ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf86i11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ245885.1| Zea mays clone 21709 mRNA sequence 172 1e-39
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 123 1e-24
3dbj|AP003535.2| Oryza sativa (japonica cultivar-group) genomic D... 123 1e-24
4ref|NM_001056606.1| Oryza sativa (japonica cultivar-group) Os03g... 98 7e-17
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 98 7e-17
6gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome... 98 7e-17
7ref|NM_001056634.1| Oryza sativa (japonica cultivar-group) Os03g... 60 2e-05
8gb|AC134231.2| Oryza sativa (japonica cultivar-group) chromosome... 60 2e-05
9dbj|AK109114.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 2e-05
10gb|BT018599.1| Zea mays clone EL01N0449A02.d mRNA sequence 58 6e-05
11gb|AC116730.7| Mus musculus chromosome 1, clone RP23-346J11, com... 58 6e-05
12gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, com... 58 6e-05
13dbj|AK242853.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 54 0.001
14ref|NM_001073287.1| Oryza sativa (japonica cultivar-group) Os12g... 54 0.001
15gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence 54 0.001
16dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 54 0.001
17gb|AC115062.13| Mus musculus chromosome 3, clone RP24-399B3, com... 54 0.001
18emb|AL713927.3|CNS07YP4 Oryza sativa chromosome 12, . BAC OSJNBa... 54 0.001
19ref|NM_001063010.1| Oryza sativa (japonica cultivar-group) Os05g... 52 0.004
20gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, com... 52 0.004
21gb|AC102176.8| Mus musculus chromosome 15, clone RP23-480E14, co... 52 0.004
22gb|AC098598.2| Oryza sativa (japonica cultivar-group) chromosome... 52 0.004
23gb|AC105260.2| Oryza sativa (japonica cultivar-group) chromosome... 52 0.004
24gb|AC159807.2| Mus musculus BAC clone RP24-399D3 from chromosome... 52 0.004
25dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.004
26dbj|AK069614.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.004
27gb|AY855168.1| Rattus norvegicus RPGR mRNA, partial cds 52 0.004
28gb|AC127270.4| Mus musculus BAC clone RP23-453E16 from 12, compl... 52 0.004
29ref|NM_001050058.1| Oryza sativa (japonica cultivar-group) Os01g... 50 0.015
30ref|NM_001049805.1| Oryza sativa (japonica cultivar-group) Os01g... 50 0.015
31gb|AC114150.5| Rattus norvegicus BAC CH230-145N21 () complete s... 50 0.015
32ref|XR_007627.1| PREDICTED: Rattus norvegicus hypothetical prote... 50 0.015
33gb|AC168212.7| Mus musculus chromosome 18, clone RP23-290N19, co... 50 0.015
34gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosom... 50 0.015
35gb|AC167405.5| Mus musculus chromosome 18, clone wi1-977A17, com... 50 0.015
36gb|AC102567.8| Mus musculus chromosome 9, clone RP23-224F1, comp... 50 0.015
37gb|AC111111.11| Mus musculus chromosome 3, clone RP23-201A9, com... 50 0.015
38gb|AC138270.12| Mus musculus chromosome 7, clone RP23-323F17, co... 50 0.015
39gb|AC020931.6| Homo sapiens chromosome 19 clone CTD-2240E14, com... 50 0.015
40gb|AC006055.1| Homo sapiens 3p22 Contig 7 PAC RPCI4-672N11 (Rosw... 50 0.015
41ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical... 50 0.015
42ref|XM_810894.1| Trypanosoma cruzi strain CL Brener histone deac... 50 0.015
43gb|AC121565.4| Mus musculus BAC clone RP23-223J11 from chromosom... 50 0.015
44dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic D... 50 0.015
45dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic D... 50 0.015
46dbj|AK104255.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.015
47dbj|AK104143.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.015
48dbj|AK066226.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.015
49gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome... 50 0.015
50gb|AC155813.2| Mus musculus BAC clone RP24-167L2 from 9, complet... 50 0.015
51gb|AY105872.1| Zea mays PCO079046 mRNA sequence 50 0.015
52gb|AC139333.4| Mus musculus BAC clone RP24-83F12 from 3, complet... 50 0.015
53gb|AC166173.3| Mus musculus BAC clone RP23-101K10 from chromosom... 50 0.015
54gb|AC153841.1| Mus musculus 6 BAC RP23-260M5 (Roswell Park Cance... 50 0.015
55emb|AL732485.8| Mouse DNA sequence from clone RP23-70G24 on chro... 50 0.015
56emb|AM055942.3| Toxoplasma gondii RH, genomic DNA chromosome Ia 48 0.058
57ref|XM_840607.1| Trypanosoma brucei TREU927 hypothetical protein... 48 0.058
58emb|CR848757.23| Zebrafish DNA sequence from clone CH211-207L3 i... 48 0.058
59ref|XM_001140477.1| PREDICTED: Pan troglodytes similar to transc... 48 0.058
60ref|XM_001138991.1| PREDICTED: Pan troglodytes similar to transc... 48 0.058
61ref|XM_001137389.1| PREDICTED: Pan troglodytes similar to transc... 48 0.058
62gb|AC185507.9| Mus musculus BAC RP24-186O7 () complete sequence 48 0.058
63ref|XM_001053229.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
64ref|XM_001072916.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
65ref|XM_001057439.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
66ref|XM_001075539.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
67ref|XM_001080603.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
68ref|XM_001070899.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
69ref|XM_001055005.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
70ref|XM_001070896.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
71ref|XM_001060498.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
72ref|XR_006617.1| PREDICTED: Rattus norvegicus hypothetical prote... 48 0.058
73ref|XM_001056093.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
74ref|XM_001068645.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
75ref|XR_006495.1| PREDICTED: Rattus norvegicus hypothetical prote... 48 0.058
76ref|XM_001056403.1| PREDICTED: Rattus norvegicus hypothetical pr... 48 0.058
77emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 48 0.058
78gb|AC123298.4| Rattus norvegicus BAC CH230-352N4 (Children's Ho... 48 0.058
79gb|AC137843.15| Mus musculus chromosome 9, clone RP23-413J12, co... 48 0.058
80gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, c... 48 0.058
81gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosom... 48 0.058
82gb|AC159437.1| Trypanosoma brucei chromosome 7 clone RPCI93-29K4... 48 0.058
83gb|AC113469.9| Mus musculus chromosome 8, clone RP23-261B5, comp... 48 0.058
84gb|AC132483.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.058
85gb|AC129775.4| Mus musculus BAC clone RP23-174N20 from chromosom... 48 0.058
86gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7... 48 0.058
87gb|AC147661.2| Pan troglodytes BAC clone CH251-336D20 from Y, co... 48 0.058
88gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, co... 48 0.058
89gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, co... 48 0.058
90gb|AC130529.2| Mus musculus BAC clone RP23-124O11 from chromosom... 48 0.058
91gb|AC144651.2| Mus musculus BAC clone RP24-251O18 from chromosom... 48 0.058
92gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosom... 48 0.058
93gb|AC144932.6| Mus musculus BAC clone RP24-462H2 from chromosome... 48 0.058
94gb|AC102388.7| Mus musculus chromosome 3, clone RP24-298F19, com... 48 0.058
95gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 48 0.058
96gb|AC137742.3| Mus musculus BAC clone RP24-345F6 from chromosome... 48 0.058
97gb|AC115948.12| Mus musculus chromosome 16, clone RP24-568J12, c... 48 0.058
98gb|AY288070.1| Ictalurus punctatus calnexin mRNA, complete cds 48 0.058
99gb|AC113198.15| Mus musculus chromosome 14, clone RP23-248E15, c... 48 0.058
100gb|AC145474.2| Rattus norvegicus chromosome 1 clone RP32-113N8 m... 48 0.058
101gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, co... 48 0.058
102gb|AC107454.12| Mus musculus chromosome 3, clone RP23-339P23, co... 48 0.058
103gb|AC132116.3| Mus musculus BAC clone RP24-158K7 from chromosome... 48 0.058
104gb|AC121971.3| Mus musculus BAC clone RP24-275H22 from chromosom... 48 0.058
105gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome... 48 0.058
106gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosom... 48 0.058
107gb|AC121793.3| Mus musculus BAC clone RP23-407B23 from chromosom... 48 0.058
108gb|U95743.1|HUU95743 Homo sapiens chromosome 16 BAC clone CIT987... 48 0.058
109gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, comple... 48 0.058
110gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, com... 48 0.058
111gb|AC163105.5| Mus musculus BAC clone RP23-259A11 from chromosom... 48 0.058
112gb|AC142310.1| Pan troglodytes BAC clone RP43-45P13 from 7, comp... 48 0.058
113gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chrom... 48 0.058
114gb|AC123687.20| Mus musculus chromosome 5, clone RP23-314A12, co... 48 0.058
115gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, compl... 48 0.058
116gb|AC093479.13| Mus musculus chromosome 16, clone RP23-61K2, com... 48 0.058
117ref|XM_819408.1| Trypanosoma brucei TREU927 clone RPCI93-29K4 hy... 48 0.058
118gb|AC134407.6| Homo sapiens chromosome 17, clone RP11-855A2, com... 48 0.058
119ref|XM_661458.1| Cryptosporidium hominis TU502 hypothetical prot... 48 0.058
120gb|AC133618.3| Rattus norvegicus 18 BAC CH230-71N8 (Children's H... 48 0.058
121gb|AC158238.2| Mus musculus BAC clone RP23-106F10 from chromosom... 48 0.058
122gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosom... 48 0.058
123ref|XM_628608.1| Cryptosporidium parvum Iowa II hypothetical pro... 48 0.058
124gb|AC159188.2| Mus musculus BAC clone RP24-247J24 from chromosom... 48 0.058
125gb|AC023102.6| Homo sapiens chromosome 8, clone RP11-414L17, com... 48 0.058
126gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, compl... 48 0.058
127ref|NM_001034484.1| Bos taurus eukaryotic translation initiation... 48 0.058
128ref|XM_814675.1| Trypanosoma cruzi strain CL Brener hypothetical... 48 0.058
129emb|CR388124.15| Zebrafish DNA sequence from clone CH211-72C8 in... 48 0.058
130gb|AC147674.5| Pan troglodytes BAC clone CH251-28I8 from chromos... 48 0.058
131gb|AC090985.6| Homo sapiens chromosome 15, clone RP11-763K15, co... 48 0.058
132emb|AL611922.7| Human DNA sequence from clone RP11-633N4 on chro... 48 0.058
133emb|AL391832.10| Human DNA sequence from clone RP11-443B7 on chr... 48 0.058
134emb|AL445604.9| Human DNA sequence from clone RP11-661D17 on chr... 48 0.058
135gb|AC024996.6| Homo sapiens chromosome 8, clone RP11-697C18, com... 48 0.058
136emb|AL354692.23| Human DNA sequence from clone RP11-361M4 on chr... 48 0.058
137emb|AL161791.15| Human DNA sequence from clone RP11-82L2 on chro... 48 0.058
138emb|AL139081.21| Human DNA sequence from clone RP11-179A7 on chr... 48 0.058
139emb|AL136968.14| Human DNA sequence from clone RP1-182O16 on chr... 48 0.058
140gb|S47695.1| YBL03-16=basic motif/leucine zipper domain protein ... 48 0.058
141gb|AC134845.5| Mus musculus BAC clone RP24-424K5 from chromosome... 48 0.058
142emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on ch... 48 0.058
143gb|AC064829.6|AC064829 Homo sapiens BAC clone RP11-375P13 from Y... 48 0.058
144emb|AL672181.11| Mouse DNA sequence from clone RP23-223D16 on ch... 48 0.058
145emb|CR933607.1| Homo sapiens mRNA; cDNA DKFZp686M17113 (from clo... 48 0.058
146ref|NM_001017764.1| Danio rerio zgc:112083 (zgc:112083), mRNA >g... 48 0.058
147gb|AC155831.7| Mus musculus 10 BAC RP24-189B10 (Roswell Park Can... 48 0.058
148gb|AC068389.10| Homo sapiens chromosome 8, clone RP11-91I20, com... 48 0.058
149gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chrom... 48 0.058
150gb|AC158510.2| Mus musculus BAC clone RP24-236E11 from chromosom... 48 0.058
151gb|AF369029.2| White spot syndrome virus, complete genome 48 0.058
152gb|AC152417.3| Mus musculus BAC clone RP23-56I21 from chromosome... 48 0.058
153gb|AC132338.4| Mus musculus BAC clone RP24-158J16 from chromosom... 48 0.058
154gb|AC127279.3| Mus musculus BAC clone RP24-247K4 from chromosome... 48 0.058
155gb|AC009058.10| Homo sapiens chromosome 16 clone RP11-292B23, co... 48 0.058
156gb|AC106870.4| Homo sapiens BAC clone RP11-223F18 from 2, comple... 48 0.058
157ref|NM_176075.2| Rattus norvegicus peroxisome proliferative acti... 48 0.058
158dbj|BS000547.1| Pan troglodytes chromosome Y clone:PTB-232N08, c... 48 0.058
159gb|AC116162.5| Homo sapiens chromosome 15, clone RP11-268L17, co... 48 0.058
160gb|AC115935.9| Mus musculus chromosome 3, clone RP24-545D23, com... 48 0.058
161emb|BX927223.9| Human DNA sequence from clone DAMA-380P17 on chr... 48 0.058
162gb|AC018634.3|AC018634 Human Chromosome 7 clone RP11-243E12, com... 48 0.058
163emb|AL772256.15| Mouse DNA sequence from clone RP23-141N19 on ch... 48 0.058
164gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, co... 48 0.058
165gb|AC102618.19| Mus musculus chromosome 18, clone RP23-426G16, c... 48 0.058
166gb|AF440570.1| Shrimp white spot syndrome virus, complete genome 48 0.058
167gb|AC155244.2| Mus musculus BAC clone RP24-318B2 from 13, comple... 48 0.058
