Identities = 38/43 (88%) Strand = Plus / Minus Query: 352 cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394 |||||| |||||||||||||||| ||| ||||||||||||| Sbjct: 17574601 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 17574559 Score = 44.1 bits (22), Expect = 0.90 Identities = 37/42 (88%) Strand = Plus / Minus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| |||||| |||| |||||||||| |||| Sbjct: 17574264 aagagcgtggagttcatgccgttctcgctctccttctccctc 17574223 Score = 42.1 bits (21), Expect = 3.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 77 cacctcttcttcctcctcgtc 97 ||||||||||||||||||||| Sbjct: 17873877 cacctcttcttcctcctcgtc 17873897
>gb|AY074564.1| Arabidopsis thaliana At1g24120/F3I6_4 mRNA, complete cds Length = 1695 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 1440 ttcttcctcttcttcttcctcttcctc 1414
>emb|AL451132.9| Human DNA sequence from clone RP11-7N10 on chromosome 9 Contains a pseudogene similar to part of serine/threonine kinase 33 (STK33), complete sequence Length = 69362 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 614 cccttcttcctctccttcttcctcttc 640 ||||||||||||| ||||||||||||| Sbjct: 55240 cccttcttcctcttcttcttcctcttc 55214
>emb|AL049537.48|HS1164I10 Human DNA sequence from clone RP5-1164I10 on chromosome 20q13.13-13.2 Contains part of the BIG2 gene for brefeldin A-inhibited guanine nucleotide-exchange protein 2, ESTs, STSs, GSSs and two CpG islands, complete sequence Length = 110028 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 2132 ttcttcctcttcttcttcctcttcctc 2106 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 1910 tcttcctcttcttcttcctcttcctc 1885
>gb|AC153557.8| Mus musculus 10 BAC RP23-203H20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 233640 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctcttcct 642 ||||||||||| ||||||||||||||| Sbjct: 183231 cttcttcctcttcttcttcctcttcct 183257
>gb|AC157095.9| Mus musculus 6 BAC RP24-350P11 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 177800 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttc 640 ||||||||||||||||||||||| Sbjct: 169925 tcttcctctccttcttcctcttc 169947
>dbj|AK101913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033071H09, full insert sequence Length = 1494 Score = 46.1 bits (23), Expect = 0.23 Identities = 38/43 (88%) Strand = Plus / Plus Query: 352 cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394 |||||| |||||||||||||||| ||| ||||||||||||| Sbjct: 472 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 514 Score = 44.1 bits (22), Expect = 0.90 Identities = 37/42 (88%) Strand = Plus / Plus Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637 ||||||||||||| |||||| |||| |||||||||| |||| Sbjct: 710 aagagcgtggagttcatgccgttctcgctctccttctccctc 751
>dbj|AK113733.1| Ciona intestinalis cDNA, clone:ciad065h05, full insert sequence Length = 924 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 908 ttcttcctcttcttcttcctcttcctc 882
>gb|AC171017.3| Gallus gallus BAC clone CH261-1F11 from chromosome ul, complete sequence Length = 189284 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Plus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 165588 cttcttcctctccttcttcctct 165610
>emb|CT009632.14| Mouse DNA sequence from clone RP23-5G10 on chromosome 16, complete sequence Length = 208600 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 196382 cttcttcctctccttcttcctct 196360 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttc 640 |||||||||||||||||||| ||||| Sbjct: 196371 ccttcttcctctccttcttcttcttc 196346
>emb|AL732329.7| Mouse DNA sequence from clone RP23-118K22 on chromosome 2, complete sequence Length = 209002 Score = 46.1 bits (23), Expect = 0.23 Identities = 23/23 (100%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctct 638 ||||||||||||||||||||||| Sbjct: 183056 cttcttcctctccttcttcctct 183034 Score = 42.1 bits (21), Expect = 3.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 615 ccttcttcctctccttcttcctcttcctc 643 |||||||| ||||||||||| |||||||| Sbjct: 183075 ccttcttcttctccttcttcttcttcctc 183047
>emb|AL589876.11| Mouse DNA sequence from clone RP23-117O11 on chromosome 2, complete sequence Length = 221782 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 614 cccttcttcctctccttcttcctcttc 640 ||||||||||||| ||||||||||||| Sbjct: 110674 cccttcttcctcttcttcttcctcttc 110700
>emb|AL590994.13| Mouse DNA sequence from clone RP23-382C19 on chromosome 11, complete sequence Length = 207814 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||||||||||| |||||||| Sbjct: 200721 ttcttcctctccttcttcttcttcctc 200747
>gb|AC166328.4| Mus musculus BAC clone RP23-31H5 from chromosome 5, complete sequence Length = 215189 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttcct 642 ||||||| ||||||||||||||||||| Sbjct: 159131 cttcttcttctccttcttcctcttcct 159105
>gb|AC002396.1| Arabidopsis thaliana chromosome I BAC F3I6 genomic sequence, complete sequence Length = 122358 Score = 46.1 bits (23), Expect = 0.23 Identities = 26/27 (96%) Strand = Plus / Plus Query: 617 ttcttcctctccttcttcctcttcctc 643 |||||||||| |||||||||||||||| Sbjct: 8709 ttcttcctcttcttcttcctcttcctc 8735
>gb|AC190152.2| Gallus gallus BAC clone CH261-171P12 from chromosome z, complete sequence Length = 287458 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||||| |||||||||||||| Sbjct: 2173 tcttcctctccctcttcctcttcctc 2198
>gb|AY843356.1| Nandopsis managuensis voucher stri-178 cytochrome b gene, complete cds; mitochondrial Length = 1137 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 619 cttcctctccttcttcctcttcctca 644 |||||||| ||||||||||||||||| Sbjct: 1065 cttcctctacttcttcctcttcctca 1090
>gb|AY843338.1| Nandopsis managuensis voucher stri-1128 cytochrome b gene, complete cds; mitochondrial Length = 1137 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Plus Query: 619 cttcctctccttcttcctcttcctca 644 |||||||| ||||||||||||||||| Sbjct: 1065 cttcctctacttcttcctcttcctca 1090
>gb|AC188553.3| Pan troglodytes BAC clone CH251-326P23 from chromosome 7, complete sequence Length = 195466 Score = 44.1 bits (22), Expect = 0.90 Identities = 25/26 (96%) Strand = Plus / Minus Query: 618 tcttcctctccttcttcctcttcctc 643 ||||||||| |||||||||||||||| Sbjct: 72273 tcttcctcttcttcttcctcttcctc 72248 Score = 42.1 bits (21), Expect = 3.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 616 cttcttcctctccttcttcctcttc 640 ||||||||||| ||||||||||||| Sbjct: 71951 cttcttcctcttcttcttcctcttc 71927 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 156,229,771 Number of extensions: 9049875 Number of successful extensions: 300916 Number of sequences better than 10.0: 1197 Number of HSP's gapped: 300822 Number of HSP's successfully gapped: 1571 Length of query: 947 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 924 Effective length of database: 18,503,978,556 Effective search space: 17097676185744 Effective search space used: 17097676185744 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)