168dbj|AP005061.3| Homo sapiens genomic DNA, chromosome 18 clone:RP... 48 0.058
169gb|AC154381.2| Mus musculus BAC clone RP23-42E2 from 16, complet... 48 0.058
170gb|DQ331969.1| Synthetic construct Saccharomyces cerevisiae clon... 48 0.058
171gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, co... 48 0.058
172gb|AF174394.1|AF174394 Homo sapiens apoptotic-related protein PC... 48 0.058
173emb|AJ314608.1|SCE314608 Saccharomyces cerevisiae GAT2 gene for ... 48 0.058
174emb|Z35773.1|SCYBL012C S.cerevisiae chromosome II reading frame ... 48 0.058
175gb|AC156797.2| Mus musculus BAC clone RP24-88A16 from chromosome... 48 0.058
176dbj|AP005136.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 48 0.058
177emb|AL929577.9| Mouse DNA sequence from clone RP23-455B1 on chro... 48 0.058
178emb|AL732551.8| Mouse DNA sequence from clone RP23-277K1 on chro... 48 0.058
179gb|AC140195.3| Mus musculus BAC clone RP24-64A19 from 6, complet... 48 0.058
180gb|AC127569.4| Mus musculus BAC clone RP24-216E20 from 9, comple... 48 0.058
181gb|AC140924.4| Mus musculus BAC clone RP24-249B5 from Y, complet... 48 0.058
182gb|AC122017.5| Mus musculus BAC clone RP24-361J4 from 7, complet... 48 0.058
183emb|CT025665.14| Mouse DNA sequence from clone RP24-340L11 on ch... 48 0.058
184gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, comple... 48 0.058
185gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, compl... 48 0.058
186gb|AC140220.4| Mus musculus BAC clone RP23-279P6 from 5, complet... 48 0.058
187gb|AC145168.5| Mus musculus BAC clone RP23-398K14 from 3, comple... 48 0.058
188gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complet... 48 0.058
189emb|CT027693.11| Mouse DNA sequence from clone RP24-120H1 on chr... 48 0.058
190emb|AL592225.17| Mouse DNA sequence from clone RP23-278M14 on ch... 48 0.058
191emb|AL672293.14| Mouse DNA sequence from clone RP23-180D16 on ch... 48 0.058
192emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chro... 48 0.058
193emb|AL807815.3| Mouse DNA sequence from clone RP23-207H16 on chr... 48 0.058
194emb|AL807773.7| Mouse DNA sequence from clone RP23-228L24 on chr... 48 0.058
195emb|AL772214.3| Mouse DNA sequence from clone RP23-370C18 on chr... 48 0.058
196emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chro... 48 0.058
197emb|AL671975.12| Mouse DNA sequence from clone RP23-25O15 on chr... 48 0.058
198emb|AL163195.5|CNS01RIH Human chromosome 14 DNA sequence BAC R-1... 48 0.058
199emb|AL034384.1|HSMTM0 Human chromosome Xq28, cosmid clones 7H3, ... 48 0.058
200dbj|D38256.1|YSCSCT1 Yeast gene for suppressor of ctr mutation 48 0.058
201gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, compl... 48 0.058
202emb|AL833802.4| Mouse DNA sequence from clone RP23-17A4 on chrom... 48 0.058
203emb|AL645824.12| Mouse DNA sequence from clone RP23-200O20 on ch... 48 0.058
204emb|AL670319.4| Mouse DNA sequence from clone RP23-315E18 on chr... 48 0.058
205ref|XR_026834.1| PREDICTED: Gallus gallus similar to retinoblast... 46 0.23
206ref|NM_001074487.1| Oryza sativa (japonica cultivar-group) Os11g... 46 0.23
207gb|AC189568.1| Brassica rapa subsp. pekinensis clone KBrH009I04,... 46 0.23
208gb|AC189201.1| Brassica rapa subsp. pekinensis clone KBrB005N03,... 46 0.23
209gb|DQ537336.1| Triticum aestivum clones BAC 1289J04; BAC 1001P20... 46 0.23
210gb|BT025997.1| Arabidopsis thaliana At1g24120 mRNA, complete cds 46 0.23
211ref|NM_102258.3| Arabidopsis thaliana ARL1; heat shock protein b... 46 0.23
212ref|XM_632536.1| Dictyostelium discoideum AX4 hypothetical prote... 46 0.23
213ref|XM_642384.1| Dictyostelium discoideum AX4 putative non-trans... 46 0.23
214gb|AC119870.17| Mus musculus chromosome 3, clone RP24-261K17, co... 46 0.23
215gb|AC137759.4| Oryza sativa (japonica cultivar-group) chromosome... 46 0.23
216gb|AC140389.3| Mus musculus BAC clone RP24-202H2 from chromosome... 46 0.23
217gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, c... 46 0.23
218gb|AC157944.2| Mus musculus BAC clone RP23-456N8 from chromosome... 46 0.23
219gb|AC153594.15| Mus musculus 10 BAC RP23-98N14 (Roswell Park Can... 46 0.23
220gb|AC090437.62| Mus musculus strain C57BL/6J clone rp23-11f20 ma... 46 0.23
221gb|AC124978.19| Mus musculus chromosome 5, clone RP24-107D19, co... 46 0.23
222gb|AC113476.20| Mus musculus chromosome 17, clone RP23-304J1, co... 46 0.23
223gb|AC132349.3| Mus musculus BAC clone RP24-82B7 from chromosome ... 46 0.23
224gb|AC123803.4| Mus musculus BAC clone RP24-492I15 from chromosom... 46 0.23
225gb|AC132427.4| Mus musculus BAC clone RP23-326N11 from chromosom... 46 0.23
226gb|AC122911.4| Mus musculus BAC clone RP23-60K16 from 8, complet... 46 0.23
227gb|AC115356.5| Mus musculus BAC clone RP23-47E9 from 15, complet... 46 0.23
228gb|AY226825.1| Arabidopsis thaliana ARG1-like protein 1 (ARL1) m... 46 0.23
229gb|AC090647.6| Genomic sequence for Mus musculus, clone RP23-252... 46 0.23
230emb|BX571713.11| Zebrafish DNA sequence from clone DKEY-19H21 in... 46 0.23
231gb|AF479256.1| Dictyostelium discoideum non-transporter ABC prot... 46 0.23
232dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.23
233gb|AY074564.1| Arabidopsis thaliana At1g24120/F3I6_4 mRNA, compl... 46 0.23
234emb|AL451132.9| Human DNA sequence from clone RP11-7N10 on chrom... 46 0.23
235emb|AL049537.48|HS1164I10 Human DNA sequence from clone RP5-1164... 46 0.23
236gb|AC153557.8| Mus musculus 10 BAC RP23-203H20 (Roswell Park Can... 46 0.23
237gb|AC157095.9| Mus musculus 6 BAC RP24-350P11 (Roswell Park Canc... 46 0.23
238dbj|AK101913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.23
239dbj|AK113733.1| Ciona intestinalis cDNA, clone:ciad065h05, full ... 46 0.23
240gb|AC171017.3| Gallus gallus BAC clone CH261-1F11 from chromosom... 46 0.23
241emb|CT009632.14| Mouse DNA sequence from clone RP23-5G10 on chro... 46 0.23
242emb|AL732329.7| Mouse DNA sequence from clone RP23-118K22 on chr... 46 0.23
243emb|AL589876.11| Mouse DNA sequence from clone RP23-117O11 on ch... 46 0.23
244emb|AL590994.13| Mouse DNA sequence from clone RP23-382C19 on ch... 46 0.23
245gb|AC166328.4| Mus musculus BAC clone RP23-31H5 from chromosome ... 46 0.23
246gb|AC002396.1| Arabidopsis thaliana chromosome I BAC F3I6 genomi... 46 0.23
247gb|AC190152.2| Gallus gallus BAC clone CH261-171P12 from chromos... 44 0.90
248gb|AY843356.1| Nandopsis managuensis voucher stri-178 cytochrome... 44 0.90
249gb|AY843338.1| Nandopsis managuensis voucher stri-1128 cytochrom... 44 0.90
250gb|AC188553.3| Pan troglodytes BAC clone CH251-326P23 from chrom... 44 0.90
251gb|AC189110.3| Gallus gallus BAC clone CH261-127N1 from chromoso... 44 0.90
252dbj|AK243531.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 44 0.90
253ref|XM_001178990.1| PREDICTED: Strongylocentrotus purpuratus sim... 44 0.90
254ref|XM_001188733.1| PREDICTED: Strongylocentrotus purpuratus hyp... 44 0.90
255ref|XM_781880.2| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.90
256ref|XM_001200784.1| PREDICTED: Strongylocentrotus purpuratus hyp... 44 0.90
257ref|NM_001060867.1| Oryza sativa (japonica cultivar-group) Os04g... 44 0.90
258gb|DQ908628.1| Gossypium hirsutum clone LIB5327-003-A1-N1-E2_FS_... 44 0.90
259emb|CU104663.1| Gorilla DNA sequence from clone CH255-397I3, com... 44 0.90
260ref|XM_001129281.1| PREDICTED: Homo sapiens hypothetical protein... 44 0.90
261gb|AC189456.1| Brassica rapa subsp. pekinensis clone KBrB073D09,... 44 0.90
262ref|XR_006859.1| PREDICTED: Rattus norvegicus hypothetical prote... 44 0.90
263ref|XM_001067123.1| PREDICTED: Rattus norvegicus hypothetical pr... 44 0.90
264ref|XM_001067535.1| PREDICTED: Rattus norvegicus hypothetical pr... 44 0.90
265ref|XM_001069870.1| PREDICTED: Rattus norvegicus hypothetical pr... 44 0.90
266ref|XR_005905.1| PREDICTED: Rattus norvegicus hypothetical prote... 44 0.90
267ref|XM_001071712.1| PREDICTED: Rattus norvegicus hypothetical pr... 44 0.90
268emb|CT010436.19| Mouse DNA sequence from clone RP23-212H16 on ch... 44 0.90
269emb|AL732348.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 44 0.90
270ref|NM_121320.2| Arabidopsis thaliana unknown protein (AT5G13170... 44 0.90
271gb|AC167143.2| Mus musculus BAC clone RP23-38J9 from chromosome ... 44 0.90
272gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, com... 44 0.90
273gb|AC154786.2| Mus musculus BAC clone RP24-468B14 from chromosom... 44 0.90
274gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome... 44 0.90
275gb|AC153799.1| Mus musculus BAC RP23-145M15 (Roswell Park Cance... 44 0.90
276gb|AC166828.3| Mus musculus BAC clone RP23-332O23 from chromosom... 44 0.90
277gb|AC159381.10| Mus musculus 6 BAC RP24-460E4 (Roswell Park Canc... 44 0.90
278gb|AC149364.2| Phakopsora pachyrhizi clone JGIAFNA-53G12, comple... 44 0.90
279gb|AC115972.13| Mus musculus chromosome 5, clone RP24-79A6, comp... 44 0.90
280gb|AC149330.2| Phakopsora pachyrhizi clone JGIAFNA-13C18, comple... 44 0.90
281gb|AC087042.2| Rattus norvegicus strain Brown Norway clone RP31-... 44 0.90
282gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, com... 44 0.90
283gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG... 44 0.90
284gb|AY534123.1|SEG_AY534122S2 Aegilops tauschii transposons Caspa... 44 0.90
285gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, c... 44 0.90
286gb|AC120406.27| Mus musculus chromosome 12, clone RP24-418L10, c... 44 0.90
287gb|AC164430.3| Mus musculus BAC clone RP23-441D9 from chromosome... 44 0.90
288gb|AC102410.5| Mus musculus chromosome 18, clone RP24-369O1, com... 44 0.90
289gb|AC116146.14| Mus musculus chromosome 7, clone RP24-168I21, co... 44 0.90
290gb|AC102923.10| Mus musculus chromosome 1, clone RP24-262J2, com... 44 0.90
291gb|AC114621.8| Mus musculus chromosome 3, clone RP24-93M7, compl... 44 0.90
292gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos... 44 0.90
293gb|AC101715.8| Mus musculus chromosome 1, clone RP23-283P17, com... 44 0.90
294gb|AC100427.25| Mus musculus chromosome 10, clone RP23-136J15, c... 44 0.90
295gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hos... 44 0.90
296gb|AC102096.11| Mus musculus chromosome 18, clone RP23-37J18, co... 44 0.90
297gb|AC137147.9| Mus musculus chromosome 5, clone RP24-141O20, com... 44 0.90
298gb|AC161197.9| Mus musculus chromosome 7, clone RP23-179K11, com... 44 0.90
299gb|AC106595.9| Rattus norvegicus 7 BAC CH230-237N20 (Children's ... 44 0.90
300gb|AC101968.11| Mus musculus chromosome 3, clone RP24-257N17, co... 44 0.90
301gb|AC158625.9| Mus musculus 6 BAC RP23-78J15 (Roswell Park Cance... 44 0.90
302gb|AC140451.3| Mus musculus BAC clone RP23-52L6 from chromosome ... 44 0.90
303gb|AC139579.3| Mus musculus BAC clone RP23-139E6 from chromosome... 44 0.90
304gb|AC132331.3| Mus musculus BAC clone RP24-217D10 from chromosom... 44 0.90
305gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosom... 44 0.90
306gb|AC144849.2| Mus musculus BAC clone RP24-482B19 from chromosom... 44 0.90
307gb|AY494860.1| Ceratocystis fimbriata microsatellite AAG-9 sequence 44 0.90
308gb|AC165154.2| Mus musculus BAC clone RP23-302C3 from chromosome... 44 0.90
309gb|AC164296.2| Mus musculus BAC clone RP24-342N6 from chromosome... 44 0.90
310gb|AC104880.13| Mus musculus chromosome 12, clone RP23-141H24, c... 44 0.90
311gb|AC118232.10| Mus musculus chromosome 9, clone RP23-462C3, com... 44 0.90
312gb|AC133191.3| Mus musculus chromosome 18 clone RP23-390K15, com... 44 0.90
313gb|AC137525.3| Mus musculus BAC clone RP23-68H24 from chromosome... 44 0.90
314gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's... 44 0.90
315gb|AC126668.3| Mus musculus BAC clone RP24-370N20 from chromosom... 44 0.90
316gb|AC127677.4| Mus musculus BAC clone RP24-226C2 from chromosome... 44 0.90
317gb|AC121983.3| Mus musculus BAC clone RP24-292F8 from chromosome... 44 0.90
318gb|AC124581.4| Mus musculus BAC clone RP23-116E3 from chromosome... 44 0.90
319gb|AC122540.4| Mus musculus BAC clone RP24-555K13 from chromosom... 44 0.90
320gb|AC127331.4| Mus musculus BAC clone RP23-127A19 from 18, compl... 44 0.90
321gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, ... 44 0.90
322gb|AC125329.4| Mus musculus BAC clone RP23-198F7 from 10, comple... 44 0.90
323gb|AC098889.3| Mus musculus BAC clone RP23-122O10 from 10, compl... 44 0.90
324gb|AC121877.2| Mus musculus BAC clone RP24-127G8 from 7, complet... 44 0.90
325gb|AC122031.2| Mus musculus BAC clone RP24-401P10 from 6, comple... 44 0.90
326gb|AC124276.5| Homo sapiens chromosome 11, clone RP13-631K18, co... 44 0.90
327gb|AC103703.5| Homo sapiens chromosome 17, clone RP11-764D10, co... 44 0.90
328gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, compl... 44 0.90
329gb|AC073316.6| Homo sapiens BAC clone RP11-191P7 from 7, complet... 44 0.90
330gb|AC113528.8| Mus musculus chromosome 18, clone RP23-419F17, co... 44 0.90
331gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, com... 44 0.90
332gb|AC163440.3| Mus musculus chromosome 1, clone RP23-445K8, comp... 44 0.90
333gb|AC105631.4| Rattus norvegicus 1 BAC CH230-132J4 (Children's H... 44 0.90
334gb|AC116320.5| Mus musculus chromosome 18 clone RP23-269B16, com... 44 0.90
335gb|AC158756.4| Mus musculus chromosome 5, clone RP24-151L11, com... 44 0.90
336gb|AC101004.6| Mus musculus, clone RP23-79E5, complete sequence 44 0.90
337gb|AC127789.4| Rattus norvegicus 1 BAC CH230-15M17 (Children's H... 44 0.90
338gb|AC096070.7| Rattus norvegicus 4 BAC CH230-20J7 (Children's Ho... 44 0.90
339ref|XM_662335.1| Cryptosporidium hominis TU502 transmembrane pro... 44 0.90
340gb|AC153993.23| Mus musculus 6 BAC RP24-568N16 (Roswell Park Can... 44 0.90
341gb|AC153839.10| Mus musculus 6 BAC RP23-93A21 (Roswell Park Canc... 44 0.90
342gb|AC162381.7| Mus musculus 10 BAC RP24-528B14 (Roswell Park Can... 44 0.90
343gb|AC115870.18| Mus musculus chromosome 1, clone RP24-339L17, co... 44 0.90
344gb|AC156610.10| Mus musculus chromosome 7, clone RP23-331C4, com... 44 0.90
345gb|AY113934.1| Arabidopsis thaliana putative senescence-associat... 44 0.90
346gb|AC160145.6| Mus musculus 10 BAC RP24-160D12 (Roswell Park Can... 44 0.90
347gb|AY045949.1| Arabidopsis thaliana putative senescence-associat... 44 0.90
348dbj|AK156909.1| Mus musculus activated spleen cDNA, RIKEN full-l... 44 0.90
349gb|AC159886.2| Mus musculus BAC clone RP24-397P9 from chromosome... 44 0.90
350gb|AC157351.11| Mus musculus chromosome 5, clone RP23-219K16, co... 44 0.90
351gb|AC026689.6| Homo sapiens chromosome 5 clone CTB-55A14, comple... 44 0.90
352gb|AC087518.5| Homo sapiens chromosome , clone RP11-359E19, comp... 44 0.90
353gb|AC108685.4| Homo sapiens X BAC RP11-323F16 (Roswell Park Canc... 44 0.90
354gb|AC027319.5| Homo sapiens chromosome 19 clone CTC-518P12, comp... 44 0.90
355gb|AC011495.8| Homo sapiens chromosome 19 clone CTB-33G10, compl... 44 0.90
356gb|AC124224.1| Homo sapiens chromosome 19 clone LLNLR-285D11, co... 44 0.90
357gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome... 44 0.90
358gb|AY050613.1| Nandopsis managuensis cytochrome b (cytb) gene, p... 44 0.90
359emb|AM087608.1| Hordeum vulgare tpase gene for transposase-relat... 44 0.90
360ref|NM_025256.4| Homo sapiens euchromatic histone-lysine N-methy... 44 0.90
361ref|NM_006709.2| Homo sapiens euchromatic histone-lysine N-methy... 44 0.90
362ref|XM_815547.1| Trypanosoma cruzi strain CL Brener mucin-associ... 44 0.90
363ref|XM_813634.1| Trypanosoma cruzi strain CL Brener hypothetical... 44 0.90
364dbj|AK042232.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 44 0.90
365dbj|AK042094.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 44 0.90
366dbj|AK076376.1| Mus musculus 10 days neonate skin cDNA, RIKEN fu... 44 0.90
367ref|XM_809918.1| Trypanosoma cruzi strain CL Brener mucin-associ... 44 0.90
368ref|XM_797630.1| Trypanosoma cruzi strain CL Brener mucin-associ... 44 0.90
369gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex B... 44 0.90
370gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B... 44 0.90
371gb|AC007493.7| Homo sapiens chromosome 16 clone RP11-21B23, comp... 44 0.90
372gb|AC020983.8| Homo sapiens chromosome 7 clone RP11-269N18, comp... 44 0.90
373gb|AC079089.8| Homo sapiens chromosome 8, clone RP11-159H10, com... 44 0.90
374gb|AC084264.7| Homo sapiens chromosome 2, clone CTB-2122H5, comp... 44 0.90
375dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.90
376dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.90
377gb|AC025106.8| Homo sapiens chromosome 11, clone RP11-734D5, com... 44 0.90
378emb|X69838.1|HSG9A H.sapiens mRNA for G9a 44 0.90
379gb|AF218853.1|AF218853 Mus musculus cytochrome P450 arachidonic ... 44 0.90
380gb|AC022733.8| Homo sapiens chromosome 8, clone RP11-470M17, com... 44 0.90
381emb|Z83846.1|HS415G2 Human DNA sequence from clone CTA-415G2 on ... 44 0.90
382emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on ch... 44 0.90
383emb|AL691497.8| Human DNA sequence from clone RP11-542C10 on chr... 44 0.90
384emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c... 44 0.90
385emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr... 44 0.90
386emb|AL590302.6| Human DNA sequence from clone RP11-252P19 on chr... 44 0.90
387gb|AC018362.8| Homo sapiens chromosome 15 clone RP11-265N6 map 1... 44 0.90
388emb|AL359260.20| Human DNA sequence from clone RP11-73H14 on chr... 44 0.90
389emb|AL359649.8| Human DNA sequence from clone RP11-65D24 on chro... 44 0.90
390dbj|AB209433.1| Homo sapiens mRNA for HLA-B associated transcrip... 44 0.90
391emb|AL138958.18| Human DNA sequence from clone RP11-206I15 on ch... 44 0.90
392gb|AC155719.11| Mus musculus 6 BAC RP24-236K6 (Roswell Park Canc... 44 0.90
393gb|BC020970.1| Homo sapiens euchromatic histone-lysine N-methylt... 44 0.90
394gb|BC018718.1| Homo sapiens euchromatic histone-lysine N-methylt... 44 0.90
395gb|BC002686.1| Homo sapiens euchromatic histone-lysine N-methylt... 44 0.90
396gb|BC009351.1| Homo sapiens euchromatic histone-lysine N-methylt... 44 0.90
397gb|AC106505.4| Rattus norvegicus 1 BAC CH230-206C20 (Children's ... 44 0.90
398gb|AC158233.2| Mus musculus BAC clone RP23-240E15 from chromosom... 44 0.90
399gb|AC159296.2| Mus musculus BAC clone RP23-278O17 from chromosom... 44 0.90
400gb|AC133597.5| Mus musculus BAC clone RP24-313B5 from chromosome... 44 0.90
401gb|AC161588.2| Mus musculus BAC clone RP24-447G12 from chromosom... 44 0.90
402gb|AC010480.7| Homo sapiens chromosome 5 clone CTD-2315M5, compl... 44 0.90
403gb|AC114533.17| Mus musculus chromosome 1, clone RP24-255G23, co... 44 0.90
404gb|AC021078.5| Homo sapiens chromosome 5 clone CTB-89H12, comple... 44 0.90
405emb|Z49939.1|SC9959 S.cerevisiae chromosome XIII cosmid 9959 44 0.90
406gb|AY087836.1| Arabidopsis thaliana clone 38843 mRNA, complete s... 44 0.90
407emb|AL391711.1|ATT19L5 Arabidopsis thaliana DNA chromosome 5, BA... 44 0.90
408emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segmen... 44 0.90
409emb|AL663076.17| Mouse DNA sequence from clone RP23-6I12 on chro... 44 0.90
410emb|AL627222.10| Mouse DNA sequence from clone RP23-265A5 on chr... 44 0.90
411gb|AF017349.1|SEG_MMDSGIII07 Mus musculus desmoglein 3 (Dsg3) ge... 44 0.90
412emb|AL589738.6| Mouse DNA sequence from clone RP23-322J11 on chr... 44 0.90
413emb|AJ315532.1|HSA315532 Homo sapiens mRNA for NG36/G9a protein 44 0.90
414gb|AC158597.7| Mus musculus 10 BAC RP24-216E13 (Roswell Park Can... 44 0.90
415gb|AC159748.5| Mus musculus 10 BAC RP24-363O22 (Roswell Park Can... 44 0.90
416gb|AC160409.6| Mus musculus 10 BAC RP23-184O11 (Roswell Park Can... 44 0.90
417gb|AC160000.9| Mus musculus 6 BAC RP24-340J19 (Roswell Park Canc... 44 0.90
418emb|CR936237.6| Human DNA sequence from clone DAAP-66K18 on chro... 44 0.90
419dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.90
420emb|AL662930.29| Mouse DNA sequence from clone RP23-212B18 on ch... 44 0.90
421emb|AL645847.15| Mouse DNA sequence from clone RP23-428I5 on chr... 44 0.90
422emb|AL645907.9| Mouse DNA sequence from clone RP23-9N7 on chromo... 44 0.90
423emb|AL773511.5| Mouse DNA sequence from clone RP24-66J23 on chro... 44 0.90
424emb|AL611944.10| Mouse DNA sequence from clone RP23-279E14 on ch... 44 0.90
425emb|CR788238.10| Human DNA sequence from clone DAMC-45E14 on chr... 44 0.90
426gb|AC154843.2| Mus musculus BAC clone RP23-58N15 from chromosome... 44 0.90
427gb|AC015977.9| Homo sapiens BAC clone RP11-527I18 from 2, comple... 44 0.90
428gb|AC155725.3| Mus musculus 6 BAC RP24-231N5 (Roswell Park Cance... 44 0.90
429gb|AC160725.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 44 0.90
430gb|AC022146.8| Homo sapiens chromosome 19 clone CTD-3020H12, com... 44 0.90
431gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, com... 44 0.90
432gb|AC155263.2| Mus musculus BAC clone RP23-415I11 from chromosom... 44 0.90
433emb|CR759784.6| Human DNA sequence from clone DAMC-303C24 on chr... 44 0.90
434emb|CR859090.1| Pongo pygmaeus mRNA; cDNA DKFZp459J2429 (from cl... 44 0.90
435dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 44 0.90
436emb|BX005460.8| Human DNA sequence from clone DASS-36P22 on chro... 44 0.90
437dbj|AP005738.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.90
438emb|CR388219.12| Human DNA sequence from clone DADB-122G4 on chr... 44 0.90
439gb|AC113303.16| Mus musculus chromosome 5, clone RP23-431E5, com... 44 0.90
440gb|AC007722.9|AC007722 Homo sapiens chromosome 17, clone CTC-803... 44 0.90
441gb|AC024590.8| Homo sapiens chromosome 16 clone RP11-487C14, com... 44 0.90
442gb|AC009232.3| Homo sapiens BAC clone RP11-352J11 from 2, comple... 44 0.90
443gb|AC011242.8| Homo sapiens BAC clone RP11-489K22 from 2, comple... 44 0.90
444gb|AC069019.8|AC069019 Mus musculus BAC RP23-455N13 (Roswell Pa... 44 0.90
445dbj|AP003074.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.90
446dbj|AK024444.1| Homo sapiens mRNA for FLJ00034 protein, partial cds 44 0.90
447gb|AC118656.4| Homo sapiens chromosome 11, clone RP11-313H5, com... 44 0.90
448gb|AF254411.1|AF254411 Homo sapiens ser/arg-rich pre-mRNA splici... 44 0.90
449gb|AC012157.21| Homo sapiens 12 BAC RP11-493P1 (Roswell Park Can... 44 0.90
450gb|AC079607.5| Homo sapiens BAC clone CTD-2262F3 from 2, complet... 44 0.90
451gb|AC018663.3|AC018663 Human Chromosome 7 clone RP11-288A3, comp... 44 0.90
452gb|AC007912.6|AC007912 Homo sapiens chromosome , clone RP11-8A1,... 44 0.90
453dbj|AK102818.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.90
454emb|AL111360.1|CNS0199K Botrytis cinerea strain T4 cDNA library 44 0.90
455emb|AL113368.1|CNS01ATC Botrytis cinerea strain T4 cDNA library 44 0.90
456emb|AL113092.1|CNS01ALO Botrytis cinerea strain T4 cDNA library 44 0.90
457emb|AL112940.1|CNS01AHG Botrytis cinerea strain T4 cDNA library 44 0.90
458emb|AL112382.1|CNS01A1Y Botrytis cinerea strain T4 cDNA library 44 0.90
459gb|AC138117.4| Mus musculus BAC clone RP24-146K16 from chromosom... 44 0.90
460dbj|AK099969.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.90
461emb|BX829518.1|CNS0A267 Arabidopsis thaliana Full-length cDNA Co... 44 0.90
462emb|BX830132.1|CNS0A181 Arabidopsis thaliana Full-length cDNA Co... 44 0.90
463dbj|AK060697.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.90
464dbj|AP004476.1| Lotus japonicus genomic DNA, chromosome 1, clone... 44 0.90
465gb|AC117651.8| Mus musculus chromosome 3, clone RP23-287I17, com... 44 0.90
466gb|AY855166.1| Phodopus sungorus RPGR mRNA, partial cds 44 0.90
467gb|AC117622.10| Mus musculus chromosome 5, clone RP23-114L5, com... 44 0.90
468gb|AC009363.4|AC009363 Homo sapiens chromosome 14 clone CTD-2317... 44 0.90
469gb|AC144904.6| Mus musculus chromosome 3, clone RP23-272C9, comp... 44 0.90
470gb|AC157016.3| Mus musculus 10 BAC RP24-505M19 (Roswell Park Can... 44 0.90
471ref|NM_021228.1| Homo sapiens serine arginine-rich pre-mRNA spli... 44 0.90
472gb|AC127686.4| Mus musculus BAC clone RP24-188G23 from 3, comple... 44 0.90
473gb|DQ332664.1| Synthetic construct Saccharomyces cerevisiae clon... 44 0.90
474gb|AC140241.3| Mus musculus BAC clone RP23-283I15 from chromosom... 44 0.90
475emb|AL162551.4|CNS01RHW Human chromosome 14 DNA sequence BAC R-4... 44 0.90
476emb|AL121576.5|CNS01DRW Human chromosome 14 DNA sequence BAC R-4... 44 0.90
477gb|AC073946.23| Mus musculus strain C57BL/6J chromosome 8 clone ... 44 0.90
478gb|AF016898.1|AF016898 Homo sapiens B-ATF gene, complete cds 44 0.90
479gb|AC151534.2| Mus musculus BAC clone RP23-446E13 from 7, comple... 44 0.90
480emb|BX284626.3| Mouse DNA sequence from clone RP23-76P19 on chro... 44 0.90
481gb|AC133174.5| Mus musculus BAC clone RP24-314N20 from 12, compl... 44 0.90
482gb|AC140416.2| Mus musculus BAC clone RP24-347A16 from 6, comple... 44 0.90
483gb|AC132091.3| Mus musculus BAC clone RP24-465H15 from 18, compl... 44 0.90
484gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complet... 44 0.90
485gb|AC003042.1|AC003042 Homo sapiens chromosome 17, clone HCIT75G... 44 0.90
486emb|CT009627.9| Mouse DNA sequence from clone RP23-71E4 on chrom... 44 0.90
487gb|AC004790.1|AC004790 Homo sapiens chromosome 19, cosmid F17987... 44 0.90
488gb|AC122881.4| Mus musculus BAC clone RP23-79J21 from 13, comple... 44 0.90
489gb|AC124490.4| Mus musculus BAC clone RP23-453I1 from 16, comple... 44 0.90
490emb|AL845455.7| Mouse DNA sequence from clone RP23-325E4 on chro... 44 0.90
491emb|AL844576.9| Mouse DNA sequence from clone RP23-233M15 on chr... 44 0.90
492emb|AL807745.7| Mouse DNA sequence from clone RP23-20E10 on chro... 44 0.90
493emb|AL831752.7| Mouse DNA sequence from clone RP23-414J22 on chr... 44 0.90
494emb|AL844609.6| Mouse DNA sequence from clone RP23-356F8 on chro... 44 0.90
495emb|AL663048.12| Mouse DNA sequence from clone RP23-166N12 on ch... 44 0.90
496emb|AL611970.11| Mouse DNA sequence from clone RP23-413K17 on ch... 44 0.90
497emb|AL732547.8| Mouse DNA sequence from clone RP23-24E11 on chro... 44 0.90
498gb|AC165336.4| Mus musculus BAC clone RP24-470O8 from chromosome... 44 0.90
499gb|AC164160.5| Mus musculus BAC clone RP23-343P15 from chromosom... 44 0.90
500emb|AL645668.15| Mouse DNA sequence from clone RP23-32L21 on chr... 44 0.90

>gb|DQ245885.1| Zea mays clone 21709 mRNA sequence
          Length = 756
 Score =  172 bits (87), Expect = 1e-39
 Identities = 219/263 (83%)
 Strand = Plus / Plus

                                                                       
Query: 508 aatcatggttattggcttgatatgtgcatgccttagcgtgttcatgtatgggtccccact 567
           ||||||||| || ||  |||||||||| ||||| |  ||| ||||||| ||||| || ||
Sbjct: 127 aatcatggtgataggaatgatatgtgcctgcctcaatgtgctcatgtacgggtcacccct 186

                                                                       
Query: 568 cgctgccgtgagaacggtgatcacttcaaagagcgtggagtacatgcccttcttcctctc 627
            |||||| ||| ||||||||||||  ||||||||||||||| |||||| |||||||| ||
Sbjct: 187 tgctgccatgaaaacggtgatcacgacaaagagcgtggagttcatgccattcttcctgtc 246

                                                                       
Query: 628 cttcttcctcttcctcaacggaggagtctgggccacgtatgcaatactcgacggagacgt 687
           |||||||||||||||||||||||| |||||||| ||||| ||  | || ||| | ||| |
Sbjct: 247 cttcttcctcttcctcaacggaggcgtctgggcaacgtacgcggtgcttgaccgcgacat 306

                                                                       
Query: 688 cttcctcggggtcccaaatgggataggctgcttcttgggcgccatccagctggttatcta 747
           |||||||||| |||| ||||||||||||| | |  | ||| ||||||||||| |  ||||
Sbjct: 307 cttcctcgggatccccaatgggataggcttcgtgcttggcaccatccagctgatcgtcta 366

                                  
Query: 748 tgcggtgtacatgaacagcaagg 770
            ||| | ||||||||||||||||
Sbjct: 367 cgcgatctacatgaacagcaagg 389



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  123 bits (62), Expect = 1e-24
 Identities = 113/130 (86%)
 Strand = Plus / Plus

                                                                            
Query: 253      gccatacgtgctcacgctgctcaacacgctgctatggctctactacggcctcaccaagcc 312
                |||||||||| ||||||| |||||| |||| || ||||||||||| ||| |||  |||| 
Sbjct: 11828845 gccatacgtgttcacgctactcaacgcgctcctctggctctactatggcgtcagtaagca 11828904

                                                                            
Query: 313      cgacggcctgctcatcgccaccgtcaacggcttcggtgccgtcatggagaccatctacat 372
                | ||||||| |||||||||||| |||||||||||||  ||||||||||| |||||||| |
Sbjct: 11828905 caacggccttctcatcgccaccatcaacggcttcgggaccgtcatggaggccatctacgt 11828964

                          
Query: 373      cgtgctcttc 382
                ||||||||||
Sbjct: 11828965 cgtgctcttc 11828974



 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                         
Query: 596      aagagcgtggagtacatgcccttct 620
                |||||||||||||||||||||||||
Sbjct: 19957415 aagagcgtggagtacatgcccttct 19957439



 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 596      aagagcgtggagtacatgcccttcttcct 624
                |||||||||||||||||||| ||||||||
Sbjct: 23876055 aagagcgtggagtacatgccgttcttcct 23876083



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 632      ttcctcttcctcaacggaggagtctgg 658
                |||||||||||||||||||| ||||||
Sbjct: 11832799 ttcctcttcctcaacggaggcgtctgg 11832825



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 611     atgcccttcttcctctccttcttcctcttc 640
               |||| ||||||||||||| |||||||||||
Sbjct: 8133572 atgctcttcttcctctccctcttcctcttc 8133543



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 596      aagagcgtggagtacatgcccttcttcct 624
                |||||||| ||||||||||| ||||||||
Sbjct: 23862868 aagagcgtagagtacatgccgttcttcct 23862896



to top

>dbj|AP003535.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1012D10
          Length = 168267

 Score =  123 bits (62), Expect = 1e-24
 Identities = 113/130 (86%)
 Strand = Plus / Plus

                                                                         
Query: 253   gccatacgtgctcacgctgctcaacacgctgctatggctctactacggcctcaccaagcc 312
             |||||||||| ||||||| |||||| |||| || ||||||||||| ||| |||  |||| 
Sbjct: 41130 gccatacgtgttcacgctactcaacgcgctcctctggctctactatggcgtcagtaagca 41189

                                                                         
Query: 313   cgacggcctgctcatcgccaccgtcaacggcttcggtgccgtcatggagaccatctacat 372
             | ||||||| |||||||||||| |||||||||||||  ||||||||||| |||||||| |
Sbjct: 41190 caacggccttctcatcgccaccatcaacggcttcgggaccgtcatggaggccatctacgt 41249

                       
Query: 373   cgtgctcttc 382
             ||||||||||
Sbjct: 41250 cgtgctcttc 41259



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 632   ttcctcttcctcaacggaggagtctgg 658
             |||||||||||||||||||| ||||||
Sbjct: 45084 ttcctcttcctcaacggaggcgtctgg 45110



to top

>ref|NM_001056606.1| Oryza sativa (japonica cultivar-group) Os03g0341300 (Os03g0341300)
           mRNA, complete cds
          Length = 1077

 Score = 97.6 bits (49), Expect = 7e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                       
Query: 598 gagcgtggagtacatgcccttcttcctctccttcttcctcttcctcaacggaggagtctg 657
           ||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||
Sbjct: 555 gagcgtggagtacatgcccttctccctctccttcttcctcttcctcaacggcggcgtctg 614

            
Query: 658 g 658
           |
Sbjct: 615 g 615



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                       
Query: 295 ctacggcctcaccaagcccgacggcctgctcatcgccaccgtcaacggcttcggtgccgt 354
           ||||||||||  |||||||| ||| || ||||||| |||||||||||||| ||| |||| 
Sbjct: 226 ctacggcctccacaagcccggcggtctcctcatcgtcaccgtcaacggctccggcgccgc 285

                                                   
Query: 355 catggagaccatctacatcgtgctcttcctcgtctacgcc 394
           | | ||| |||||||| ||  ||||| ||||| |||||||
Sbjct: 286 cctcgaggccatctacgtcacgctctacctcgcctacgcc 325



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 97.6 bits (49), Expect = 7e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                            
Query: 598      gagcgtggagtacatgcccttcttcctctccttcttcctcttcctcaacggaggagtctg 657
                ||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||
Sbjct: 12701917 gagcgtggagtacatgcccttctccctctccttcttcctcttcctcaacggcggcgtctg 12701976

                 
Query: 658      g 658
                |
Sbjct: 12701977 g 12701977



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                            
Query: 295      ctacggcctcaccaagcccgacggcctgctcatcgccaccgtcaacggcttcggtgccgt 354
                ||||||||||  |||||||| ||| || ||||||| |||||||||||||| ||| |||| 
Sbjct: 12700888 ctacggcctccacaagcccggcggtctcctcatcgtcaccgtcaacggctccggcgccgc 12700947

                                                        
Query: 355      catggagaccatctacatcgtgctcttcctcgtctacgcc 394
                | | ||| |||||||| ||  ||||| ||||| |||||||
Sbjct: 12700948 cctcgaggccatctacgtcacgctctacctcgcctacgcc 12700987



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                          
Query: 596      aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
                ||||||||||||| |||||||||||  |||||||||||||||
Sbjct: 12978063 aagagcgtggagttcatgcccttctggctctccttcttcctc 12978022



to top

>gb|AC121491.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0050D18, complete sequence
          Length = 126350

 Score = 97.6 bits (49), Expect = 7e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                         
Query: 598   gagcgtggagtacatgcccttcttcctctccttcttcctcttcctcaacggaggagtctg 657
             ||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||
Sbjct: 59607 gagcgtggagtacatgcccttctccctctccttcttcctcttcctcaacggcggcgtctg 59666

              
Query: 658   g 658
             |
Sbjct: 59667 g 59667



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                         
Query: 295   ctacggcctcaccaagcccgacggcctgctcatcgccaccgtcaacggcttcggtgccgt 354
             ||||||||||  |||||||| ||| || ||||||| |||||||||||||| ||| |||| 
Sbjct: 58578 ctacggcctccacaagcccggcggtctcctcatcgtcaccgtcaacggctccggcgccgc 58637

                                                     
Query: 355   catggagaccatctacatcgtgctcttcctcgtctacgcc 394
             | | ||| |||||||| ||  ||||| ||||| |||||||
Sbjct: 58638 cctcgaggccatctacgtcacgctctacctcgcctacgcc 58677



to top

>ref|NM_001056634.1| Oryza sativa (japonica cultivar-group) Os03g0347500 (Os03g0347500)
           mRNA, complete cds
          Length = 1492

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
           ||||||||||||| |||||||||||  |||||||||||||||
Sbjct: 624 aagagcgtggagttcatgcccttctggctctccttcttcctc 665



to top

>gb|AC134231.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0006D11, complete sequence
          Length = 176637

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 596   aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
             ||||||||||||| |||||||||||  |||||||||||||||
Sbjct: 58986 aagagcgtggagttcatgcccttctggctctccttcttcctc 58945



to top

>dbj|AK109114.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-C05, full
           insert sequence
          Length = 1492

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
           ||||||||||||| |||||||||||  |||||||||||||||
Sbjct: 624 aagagcgtggagttcatgcccttctggctctccttcttcctc 665



to top

>gb|BT018599.1| Zea mays clone EL01N0449A02.d mRNA sequence
          Length = 1762

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcct 636
           ||||||||||||| |||||||||||  ||||||||||||||
Sbjct: 727 aagagcgtggagttcatgcccttctcgctctccttcttcct 767



to top

>gb|AC116730.7| Mus musculus chromosome 1, clone RP23-346J11, complete sequence
          Length = 208503

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                           
Query: 615    ccttcttcctctccttcttcctcttcctc 643
              |||||||||||||||||||||||||||||
Sbjct: 197222 ccttcttcctctccttcttcctcttcctc 197250



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 616    cttcttcctctccttcttcctct 638
              |||||||||||||||||||||||
Sbjct: 197211 cttcttcctctccttcttcctct 197233



to top

>gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, complete sequence
          Length = 250957

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||||||||||||||||||||||||
Sbjct: 20695 ccttcttcctctccttcttcctcttcctc 20723



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 616   cttcttcctctccttcttcctct 638
             |||||||||||||||||||||||
Sbjct: 20684 cttcttcctctccttcttcctct 20706



to top

>dbj|AK242853.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J090073D19,
           full insert sequence
          Length = 1656

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 598 gagcgtggagtacatgcccttcttcctctcc 628
           ||||||||||||||||||||||| |||||||
Sbjct: 678 gagcgtggagtacatgcccttctccctctcc 708



to top

>ref|NM_001073287.1| Oryza sativa (japonica cultivar-group) Os12g0476200 (Os12g0476200)
           mRNA, complete cds
          Length = 891

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 598 gagcgtggagtacatgcccttcttcctctcc 628
           ||||||||||||||||||||||| |||||||
Sbjct: 483 gagcgtggagtacatgcccttctccctctcc 513



to top

>gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence
          Length = 1159

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 598 gagcgtggagtacatgcccttcttcctctccttct 632
           ||||||||||| ||||||||||| |||||||||||
Sbjct: 359 gagcgtggagttcatgcccttctccctctccttct 393



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                               
Query: 598      gagcgtggagtacatgcccttcttcctctcc 628
                ||||||||||||||||||||||| |||||||
Sbjct: 17344102 gagcgtggagtacatgcccttctccctctcc 17344072



to top

>gb|AC115062.13| Mus musculus chromosome 3, clone RP24-399B3, complete sequence
          Length = 198727

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 615   ccttcttcctctccttcttcctcttcc 641
             |||||||||||||||||||||||||||
Sbjct: 73322 ccttcttcctctccttcttcctcttcc 73296



to top

>emb|AL713927.3|CNS07YP4 Oryza sativa chromosome 12, . BAC OSJNBa0021B03 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 154826

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 598   gagcgtggagtacatgcccttcttcctctcc 628
             ||||||||||||||||||||||| |||||||
Sbjct: 59267 gagcgtggagtacatgcccttctccctctcc 59297



to top

>ref|NM_001063010.1| Oryza sativa (japonica cultivar-group) Os05g0588500 (Os05g0588500)
           mRNA, complete cds
          Length = 1362

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 594 caaagagcgtggagtacatgcccttc 619
           ||||||||||||||||||||||||||
Sbjct: 814 caaagagcgtggagtacatgcccttc 839



to top

>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence
          Length = 141824

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 614   cccttcttcctctccttcttcctcttcctc 643
             ||||||||||||| ||||||||||||||||
Sbjct: 27257 cccttcttcctcttcttcttcctcttcctc 27228



to top

>gb|AC102176.8| Mus musculus chromosome 15, clone RP23-480E14, complete sequence
          Length = 181577

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 618    tcttcctctccttcttcctcttcctc 643
              ||||||||||||||||||||||||||
Sbjct: 127920 tcttcctctccttcttcctcttcctc 127945



to top

>gb|AC098598.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1007_H05,
              complete sequence
          Length = 108479

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 594    caaagagcgtggagtacatgcccttc 619
              ||||||||||||||||||||||||||
Sbjct: 103490 caaagagcgtggagtacatgcccttc 103465



to top

>gb|AC105260.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_D04,
             complete sequence
          Length = 100800

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 594   caaagagcgtggagtacatgcccttc 619
             ||||||||||||||||||||||||||
Sbjct: 19659 caaagagcgtggagtacatgcccttc 19634



to top

>gb|AC159807.2| Mus musculus BAC clone RP24-399D3 from chromosome 12, complete
            sequence
          Length = 131785

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 618  tcttcctctccttcttcctcttcctc 643
            ||||||||||||||||||||||||||
Sbjct: 7712 tcttcctctccttcttcctcttcctc 7687



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                          
Query: 594      caaagagcgtggagtacatgcccttc 619
                ||||||||||||||||||||||||||
Sbjct: 29093435 caaagagcgtggagtacatgcccttc 29093410



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 616      cttcttcctctccttcttcctcttcctc 643
                ||||||||||| ||||||||||||||||
Sbjct: 19075660 cttcttcctcttcttcttcctcttcctc 19075687



to top

>dbj|AK069614.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023023E05, full
           insert sequence
          Length = 1363

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 594 caaagagcgtggagtacatgcccttc 619
           ||||||||||||||||||||||||||
Sbjct: 815 caaagagcgtggagtacatgcccttc 840



to top

>gb|AY855168.1| Rattus norvegicus RPGR mRNA, partial cds
          Length = 1719

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 614 cccttcttcctctccttcttcctcttcctc 643
           |||||||||||||||||| |||||||||||
Sbjct: 888 cccttcttcctctccttcctcctcttcctc 859



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 614 cccttcttcctctccttcttcctcttcctc 643
           ||||||||||||||||||  ||||||||||
Sbjct: 711 cccttcttcctctccttccccctcttcctc 682



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 614 cccttcttcctctccttcttcctcttcctc 643
           ||||||||||||||| || |||||||||||
Sbjct: 816 cccttcttcctctccctcctcctcttcctc 787



to top

>gb|AC127270.4| Mus musculus BAC clone RP23-453E16 from 12, complete sequence
          Length = 181004

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||||||||||||||||||||
Sbjct: 31754 tcttcctctccttcttcctcttcctc 31779



to top

>ref|NM_001050058.1| Oryza sativa (japonica cultivar-group) Os01g0606000 (Os01g0606000)
           mRNA, complete cds
          Length = 810

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 596 aagagcgtggagtacatgcccttcttcct 624
           |||||||||||||||||||| ||||||||
Sbjct: 508 aagagcgtggagtacatgccgttcttcct 536



to top

>ref|NM_001049805.1| Oryza sativa (japonica cultivar-group) Os01g0541800 (Os01g0541800)
           mRNA, complete cds
          Length = 1212

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 596 aagagcgtggagtacatgcccttct 620
           |||||||||||||||||||||||||
Sbjct: 670 aagagcgtggagtacatgcccttct 694



to top

>gb|AC114150.5| Rattus norvegicus  BAC CH230-145N21 () complete sequence
          Length = 197180

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 615    ccttcttcctctccttcttcctcttcctc 643
              |||||||||||| ||||||||||||||||
Sbjct: 174624 ccttcttcctcttcttcttcctcttcctc 174596



to top

>ref|XR_007627.1| PREDICTED: Rattus norvegicus hypothetical protein LOC681697
           (LOC681697), mRNA
          Length = 734

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 615 ccttcttcctctccttcttcctcttcctc 643
           |||||||||||| ||||||||||||||||
Sbjct: 520 ccttcttcctcttcttcttcctcttcctc 492



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 618 tcttcctctccttcttcctcttcctc 643
           ||||||||| ||||||||||||||||
Sbjct: 499 tcttcctcttcttcttcctcttcctc 474



to top

>gb|AC168212.7| Mus musculus chromosome 18, clone RP23-290N19, complete sequence
          Length = 197719

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 615    ccttcttcctctccttcttcctcttcctc 643
              ||||||||||||||||| |||||||||||
Sbjct: 188058 ccttcttcctctccttcctcctcttcctc 188030



to top

>gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosome 6, complete sequence
          Length = 218586

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              |||||||||||||||||||||||||
Sbjct: 217132 cttcttcctctccttcttcctcttc 217108



to top

>gb|AC167405.5| Mus musculus chromosome 18, clone wi1-977A17, complete sequence
          Length = 41204

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             ||||||||||||||||| |||||||||||
Sbjct: 14842 ccttcttcctctccttcctcctcttcctc 14870



to top

>gb|AC102567.8| Mus musculus chromosome 9, clone RP23-224F1, complete sequence
          Length = 198097

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 615    ccttcttcctctccttcttcctcttcctc 643
              ||||||||||||||||||||||| |||||
Sbjct: 147294 ccttcttcctctccttcttcctcctcctc 147322



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 615    ccttcttcctctccttcttcctct 638
              ||||||||||||||||||||||||
Sbjct: 147282 ccttcttcctctccttcttcctct 147305



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 616    cttcttcctctccttcttcctct 638
              |||||||||||||||||||||||
Sbjct: 147271 cttcttcctctccttcttcctct 147293



to top

>gb|AC111111.11| Mus musculus chromosome 3, clone RP23-201A9, complete sequence
          Length = 233326

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 615    ccttcttcctctccttcttcctcttcctc 643
              |||||| ||||||||||||||||||||||
Sbjct: 159537 ccttctccctctccttcttcctcttcctc 159509



to top

>gb|AC138270.12| Mus musculus chromosome 7, clone RP23-323F17, complete sequence
          Length = 213855

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             |||||||||||||||||||||||||
Sbjct: 41982 cttcttcctctccttcttcctcttc 42006



to top

>gb|AC020931.6| Homo sapiens chromosome 19 clone CTD-2240E14, complete sequence
          Length = 129048

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||||||| ||||||||||||||||
Sbjct: 34662 ccttcttcctcttcttcttcctcttcctc 34634



to top

>gb|AC006055.1| Homo sapiens 3p22 Contig 7 PAC RPCI4-672N11 (Roswell Park Cancer
             Institute Human PAC Library) complete sequence
          Length = 91885

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||| ||||||||||||||||||||
Sbjct: 34291 ccttcttcttctccttcttcctcttcctc 34263



to top

>ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053507049.179) partial mRNA
          Length = 3402

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 616  cttcttcctctccttcttcctcttc 640
            |||||||||||||||||||||||||
Sbjct: 1144 cttcttcctctccttcttcctcttc 1120



to top

>ref|XM_810894.1| Trypanosoma cruzi strain CL Brener histone deacetylase
            (Tc00.1047053506821.140) partial mRNA
          Length = 1536

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 616  cttcttcctctccttcttcctcttcctca 644
            ||||||||||| |||||||||||||||||
Sbjct: 1450 cttcttcctcttcttcttcctcttcctca 1422



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 616  cttcttcctctccttcttcctcttc 640
            ||||||||||| |||||||||||||
Sbjct: 1462 cttcttcctcttcttcttcctcttc 1438



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 616  cttcttcctctccttcttcctcttc 640
            ||||||||||| |||||||||||||
Sbjct: 1474 cttcttcctcttcttcttcctcttc 1450



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 616  cttcttcctctccttcttcctcttc 640
            ||||||||||| |||||||||||||
Sbjct: 1486 cttcttcctcttcttcttcctcttc 1462



to top

>gb|AC121565.4| Mus musculus BAC clone RP23-223J11 from chromosome 6, complete sequence
          Length = 170000

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              |||||||||||||||||||||||||
Sbjct: 105197 cttcttcctctccttcttcctcttc 105221



to top

>dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0062A24
          Length = 148362

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 596   aagagcgtggagtacatgcccttct 620
             |||||||||||||||||||||||||
Sbjct: 60324 aagagcgtggagtacatgcccttct 60348



to top

>dbj|AP003303.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0704D04
          Length = 147638

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 596   aagagcgtggagtacatgcccttcttcct 624
             |||||||||||||||||||| ||||||||
Sbjct: 22459 aagagcgtggagtacatgccgttcttcct 22487



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 596  aagagcgtggagtacatgcccttcttcct 624
            |||||||| ||||||||||| ||||||||
Sbjct: 9272 aagagcgtagagtacatgccgttcttcct 9300



to top

>dbj|AK104255.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D11, full
           insert sequence
          Length = 1168

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 596 aagagcgtggagtacatgcccttct 620
           |||||||||||||||||||||||||
Sbjct: 666 aagagcgtggagtacatgcccttct 690



to top

>dbj|AK104143.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G10, full
           insert sequence
          Length = 1096

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 596 aagagcgtggagtacatgcccttct 620
           |||||||||||||||||||||||||
Sbjct: 670 aagagcgtggagtacatgcccttct 694



to top

>dbj|AK066226.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013057K13, full
           insert sequence
          Length = 1213

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 596 aagagcgtggagtacatgcccttct 620
           |||||||||||||||||||||||||
Sbjct: 671 aagagcgtggagtacatgcccttct 695



to top

>gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome 8, complete sequence
          Length = 249808

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              |||||||||||||||||||||||||
Sbjct: 232946 cttcttcctctccttcttcctcttc 232922



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 615    ccttcttcctctccttcttcctcttc 640
              |||||||||||| |||||||||||||
Sbjct: 232935 ccttcttcctcttcttcttcctcttc 232910



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 232789 cttcttcctcttcttcttcctcttc 232765



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 232801 cttcttcctcttcttcttcctcttc 232777



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 233117 cttcttcctcttcttcttcctcttc 233093



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 233129 cttcttcctcttcttcttcctcttc 233105



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 233262 cttcttcctcttcttcttcctcttc 233238



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 233274 cttcttcctcttcttcttcctcttc 233250



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 233604 cttcttcctcttcttcttcctcttc 233580



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 233631 cttcttcctcttcttcttcctcttc 233607



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 234535 cttcttcctcttcttcttcctcttc 234511



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 234547 cttcttcctcttcttcttcctcttc 234523



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 234899 cttcttcctcttcttcttcctcttc 234875



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 234911 cttcttcctcttcttcttcctcttc 234887



to top

>gb|AC155813.2| Mus musculus BAC clone RP24-167L2 from 9, complete sequence
          Length = 166097

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             ||||||||||||||||||||||| |||||
Sbjct: 47694 ccttcttcctctccttcttcctcctcctc 47722



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 615   ccttcttcctctccttcttcctct 638
             ||||||||||||||||||||||||
Sbjct: 47682 ccttcttcctctccttcttcctct 47705



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 616   cttcttcctctccttcttcctct 638
             |||||||||||||||||||||||
Sbjct: 47671 cttcttcctctccttcttcctct 47693



to top

>gb|AY105872.1| Zea mays PCO079046 mRNA sequence
          Length = 1346

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 596 aagagcgtggagtacatgcccttcttcctctcc 628
           |||||||| |||||||||||||||| |||||||
Sbjct: 722 aagagcgtagagtacatgcccttctccctctcc 754



to top

>gb|AC139333.4| Mus musculus BAC clone RP24-83F12 from 3, complete sequence
          Length = 162197

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||||||| ||||||||||||||||
Sbjct: 18554 ccttcttcctcttcttcttcctcttcctc 18526



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 18355 cttcttcctcttcttcttcctcttcctc 18328



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||
Sbjct: 18533 tcttcctcttcttcttcctcttcctc 18508



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 18367 cttcttcctcttcttcttcctcttc 18343



to top

>gb|AC166173.3| Mus musculus BAC clone RP23-101K10 from chromosome 3, complete sequence
          Length = 196177

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||||||| ||||||||||||||||
Sbjct: 76098 ccttcttcctcttcttcttcctcttcctc 76126



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 76297 cttcttcctcttcttcttcctcttcctc 76324



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||
Sbjct: 76119 tcttcctcttcttcttcctcttcctc 76144



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 76285 cttcttcctcttcttcttcctcttc 76309



to top

>gb|AC153841.1| Mus musculus 6 BAC RP23-260M5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190541

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 615    ccttcttcctctccttcttcctcttcctc 643
              |||||||||||||||||||||||| ||||
Sbjct: 153673 ccttcttcctctccttcttcctctccctc 153645



to top

>emb|AL732485.8| Mouse DNA sequence from clone RP23-70G24 on chromosome 2, complete
             sequence
          Length = 92562

 Score = 50.1 bits (25), Expect = 0.015
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||||||| ||||||||||||||||
Sbjct: 48409 ccttcttcctcttcttcttcctcttcctc 48381



to top

>emb|AM055942.3| Toxoplasma gondii RH, genomic DNA chromosome Ia
          Length = 1986653

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 615     ccttcttcctctccttcttcctct 638
               ||||||||||||||||||||||||
Sbjct: 1409131 ccttcttcctctccttcttcctct 1409108



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 615     ccttcttcctctccttcttcctcttc 640
               ||||||||||||| ||||||||||||
Sbjct: 1766867 ccttcttcctctctttcttcctcttc 1766842



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 371139 cttcttcctcttcttcttcctcttc 371163



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1388311 cttcttcctcttcttcttcctcttc 1388287



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1388323 cttcttcctcttcttcttcctcttc 1388299



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1388335 cttcttcctcttcttcttcctcttc 1388311



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1503859 cttcttcctcttcttcttcctcttc 1503835



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1503871 cttcttcctcttcttcttcctcttc 1503847



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1503892 cttcttcctcttcttcttcctcttc 1503868



to top

>ref|XM_840607.1| Trypanosoma brucei TREU927 hypothetical protein, conserved
           (Tb927_7.760) mRNA, complete cds
          Length = 1710

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 85  cttcttcctcttcttcttcctcttcctc 58



to top

>emb|CR848757.23| Zebrafish DNA sequence from clone CH211-207L3 in linkage group 15,
             complete sequence
          Length = 205827

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 621   tcctctccttcttcctcttcctca 644
             ||||||||||||||||||||||||
Sbjct: 94209 tcctctccttcttcctcttcctca 94232



to top

>ref|XM_001140477.1| PREDICTED: Pan troglodytes similar to transcript Y 7 (LOC739223),
           mRNA
          Length = 888

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 355 cttcttcctcttcttcttcctcttcctc 328



to top

>ref|XM_001138991.1| PREDICTED: Pan troglodytes similar to transcript Y 7 (LOC738248),
           mRNA
          Length = 894

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 361 cttcttcctcttcttcttcctcttcctc 334



to top

>ref|XM_001137389.1| PREDICTED: Pan troglodytes similar to transcript Y 7 (LOC737176),
           mRNA
          Length = 894

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 361 cttcttcctcttcttcttcctcttcctc 334



to top

>gb|AC185507.9| Mus musculus  BAC RP24-186O7 () complete sequence
          Length = 44344

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 12889 cttcttcctcttcttcttcctcttcctc 12862



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 12748 cttcttcctcttcttcttcctcttc 12724



to top

>ref|XM_001053229.1| PREDICTED: Rattus norvegicus hypothetical protein LOC678744
           (LOC678744), mRNA
          Length = 390

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 291 cttcttcctcttcttcttcctcttcctc 264



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 616 cttcttcctctccttcttcctcttc 640
           ||||||||||| |||||||||||||
Sbjct: 303 cttcttcctcttcttcttcctcttc 279



to top

>ref|XM_001072916.1| PREDICTED: Rattus norvegicus hypothetical protein LOC686214
           (LOC686214), mRNA
          Length = 438

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 208 cttcttcctcttcttcttcctcttcctc 181



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 280 cttcttcctcttcttcttcctcttcctc 253



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 616 cttcttcctctccttcttcctcttc 640
           ||||||||||| |||||||||||||
Sbjct: 301 cttcttcctcttcttcttcctcttc 277



to top

>ref|XM_001057439.1| PREDICTED: Rattus norvegicus hypothetical protein LOC681565
           (LOC681565), mRNA
          Length = 510

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 259 cttcttcctcttcttcttcctcttcctc 232



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 616 cttcttcctctccttcttcctcttc 640
           ||||||||||| |||||||||||||
Sbjct: 142 cttcttcctcttcttcttcctcttc 118



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 616 cttcttcctctccttcttcctcttc 640
           ||||||||||| |||||||||||||
Sbjct: 355 cttcttcctcttcttcttcctcttc 331



to top

>ref|XM_001075539.1| PREDICTED: Rattus norvegicus hypothetical protein LOC690765
           (LOC690765), mRNA
          Length = 675

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 505 cttcttcctcttcttcttcctcttcctc 478



to top

>ref|XM_001080603.1| PREDICTED: Rattus norvegicus hypothetical protein LOC687939
           (LOC687939), mRNA
          Length = 732

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 595 cttcttcctcttcttcttcctcttcctc 568



to top

>ref|XM_001070899.1| PREDICTED: Rattus norvegicus hypothetical protein LOC684541
           (LOC684541), mRNA
          Length = 417

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 97  cttcttcctcttcttcttcctcttcctc 70



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 124 cttcttcctcttcttcttcctcttcctc 97



to top

>ref|XM_001055005.1| PREDICTED: Rattus norvegicus hypothetical protein LOC679935
           (LOC679935), mRNA
          Length = 417

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 97  cttcttcctcttcttcttcctcttcctc 70



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 124 cttcttcctcttcttcttcctcttcctc 97



to top

>ref|XM_001070896.1| PREDICTED: Rattus norvegicus hypothetical protein LOC689461
           (LOC689461), mRNA
          Length = 492

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 193 cttcttcctcttcttcttcctcttcctc 166



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 283 cttcttcctcttcttcttcctcttcctc 256



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 618 tcttcctctccttcttcctcttcctc 643
           ||||||||| ||||||||||||||||
Sbjct: 236 tcttcctcttcttcttcctcttcctc 211



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 615 ccttcttcctctccttcttcctcttcctc 643
           |||||||||||| | ||||||||||||||
Sbjct: 122 ccttcttcctcttcctcttcctcttcctc 94



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 615 ccttcttcctctccttcttcctcttcctc 643
           |||||| | ||||||||||||||||||||
Sbjct: 134 ccttctccttctccttcttcctcttcctc 106



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 616 cttcttcctctccttcttcctcttc 640
           ||||||||||| |||||||||||||
Sbjct: 322 cttcttcctcttcttcttcctcttc 298



to top

>ref|XM_001060498.1| PREDICTED: Rattus norvegicus hypothetical protein LOC681149
           (LOC681149), mRNA
          Length = 222

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 67  cttcttcctcttcttcttcctcttcctc 40



to top

>ref|XR_006617.1| PREDICTED: Rattus norvegicus hypothetical protein LOC689318
           (LOC689318), mRNA
          Length = 290

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 231 cttcttcctcttcttcttcctcttcctc 204



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 618 tcttcctctccttcttcctcttcctc 643
           ||||||||| ||||||||||||||||
Sbjct: 211 tcttcctcttcttcttcctcttcctc 186



to top

>ref|XM_001056093.1| PREDICTED: Rattus norvegicus hypothetical protein LOC679382
           (LOC679382), mRNA
          Length = 591

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 346 cttcttcctcttcttcttcctcttcctc 319



to top

>ref|XM_001068645.1| PREDICTED: Rattus norvegicus hypothetical protein LOC688870
           (LOC688870), mRNA
          Length = 582

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 337 cttcttcctcttcttcttcctcttcctc 310



to top

>ref|XR_006495.1| PREDICTED: Rattus norvegicus hypothetical protein LOC688855
           (LOC688855), mRNA
          Length = 306

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 58  cttcttcctcttcttcttcctcttcctc 31



to top

>ref|XM_001056403.1| PREDICTED: Rattus norvegicus hypothetical protein LOC680269
           (LOC680269), mRNA
          Length = 666

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 556 cttcttcctcttcttcttcctcttcctc 529



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 616 cttcttcctctccttcttcctcttc 640
           ||||||||||| |||||||||||||
Sbjct: 373 cttcttcctcttcttcttcctcttc 349



to top

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 616     cttcttcctctccttcttcctcttcctc 643
               ||||||||||| ||||||||||||||||
Sbjct: 1348392 cttcttcctcttcttcttcctcttcctc 1348419



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||| |||||||||||||||||||
Sbjct: 1348293 cttctgcctctccttcttcctcttc 1348317



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1348314 cttcttcctcttcttcttcctcttc 1348338



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 616     cttcttcctctccttcttcctcttc 640
               ||||||||||| |||||||||||||
Sbjct: 1549523 cttcttcctcttcttcttcctcttc 1549547



to top

>gb|AC123298.4| Rattus norvegicus  BAC CH230-352N4 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 175621

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 60825 cttcttcctcttcttcttcctcttcctc 60852



to top

>gb|AC137843.15| Mus musculus chromosome 9, clone RP23-413J12, complete sequence
          Length = 197907

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 47517 cttcttcctcttcttcttcctcttcctc 47544



to top

>gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, complete sequence
          Length = 218156

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 615    ccttcttcctctccttcttcctct 638
              ||||||||||||||||||||||||
Sbjct: 114597 ccttcttcctctccttcttcctct 114574



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 615    ccttcttcctctccttcttcctct 638
              ||||||||||||||||||||||||
Sbjct: 114609 ccttcttcctctccttcttcctct 114586



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 615    ccttcttcctctccttcttcctct 638
              ||||||||||||||||||||||||
Sbjct: 114621 ccttcttcctctccttcttcctct 114598



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 616    cttcttcctctccttcttcctct 638
              |||||||||||||||||||||||
Sbjct: 114632 cttcttcctctccttcttcctct 114610



to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 164403 cttcttcctcttcttcttcctcttcctc 164430



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 164379 cttcttcctcttcttcttcctcttc 164403



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 164391 cttcttcctcttcttcttcctcttc 164415



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 164553 cttcttcctcttcttcttcctcttc 164577



to top

>gb|AC159437.1| Trypanosoma brucei chromosome 7 clone RPCI93-29K4, complete sequence
          Length = 159858

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 99548 cttcttcctcttcttcttcctcttcctc 99521



to top

>gb|AC113469.9| Mus musculus chromosome 8, clone RP23-261B5, complete sequence
          Length = 198937

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 83050 cttcttcctcttcttcttcctcttcctc 83023



to top

>gb|AC132483.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0014C03, complete sequence
          Length = 143739

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 88303 cttcttcctcttcttcttcctcttcctc 88330



to top

>gb|AC129775.4| Mus musculus BAC clone RP23-174N20 from chromosome 3, complete sequence
          Length = 225505

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 92556 cttcttcctcttcttcttcctcttcctc 92583



to top

>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence
          Length = 110310

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 40238 cttcttcctcttcttcttcctcttcctc 40211



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 40100 cttcttcctcttcttcttcctcttc 40076



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 40199 cttcttcctcttcttcttcctcttc 40175



to top

>gb|AC147661.2| Pan troglodytes BAC clone CH251-336D20 from Y, complete sequence
          Length = 160602

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 34125 cttcttcctcttcttcttcctcttcctc 34152



to top

>gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, complete sequence
          Length = 241654

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 218908 cttcttcctcttcttcttcctcttcctc 218935



to top

>gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, complete sequence
          Length = 196240

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 73935 cttcttcctcttcttcttcctcttcctc 73908



to top

>gb|AC130529.2| Mus musculus BAC clone RP23-124O11 from chromosome 16, complete
             sequence
          Length = 231967

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 20672 cttcttcctcttcttcttcctcttcctc 20699



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 619    cttcctctccttcttcctcttcctc 643
              |||||| ||||||||||||||||||
Sbjct: 207288 cttcctttccttcttcctcttcctc 207312



to top

>gb|AC144651.2| Mus musculus BAC clone RP24-251O18 from chromosome Y, complete sequence
          Length = 144831

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 116532 cttcttcctcttcttcttcctcttcctc 116505



to top

>gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosome 16, complete sequence
          Length = 206486

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||| ||||||||||||||||||||
Sbjct: 143336 cttcttcttctccttcttcctcttcctc 143309



to top

>gb|AC144932.6| Mus musculus BAC clone RP24-462H2 from chromosome 6, complete sequence
          Length = 140840

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 24205 cttcttcttctccttcttcctcttcctc 24178



to top

>gb|AC102388.7| Mus musculus chromosome 3, clone RP24-298F19, complete sequence
          Length = 166620

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 13423 cttcttcctcttcttcttcctcttcctc 13450



to top

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||||
Sbjct: 80789 cttcttcctttccttcttcctcttcctc 80816



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||
Sbjct: 59822 tcttcctcttcttcttcctcttcctc 59847



to top

>gb|AC137742.3| Mus musculus BAC clone RP24-345F6 from chromosome 16, complete sequence
          Length = 170248

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 100618 cttcttcctcttcttcttcctcttcctc 100645



to top

>gb|AC115948.12| Mus musculus chromosome 16, clone RP24-568J12, complete sequence
          Length = 212604

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 10846 cttcttcttctccttcttcctcttcctc 10819



to top

>gb|AY288070.1| Ictalurus punctatus calnexin mRNA, complete cds
          Length = 2197

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 1663 cttcttcctcttcttcttcctcttcctc 1636



to top

>gb|AC113198.15| Mus musculus chromosome 14, clone RP23-248E15, complete sequence
          Length = 236220

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 110623 cttcttcctcttcttcttcctcttcctc 110650



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||| ||||||||||||||||||||
Sbjct: 110760 cttcttcttctccttcttcctcttcctc 110787



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 110611 cttcttcctcttcttcttcctcttc 110635



to top

>gb|AC145474.2| Rattus norvegicus chromosome 1 clone RP32-113N8 map q32, complete
              sequence
          Length = 137003

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 103098 cttcttcctcttcttcttcctcttcctc 103071



to top

>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence
          Length = 236274

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 127051 cttcttcctcttcttcttcctcttcctc 127078



to top

>gb|AC107454.12| Mus musculus chromosome 3, clone RP23-339P23, complete sequence
          Length = 199324

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 52849 cttcttcctcttcttcttcctcttcctc 52822



to top

>gb|AC132116.3| Mus musculus BAC clone RP24-158K7 from chromosome 2, complete sequence
          Length = 165307

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 144467 cttcttcctcttcttcttcctcttcctc 144494



to top

>gb|AC121971.3| Mus musculus BAC clone RP24-275H22 from chromosome 7, complete sequence
          Length = 195611

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 93015 cttcttcctcttcttcttcctcttcctc 92988



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 92907 cttcttcctcttcttcttcctcttc 92883



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 93136 cttcttcctcttcttcttcctcttc 93112



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 93166 cttcttcctcttcttcttcctcttc 93142



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 93208 cttcttcctcttcttcttcctcttc 93184



to top

>gb|AC126032.4| Mus musculus BAC clone RP24-94B12 from chromosome 1, complete sequence
          Length = 207475

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 141871 cttcttcctcttcttcttcctcttcctc 141898



to top

>gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosome 14, complete
             sequence
          Length = 178501

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 98132 cttcttcctcttcttcttcctcttcctc 98159



to top

>gb|AC121793.3| Mus musculus BAC clone RP23-407B23 from chromosome 9, complete
            sequence
          Length = 194815

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 5395 cttcttcctcttcttcttcctcttcctc 5422



to top

>gb|U95743.1|HUU95743 Homo sapiens chromosome 16 BAC clone CIT987-SK65D3, complete sequence
          Length = 192730

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||||| ||||||||||||||
Sbjct: 89616 cttcttcctctccctcttcctcttcctc 89589



to top

>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence
          Length = 189936

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 9472 cttcttcctcttcttcttcctcttcctc 9445



to top

>gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, complete sequence
          Length = 211521

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 951 cttcttcctctacttcttcctcttcctc 978



to top

>gb|AC163105.5| Mus musculus BAC clone RP23-259A11 from chromosome 14, complete sequence
          Length = 227806

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 210786 cttcttcctcttcttcttcctcttcctc 210759



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 210681 cttcttcctcttcttcttcctcttc 210657



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 210693 cttcttcctcttcttcttcctcttc 210669



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 210705 cttcttcctcttcttcttcctcttc 210681



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 210717 cttcttcctcttcttcttcctcttc 210693



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 210744 cttcttcctcttcttcttcctcttc 210720



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 210756 cttcttcctcttcttcttcctcttc 210732



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 210798 cttcttcctcttcttcttcctcttc 210774



to top

>gb|AC142310.1| Pan troglodytes BAC clone RP43-45P13 from 7, complete sequence
          Length = 197471

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 169780 cttcttcctcttcttcttcctcttcctc 169807



to top

>gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chromosome y, complete
              sequence
          Length = 196802

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 105084 cttcttcctcttcttcttcctcttcctc 105057



to top

>gb|AC123687.20| Mus musculus chromosome 5, clone RP23-314A12, complete sequence
          Length = 189230

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 37082 cttcttcctcttcttcttcctcttcctc 37055



to top

>gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, complete sequence
          Length = 191133

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 172310 cttcttcctcttcttcttcctcttcctc 172337



to top

>gb|AC093479.13| Mus musculus chromosome 16, clone RP23-61K2, complete sequence
          Length = 243771

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 97997 cttcttcctcttcttcttcctcttcctc 97970



to top

>ref|XM_819408.1| Trypanosoma brucei TREU927 clone RPCI93-29K4 hypothetical protein
           (Tb927.7.760) partial mRNA
          Length = 1710

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 85  cttcttcctcttcttcttcctcttcctc 58



to top

>gb|AC134407.6| Homo sapiens chromosome 17, clone RP11-855A2, complete sequence
          Length = 199875

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 144723 cttcttcctcttcttcttcctcttcctc 144696



to top

>ref|XM_661458.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.70508)
           partial mRNA
          Length = 1068

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 615 ccttcttcctctccttcttcctcttcctcaac 646
           ||||||||||||||||||||  ||||||||||
Sbjct: 776 ccttcttcctctccttcttcgccttcctcaac 745



to top

>gb|AC133618.3| Rattus norvegicus 18 BAC CH230-71N8 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 234684

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 103336 cttcttcctcttcttcttcctcttcctc 103309



to top

>gb|AC158238.2| Mus musculus BAC clone RP23-106F10 from chromosome 9, complete sequence
          Length = 242356

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||||| ||||||||||||||
Sbjct: 200686 cttcttcctctccctcttcctcttcctc 200659



to top

>gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosome 9, complete sequence
          Length = 215002

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 175894 cttcttcctcttcttcttcctcttcctc 175867



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 175744 cttcttcctcttcttcttcctcttc 175720



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 175906 cttcttcctcttcttcttcctcttc 175882



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 175918 cttcttcctcttcttcttcctcttc 175894



to top

>ref|XM_628608.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd7_4610),
           partial mRNA
          Length = 1068

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 615 ccttcttcctctccttcttcctcttcctcaac 646
           ||||||||||||||||||||  ||||||||||
Sbjct: 776 ccttcttcctctccttcttcaccttcctcaac 745



to top

>gb|AC159188.2| Mus musculus BAC clone RP24-247J24 from chromosome 13, complete
             sequence
          Length = 197018

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 78327 cttcttcctcttcttcttcctcttcctc 78300



to top

>gb|AC023102.6| Homo sapiens chromosome 8, clone RP11-414L17, complete sequence
          Length = 175263

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 615  ccttcttcctctccttcttcctct 638
            ||||||||||||||||||||||||
Sbjct: 7438 ccttcttcctctccttcttcctct 7461



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 618  tcttcctctccttcttcctct 638
            |||||||||||||||||||||
Sbjct: 7429 tcttcctctccttcttcctct 7449



to top

>gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, complete sequence
          Length = 142645

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 118749 cttcttcctcttcttcttcctcttcctc 118722



to top

>ref|NM_001034484.1| Bos taurus eukaryotic translation initiation factor 3, subunit 7
            zeta, 66/67kDa (EIF3S7), mRNA
 gb|BC102156.1| Bos taurus eukaryotic translation initiation factor 3, subunit 7
            zeta, 66/67kDa, mRNA (cDNA clone MGC:127237
            IMAGE:7946041), complete cds
          Length = 1904

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 1740 cttcttcctcttcttcttcctcttcctc 1713



to top

>ref|XM_814675.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053508641.90) partial mRNA
          Length = 3627

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 77   cacctcttcttcctcctcgtcccttcca 104
            ||||||||||||||||||||| ||||||
Sbjct: 2970 cacctcttcttcctcctcgtcgcttcca 2943



to top

>emb|CR388124.15| Zebrafish DNA sequence from clone CH211-72C8 in linkage group 15,
             complete sequence
          Length = 173535

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 621   tcctctccttcttcctcttcctca 644
             ||||||||||||||||||||||||
Sbjct: 60016 tcctctccttcttcctcttcctca 60039



to top

>gb|AC147674.5| Pan troglodytes BAC clone CH251-28I8 from chromosome y, complete
             sequence
          Length = 193266

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 90140 cttcttcctcttcttcttcctcttcctc 90167



to top

>gb|AC090985.6| Homo sapiens chromosome 15, clone RP11-763K15, complete sequence
          Length = 186078

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 124159 cttcttcctcttcttcttcctcttcctc 124186



to top

>emb|AL611922.7| Human DNA sequence from clone RP11-633N4 on chromosome 9, complete
              sequence
          Length = 176612

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 620    ttcctctccttcttcctcttcctc 643
              ||||||||||||||||||||||||
Sbjct: 167479 ttcctctccttcttcctcttcctc 167502



to top

>emb|AL391832.10| Human DNA sequence from clone RP11-443B7 on chromosome 1 Contains two
             novel genes (LOC284527), complete sequence
          Length = 144648

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 21363 cttcttcctcttcttcttcctcttcctc 21336



to top

>emb|AL445604.9| Human DNA sequence from clone RP11-661D17 on chromosome 13 Contains a CpG
              island, complete sequence
          Length = 174615

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 123899 cttcttcctcttcttcttcctcttcctc 123872



to top

>gb|AC024996.6| Homo sapiens chromosome 8, clone RP11-697C18, complete sequence
          Length = 177864

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 122306 cttcttcctcttcttcttcctcttcctc 122333



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 618    tcttcctctccttcttcctcttcctc 643
              ||||||||| ||||||||||||||||
Sbjct: 122326 tcttcctcttcttcttcctcttcctc 122351



to top

>emb|AL354692.23| Human DNA sequence from clone RP11-361M4 on chromosome 9 Contains a
             novel pseudogene, complete sequence
          Length = 110443

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 73638 cttcttcctcttcttcttcctcttcctc 73665



to top

>emb|AL161791.15| Human DNA sequence from clone RP11-82L2 on chromosome 9 Contains the 5'
             end of the SMC2L1 gene for SMC2 structural maintenance of
             chromosomes 2-like 1 (yeast) (CAPE, CAP-E, hCAP-E) and a
             CpG island, complete sequence
          Length = 108821

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 33076 cttcttcttctccttcttcctcttcctc 33049



to top

>emb|AL139081.21| Human DNA sequence from clone RP11-179A7 on chromosome 13 Contains
             parts of 2 novel genes and the RFC3 gene for replication
             factor C (activator 1) 3, 38kDa, complete sequence
          Length = 185602

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 617   ttcttcctctccttcttcctcttc 640
             ||||||||||||||||||||||||
Sbjct: 61350 ttcttcctctccttcttcctcttc 61373



to top

>emb|AL136968.14| Human DNA sequence from clone RP1-182O16 on chromosome 6 Contains the
             5' end of a novel protein, a ribosomal protein L34
             pseudogene, a glyceraldehyde 3-phosphate dehydrogenase
             (GAPDH) pseudogene and a CpG island, complete sequence
          Length = 70541

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 47593 cttcttcctcttcttcttcctcttcctc 47566



to top

>gb|S47695.1| YBL03-16=basic motif/leucine zipper domain protein homolog,
           YBL03-23=multidrug resistance PDR1 protein homolog
           [Saccharomyces cerevisiae, S288C, Genomic, 10 genes,
           12684 nt]
          Length = 12684

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 412 cttcttcctcttcttcttcctcttcctc 385



to top

>gb|AC134845.5| Mus musculus BAC clone RP24-424K5 from chromosome 1, complete sequence
          Length = 194449

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 81072 cttcttcctcttcttcttcctcttcctc 81099



to top

>emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on chromosome 11 Contains the
             5' end of the Lpo gene for lactoperoxidase, a novel gene,
             the Epx gene for eosinophil peroxidase, the Olfr462,
             Olfr463 and Olfr464 genes for olfactory receptors 462, 463
             and 464, a novel gene, a cytochrome c oxidase subunit VIc
             (Cox6c) pseudogene, a ubiquitin-conjugating enzyme E2B (S.
             cerevisiae RAD6 homology) (Ube2b) pseudogene and the 3'
             end of the gene for dynein light chain 2 (6720463E02Rik),
             complete sequence
          Length = 184069

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 87461 cttcttcctcttcttcttcctcttcctc 87488



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||
Sbjct: 87499 tcttcctcttcttcttcctcttcctc 87524



to top

>gb|AC064829.6|AC064829 Homo sapiens BAC clone RP11-375P13 from Y, complete sequence
          Length = 89684

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 16955 cttcttcctcttcttcttcctcttcctc 16982



to top

>emb|AL672181.11| Mouse DNA sequence from clone RP23-223D16 on chromosome 11, complete
            sequence
          Length = 181460

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 3782 cttcttcctcttcttcttcctcttcctc 3809



to top

>emb|CR933607.1| Homo sapiens mRNA; cDNA DKFZp686M17113 (from clone DKFZp686M17113)
          Length = 6217

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 726 cttcttcctcttcttcttcctcttcctc 699



to top

>ref|NM_001017764.1| Danio rerio zgc:112083 (zgc:112083), mRNA
 gb|BC093191.1| Danio rerio zgc:112083, mRNA (cDNA clone MGC:112083 IMAGE:7416515),
            complete cds
          Length = 2245

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 621  tcctctccttcttcctcttcctca 644
            ||||||||||||||||||||||||
Sbjct: 1572 tcctctccttcttcctcttcctca 1595



to top

>gb|AC155831.7| Mus musculus 10 BAC RP24-189B10 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 197153

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||||||||||||||| ||||
Sbjct: 142644 cttcttcctctccttcttcctctccctc 142617



to top

>gb|AC068389.10| Homo sapiens chromosome 8, clone RP11-91I20, complete sequence
          Length = 171515

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 615   ccttcttcctctccttcttcctct 638
             ||||||||||||||||||||||||
Sbjct: 66550 ccttcttcctctccttcttcctct 66527



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 615   ccttcttcctctccttcttcctct 638
             ||||||||||||||||||||||||
Sbjct: 66562 ccttcttcctctccttcttcctct 66539



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 618   tcttcctctccttcttcctct 638
             |||||||||||||||||||||
Sbjct: 66571 tcttcctctccttcttcctct 66551



to top

>gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chromosome unknown,
             complete sequence
          Length = 184511

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 15446 cttcttcctcttcttcttcctcttcctc 15473



to top

>gb|AC158510.2| Mus musculus BAC clone RP24-236E11 from chromosome 9, complete sequence
          Length = 178963

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||||| ||||||||||||||
Sbjct: 12998 cttcttcctctccctcttcctcttcctc 12971



to top

>gb|AF369029.2| White spot syndrome virus, complete genome
          Length = 292967

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 175338 cttcttcctcttcttcttcctcttcctc 175311



to top

>gb|AC152417.3| Mus musculus BAC clone RP23-56I21 from chromosome 10, complete sequence
          Length = 233783

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||||||||||||||| ||||
Sbjct: 228937 cttcttcctctccttcttcctctccctc 228910



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 228961 cttcttcctcttcttcttcctcttc 228937



to top

>gb|AC132338.4| Mus musculus BAC clone RP24-158J16 from chromosome 5, complete sequence
          Length = 163304

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 92173 cttcttcctcttcttcttcctcttcctc 92146



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||||||| | ||||||||||||||
Sbjct: 92073 ccttcttcctcttcctcttcctcttcctc 92045



to top

>gb|AC127279.3| Mus musculus BAC clone RP24-247K4 from chromosome 10, complete sequence
          Length = 185573

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||||||||||||||| ||||
Sbjct: 154130 cttcttcctctccttcttcctctccctc 154157



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 154106 cttcttcctcttcttcttcctcttc 154130



to top

>gb|AC009058.10| Homo sapiens chromosome 16 clone RP11-292B23, complete sequence
          Length = 164844

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 88361 cttcttcttctccttcttcctcttcctc 88334



to top

>gb|AC106870.4| Homo sapiens BAC clone RP11-223F18 from 2, complete sequence
          Length = 143441

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 34850 cttcttcctcttcttcttcctcttcctc 34823



to top

>ref|NM_176075.2| Rattus norvegicus peroxisome proliferative activated receptor, gamma,
            coactivator 1 beta (Ppargc1b), mRNA
 gb|AY188951.1| Rattus norvegicus peroxisome proliferator-activated receptor gamma
            coactivator 1beta-2a mRNA, complete cds
          Length = 3163

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 1264 cttcttcctcttcttcttcctcttcctc 1237



to top

>dbj|BS000547.1| Pan troglodytes chromosome Y clone:PTB-232N08, complete sequences
          Length = 219991

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 214596 cttcttcctcttcttcttcctcttcctc 214569



to top

>gb|AC116162.5| Homo sapiens chromosome 15, clone RP11-268L17, complete sequence
          Length = 160580

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 14523 cttcttcctcttcttcttcctcttcctc 14550



to top

>gb|AC115935.9| Mus musculus chromosome 3, clone RP24-545D23, complete sequence
          Length = 145137

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 47998 cttcttcctcttcttcttcctcttcctc 48025



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||
Sbjct: 48018 tcttcctcttcttcttcctcttcctc 48043



to top

>emb|BX927223.9| Human DNA sequence from clone DAMA-380P17 on chromosome 6, complete
             sequence
          Length = 83649

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||||| ||||||||||||||
Sbjct: 62367 cttcttcctctccctcttcctcttcctc 62394



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||
Sbjct: 62405 tcttcctcttcttcttcctcttcctc 62430



to top

>gb|AC018634.3|AC018634 Human Chromosome 7 clone RP11-243E12, complete sequence
          Length = 174241

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 145304 cttcttcctcttcttcttcctcttcctc 145331



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 146039 cttcttcctcttcttcttcctcttc 146063



to top

>emb|AL772256.15| Mouse DNA sequence from clone RP23-141N19 on chromosome 2, complete
             sequence
          Length = 191321

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 65278 cttcttcctcttcttcttcctcttcctc 65305



to top

>gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, complete sequence
          Length = 216692

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 24305 cttcttcctcttcttcttcctcttcctc 24332



to top

>gb|AC102618.19| Mus musculus chromosome 18, clone RP23-426G16, complete sequence
          Length = 242449

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 129280 cttcttcctcttcttcttcctcttcctc 129253



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 129292 cttcttcctcttcttcttcctcttc 129268



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 129304 cttcttcctcttcttcttcctcttc 129280



to top

>gb|AF440570.1| Shrimp white spot syndrome virus, complete genome
          Length = 307287

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 159980 cttcttcctcttcttcttcctcttcctc 159953



to top

>gb|AC155244.2| Mus musculus BAC clone RP24-318B2 from 13, complete sequence
          Length = 198847

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 24690 cttcttcctcttcttcttcctcttcctc 24717



to top

>dbj|AP005061.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-419P8, complete
             sequence
          Length = 186074

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 13307 cttcttcttctccttcttcctcttcctc 13280



to top

>gb|AC154381.2| Mus musculus BAC clone RP23-42E2 from 16, complete sequence
          Length = 201052

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 24465 cttcttcttctccttcttcctcttcctc 24492



to top

>gb|DQ331969.1| Synthetic construct Saccharomyces cerevisiae clone FLH202494.01X SCT1
            gene, complete sequence
          Length = 2280

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 2236 cttcttcctcttcttcttcctcttcctc 2209



to top

>gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, complete sequence
          Length = 240821

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 127196 cttcttcctctacttcttcctcttcctc 127169



to top

>gb|AF174394.1|AF174394 Homo sapiens apoptotic-related protein PCAR mRNA, partial cds
          Length = 988

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 169 cttcttcctcttcttcttcctcttcctc 142



to top

>emb|AJ314608.1|SCE314608 Saccharomyces cerevisiae GAT2 gene for glycerol-3-phosphate
            acyltransferase
          Length = 2253

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 2209 cttcttcctcttcttcttcctcttcctc 2182



to top

>emb|Z35773.1|SCYBL012C S.cerevisiae chromosome II reading frame ORF YBL012c
          Length = 2874

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 2538 cttcttcctcttcttcttcctcttcctc 2511



to top

>gb|AC156797.2| Mus musculus BAC clone RP24-88A16 from chromosome 14, complete sequence
          Length = 166341

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 135242 cttcttcctcttcttcttcctcttcctc 135269



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 135230 cttcttcctcttcttcttcctcttc 135254



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 135272 cttcttcctcttcttcttcctcttc 135296



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 135284 cttcttcctcttcttcttcctcttc 135308



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 135311 cttcttcctcttcttcttcctcttc 135335



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 135323 cttcttcctcttcttcttcctcttc 135347



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 135335 cttcttcctcttcttcttcctcttc 135359



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 135347 cttcttcctcttcttcttcctcttc 135371



to top

>dbj|AP005136.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-715F3, complete
             sequence
          Length = 174547

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 78475 cttcttcttctccttcttcctcttcctc 78448



to top

>emb|AL929577.9| Mouse DNA sequence from clone RP23-455B1 on chromosome 4, complete
             sequence
          Length = 152910

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 46385 cttcttcctcttcttcttcctcttcctc 46412



to top

>emb|AL732551.8| Mouse DNA sequence from clone RP23-277K1 on chromosome 4, complete
             sequence
          Length = 127241

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 11283 cttcttcctcttcttcttcctcttcctc 11310



to top

>gb|AC140195.3| Mus musculus BAC clone RP24-64A19 from 6, complete sequence
          Length = 156314

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||| ||||||||||||||||||||
Sbjct: 127072 cttcttcttctccttcttcctcttcctc 127045



to top

>gb|AC127569.4| Mus musculus BAC clone RP24-216E20 from 9, complete sequence
          Length = 168588

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 23550 cttcttcctcttcttcttcctcttcctc 23577



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 23526 cttcttcctcttcttcttcctcttc 23550



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 23538 cttcttcctcttcttcttcctcttc 23562



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 23700 cttcttcctcttcttcttcctcttc 23724



to top

>gb|AC140924.4| Mus musculus BAC clone RP24-249B5 from Y, complete sequence
          Length = 200241

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 63513 cttcttcctcttcttcttcctcttcctc 63486



to top

>gb|AC122017.5| Mus musculus BAC clone RP24-361J4 from 7, complete sequence
          Length = 158807

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 77388 cttcttcctcttcttcttcctcttcctc 77415



to top

>emb|CT025665.14| Mouse DNA sequence from clone RP24-340L11 on chromosome 9, complete
             sequence
          Length = 151896

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 10328 cttcttcctcttcttcttcctcttcctc 10301



to top

>gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, complete sequence
          Length = 211064

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||| ||||||||||||||||||
Sbjct: 169454 cttcttcctttccttcttcctcttcctc 169481



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 618    tcttcctctccttcttcctcttcctc 643
              ||||||||| ||||||||||||||||
Sbjct: 148487 tcttcctcttcttcttcctcttcctc 148512



to top

>gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, complete sequence
          Length = 209693

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 615   ccttcttcctctccttcttcctct 638
             ||||||||||||||||||||||||
Sbjct: 69139 ccttcttcctctccttcttcctct 69162



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 615   ccttcttcctctccttcttcctct 638
             ||||||||||||||||||||||||
Sbjct: 69151 ccttcttcctctccttcttcctct 69174



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 615   ccttcttcctctccttcttcctct 638
             ||||||||||||||||||||||||
Sbjct: 69163 ccttcttcctctccttcttcctct 69186



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 616   cttcttcctctccttcttcctct 638
             |||||||||||||||||||||||
Sbjct: 69128 cttcttcctctccttcttcctct 69150



to top

>gb|AC140220.4| Mus musculus BAC clone RP23-279P6 from 5, complete sequence
          Length = 182156

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||||||||||| ||||||||
Sbjct: 92223 cttcttcctctccttcttcttcttcctc 92250



 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||||||||||| ||||||||
Sbjct: 92241 cttcttcctctccttcttcttcttcctc 92268



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||
Sbjct: 175839 cttcttcctcttcttcttcctcttc 175863



to top

>gb|AC145168.5| Mus musculus BAC clone RP23-398K14 from 3, complete sequence
          Length = 217058

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 43585 cttcttcctcttcttcttcctcttcctc 43558



to top

>gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complete sequence
          Length = 174224

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 152705 cttcttcctcttcttcttcctcttcctc 152678



to top

>emb|CT027693.11| Mouse DNA sequence from clone RP24-120H1 on chromosome 16, complete
             sequence
          Length = 186376

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 49624 cttcttcctcttcttcttcctcttcctc 49597



to top

>emb|AL592225.17| Mouse DNA sequence from clone RP23-278M14 on chromosome 1, complete
              sequence
          Length = 183397

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 167843 cttcttcctcttcttcttcctcttcctc 167816



to top

>emb|AL672293.14| Mouse DNA sequence from clone RP23-180D16 on chromosome X, complete
             sequence
          Length = 177087

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 43497 cttcttcctcttcttcttcctcttcctc 43470



to top

>emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chromosome X, complete
             sequence
          Length = 193219

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 59486 cttcttcctcttcttcttcctcttcctc 59459



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 59348 cttcttcctcttcttcttcctcttc 59324



to top

>emb|AL807815.3| Mouse DNA sequence from clone RP23-207H16 on chromosome 4, complete
              sequence
          Length = 206914

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 204923 cttcttcctcttcttcttcctcttcctc 204950



to top

>emb|AL807773.7| Mouse DNA sequence from clone RP23-228L24 on chromosome X, complete
              sequence
          Length = 186645

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              |||| |||||||||||||||||||||||
Sbjct: 116117 cttcctcctctccttcttcctcttcctc 116144



to top

>emb|AL772214.3| Mouse DNA sequence from clone RP23-370C18 on chromosome 2, complete
             sequence
          Length = 181349

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 65615 cttcttcctcttcttcttcctcttcctc 65588



to top

>emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chromosome 11, complete
             sequence
          Length = 205030

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 25419 cttcttcctcttcttcttcctcttcctc 25392



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 25335 cttcttcctcttcttcttcctcttc 25311



to top

>emb|AL671975.12| Mouse DNA sequence from clone RP23-25O15 on chromosome X, complete
             sequence
          Length = 231530

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 56565 cttcttcctcttcttcttcctcttcctc 56592



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 56532 cttcttcctcttcttcttcctcttc 56556



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 56553 cttcttcctcttcttcttcctcttc 56577



to top

>emb|AL163195.5|CNS01RIH Human chromosome 14 DNA sequence BAC R-14J7 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 162209

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 112015 cttcttcctcttcttcttcctcttcctc 111988



to top

>emb|AL034384.1|HSMTM0 Human chromosome Xq28, cosmid clones 7H3, 14D7, C1230, 11E7, F1096,
              A12197, 12G8, A09100; complete sequence bases 1..217657
          Length = 217657

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 616    cttcttcctctccttcttcctcttcctc 643
              ||||||||||| ||||||||||||||||
Sbjct: 113749 cttcttcctcttcttcttcctcttcctc 113722



to top

>dbj|D38256.1|YSCSCT1 Yeast gene for suppressor of ctr mutation
          Length = 3262

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 616  cttcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||||
Sbjct: 2861 cttcttcctcttcttcttcctcttcctc 2834



to top

>gb|AC114494.2| Homo sapiens chromosome 1 clone RP11-439L8, complete sequence
          Length = 146301

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||| ||||||||||||||||||||
Sbjct: 83565 cttcttcttctccttcttcctcttcctc 83538



to top

>emb|AL833802.4| Mouse DNA sequence from clone RP23-17A4 on chromosome 4, complete
           sequence
          Length = 8077

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 616 cttcttcctctccttcttcctcttcctc 643
           ||||||||||| ||||||||||||||||
Sbjct: 9   cttcttcctcttcttcttcctcttcctc 36



to top

>emb|AL645824.12| Mouse DNA sequence from clone RP23-200O20 on chromosome 4, complete
             sequence
          Length = 145443

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 22415 cttcttcctcttcttcttcctcttcctc 22388



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 22427 cttcttcctcttcttcttcctcttc 22403



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 22439 cttcttcctcttcttcttcctcttc 22415



to top

>emb|AL670319.4| Mouse DNA sequence from clone RP23-315E18 on chromosome 4, complete
             sequence
          Length = 40107

 Score = 48.1 bits (24), Expect = 0.058
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 616   cttcttcctctccttcttcctcttcctc 643
             ||||||||||| ||||||||||||||||
Sbjct: 11146 cttcttcctcttcttcttcctcttcctc 11173



to top

>ref|XR_026834.1| PREDICTED: Gallus gallus similar to retinoblastoma protein-binding
            zinc finger protein (LOC419478), mRNA
          Length = 6066

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 618  tcttcctctccttcttcctcttcctca 644
            ||||||||| |||||||||||||||||
Sbjct: 3256 tcttcctcttcttcttcctcttcctca 3282



to top

>ref|NM_001074487.1| Oryza sativa (japonica cultivar-group) Os11g0508600 (Os11g0508600)
           mRNA, complete cds
          Length = 1492

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 352 cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394
           |||||| ||||||||||||||||   ||| |||||||||||||
Sbjct: 471 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 513



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
           ||||||||||||| |||||| ||||  |||||||||| ||||
Sbjct: 709 aagagcgtggagttcatgccgttctcgctctccttctccctc 750



to top

>gb|AC189568.1| Brassica rapa subsp. pekinensis clone KBrH009I04, complete sequence
          Length = 162363

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 618    tcttcctctccttcttcctcttcctcaacgg 648
              ||||||||| ||||||| |||||||||||||
Sbjct: 108659 tcttcctcttcttcttcttcttcctcaacgg 108689



to top

>gb|AC189201.1| Brassica rapa subsp. pekinensis clone KBrB005N03, complete sequence
          Length = 166828

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 621   tcctctccttcttcctcttcctc 643
             |||||||||||||||||||||||
Sbjct: 46286 tcctctccttcttcctcttcctc 46308



to top

>gb|DQ537336.1| Triticum aestivum clones BAC 1289J04; BAC 1001P20, complete sequence
          Length = 206063

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 617    ttcttcctctccttcttcctcttcctc 643
              |||||||||| ||||||||||||||||
Sbjct: 117662 ttcttcctcttcttcttcctcttcctc 117688



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 616    cttcttcctctccttcttcctcttc 640
              ||||||| |||||||||||||||||
Sbjct: 119066 cttcttcttctccttcttcctcttc 119090



to top

>gb|BT025997.1| Arabidopsis thaliana At1g24120 mRNA, complete cds
          Length = 1311

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 617  ttcttcctctccttcttcctcttcctc 643
            |||||||||| ||||||||||||||||
Sbjct: 1197 ttcttcctcttcttcttcctcttcctc 1171



to top

>ref|NM_102258.3| Arabidopsis thaliana ARL1; heat shock protein binding / unfolded
            protein binding (ARL1) mRNA, complete cds
          Length = 1699

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 617  ttcttcctctccttcttcctcttcctc 643
            |||||||||| ||||||||||||||||
Sbjct: 1445 ttcttcctcttcttcttcctcttcctc 1419



to top

>ref|XM_632536.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0187101)
            mRNA, complete cds
          Length = 3414

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 616  cttcttcctctccttcttcctcttcctcaac 646
            ||||||||||| ||||||||||||| |||||
Sbjct: 1294 cttcttcctcttcttcttcctcttcttcaac 1264



to top

>ref|XM_642384.1| Dictyostelium discoideum AX4 putative non-transporter ABC protein
           (abcF4) mRNA, complete cds
          Length = 3429

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 616 cttcttcctctccttcttcctcttcctcaac 646
           ||||||||||| ||||||||||||| |||||
Sbjct: 721 cttcttcctcttcttcttcctcttcttcaac 691



to top

>gb|AC119870.17| Mus musculus chromosome 3, clone RP24-261K17, complete sequence
          Length = 144502

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 621   tcctctccttcttcctcttcctc 643
             |||||||||||||||||||||||
Sbjct: 59872 tcctctccttcttcctcttcctc 59894



to top

>gb|AC137759.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0008H02, complete sequence
          Length = 143438

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                        
Query: 352   cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394
             |||||| ||||||||||||||||   ||| |||||||||||||
Sbjct: 82412 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 82370



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 596   aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
             ||||||||||||| |||||| ||||  |||||||||| ||||
Sbjct: 82075 aagagcgtggagttcatgccgttctcgctctccttctccctc 82034



to top

>gb|AC140389.3| Mus musculus BAC clone RP24-202H2 from chromosome 18, complete sequence
          Length = 169195

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 616    cttcttcctctccttcttcctcttcct 642
              ||||||||||| |||||||||||||||
Sbjct: 107605 cttcttcctcttcttcttcctcttcct 107631



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 616    cttcttcctctccttcttcctcttcct 642
              ||||||||||| |||||||||||||||
Sbjct: 107668 cttcttcctcttcttcttcctcttcct 107694



to top

>gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, complete sequence
          Length = 171023

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 617   ttcttcctctccttcttcctcttcctc 643
             |||||||||| ||||||||||||||||
Sbjct: 30964 ttcttcctcttcttcttcctcttcctc 30990



to top

>gb|AC157944.2| Mus musculus BAC clone RP23-456N8 from chromosome 15, complete sequence
          Length = 179092

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 614   cccttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||||
Sbjct: 60634 cccttcttcctttccttcttcctcttc 60660



to top

>gb|AC153594.15| Mus musculus 10 BAC RP23-98N14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 208555

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 618    tcttcctctccttcttcctcttc 640
              |||||||||||||||||||||||
Sbjct: 172088 tcttcctctccttcttcctcttc 172066



to top

>gb|AC090437.62| Mus musculus strain C57BL/6J clone rp23-11f20 map 6, complete sequence
          Length = 227127

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 614    cccttcttcctctccttcttcctcttc 640
              ||||||||||||| |||||||||||||
Sbjct: 170719 cccttcttcctcttcttcttcctcttc 170693



to top

>gb|AC124978.19| Mus musculus chromosome 5, clone RP24-107D19, complete sequence
          Length = 182405

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 616   cttcttcctctccttcttcctcttcct 642
             ||||||| |||||||||||||||||||
Sbjct: 40875 cttcttcttctccttcttcctcttcct 40849



to top

>gb|AC113476.20| Mus musculus chromosome 17, clone RP23-304J1, complete sequence
          Length = 227026

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 621   tcctctccttcttcctcttcctc 643
             |||||||||||||||||||||||
Sbjct: 76917 tcctctccttcttcctcttcctc 76939



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 615   ccttcttcctctccttcttcctcttcctc 643
             |||||||||||| | ||||||||||||||
Sbjct: 76923 ccttcttcctcttcctcttcctcttcctc 76951



to top

>gb|AC132349.3| Mus musculus BAC clone RP24-82B7 from chromosome 16, complete sequence
          Length = 216783

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 617   ttcttcctctccttcttcctcttcctc 643
             |||||||||| ||||||||||||||||
Sbjct: 51377 ttcttcctcttcttcttcctcttcctc 51351



to top

>gb|AC123803.4| Mus musculus BAC clone RP24-492I15 from chromosome 10, complete sequence
          Length = 169964

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 617    ttcttcctctccttcttcctcttcctc 643
              |||||||||| ||||||||||||||||
Sbjct: 102760 ttcttcctcttcttcttcctcttcctc 102734



 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 614    cccttcttcctctccttcttcctcttc 640
              ||||||||||||| |||||||||||||
Sbjct: 102790 cccttcttcctcttcttcttcctcttc 102764



to top

>gb|AC132427.4| Mus musculus BAC clone RP23-326N11 from chromosome 18, complete sequence
          Length = 192806

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 616    cttcttcctctccttcttcctcttcct 642
              |||||||||||||||||| ||||||||
Sbjct: 154912 cttcttcctctccttctttctcttcct 154886



to top

>gb|AC122911.4| Mus musculus BAC clone RP23-60K16 from 8, complete sequence
          Length = 150400

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 617    ttcttcctctccttcttcctcttcctc 643
              |||||||||| ||||||||||||||||
Sbjct: 126727 ttcttcctcttcttcttcctcttcctc 126701



to top

>gb|AC115356.5| Mus musculus BAC clone RP23-47E9 from 15, complete sequence
          Length = 212177

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 614    cccttcttcctctccttcttcctcttc 640
              ||||||||||| |||||||||||||||
Sbjct: 187112 cccttcttcctttccttcttcctcttc 187138



to top

>gb|AY226825.1| Arabidopsis thaliana ARG1-like protein 1 (ARL1) mRNA, complete cds
          Length = 1626

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 617  ttcttcctctccttcttcctcttcctc 643
            |||||||||| ||||||||||||||||
Sbjct: 1445 ttcttcctcttcttcttcctcttcctc 1419



to top

>gb|AC090647.6| Genomic sequence for Mus musculus, clone RP23-252I12, complete sequence
          Length = 139891

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 614   cccttcttcctctccttcttcct 636
             |||||||||||||||||||||||
Sbjct: 45111 cccttcttcctctccttcttcct 45089



to top

>emb|BX571713.11| Zebrafish DNA sequence from clone DKEY-19H21 in linkage group 9,
             complete sequence
          Length = 103882

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 617   ttcttcctctccttcttcctcttcctc 643
             ||||||||| |||||||||||||||||
Sbjct: 29495 ttcttcctcgccttcttcctcttcctc 29469



to top

>gb|AF479256.1| Dictyostelium discoideum non-transporter ABC protein AbcF4 (abcF4)
            gene, complete cds; and unknown gene
          Length = 5003

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 616  cttcttcctctccttcttcctcttcctcaac 646
            ||||||||||| ||||||||||||| |||||
Sbjct: 2003 cttcttcctcttcttcttcctcttcttcaac 1973



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                           
Query: 352      cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394
                |||||| ||||||||||||||||   ||| |||||||||||||
Sbjct: 17574601 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 17574559



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                          
Query: 596      aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
                ||||||||||||| |||||| ||||  |||||||||| ||||
Sbjct: 17574264 aagagcgtggagttcatgccgttctcgctctccttctccctc 17574223



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 77       cacctcttcttcctcctcgtc 97
                |||||||||||||||||||||
Sbjct: 17873877 cacctcttcttcctcctcgtc 17873897



to top

>gb|AY074564.1| Arabidopsis thaliana At1g24120/F3I6_4 mRNA, complete cds
          Length = 1695

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 617  ttcttcctctccttcttcctcttcctc 643
            |||||||||| ||||||||||||||||
Sbjct: 1440 ttcttcctcttcttcttcctcttcctc 1414



to top

>emb|AL451132.9| Human DNA sequence from clone RP11-7N10 on chromosome 9 Contains a
             pseudogene similar to part of serine/threonine kinase 33
             (STK33), complete sequence
          Length = 69362

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 614   cccttcttcctctccttcttcctcttc 640
             ||||||||||||| |||||||||||||
Sbjct: 55240 cccttcttcctcttcttcttcctcttc 55214



to top

>emb|AL049537.48|HS1164I10 Human DNA sequence from clone RP5-1164I10 on chromosome 20q13.13-13.2
            Contains part of the BIG2 gene for brefeldin A-inhibited
            guanine nucleotide-exchange protein 2, ESTs, STSs, GSSs
            and two CpG islands, complete sequence
          Length = 110028

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 617  ttcttcctctccttcttcctcttcctc 643
            |||||||||| ||||||||||||||||
Sbjct: 2132 ttcttcctcttcttcttcctcttcctc 2106



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 618  tcttcctctccttcttcctcttcctc 643
            ||||||||| ||||||||||||||||
Sbjct: 1910 tcttcctcttcttcttcctcttcctc 1885



to top

>gb|AC153557.8| Mus musculus 10 BAC RP23-203H20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 233640

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 616    cttcttcctctccttcttcctcttcct 642
              ||||||||||| |||||||||||||||
Sbjct: 183231 cttcttcctcttcttcttcctcttcct 183257



to top

>gb|AC157095.9| Mus musculus 6 BAC RP24-350P11 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 177800

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 618    tcttcctctccttcttcctcttc 640
              |||||||||||||||||||||||
Sbjct: 169925 tcttcctctccttcttcctcttc 169947



to top

>dbj|AK101913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033071H09, full
           insert sequence
          Length = 1494

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 352 cgtcatggagaccatctacatcgtgctcttcctcgtctacgcc 394
           |||||| ||||||||||||||||   ||| |||||||||||||
Sbjct: 472 cgtcatcgagaccatctacatcgccgtctacctcgtctacgcc 514



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 596 aagagcgtggagtacatgcccttcttcctctccttcttcctc 637
           ||||||||||||| |||||| ||||  |||||||||| ||||
Sbjct: 710 aagagcgtggagttcatgccgttctcgctctccttctccctc 751



to top

>dbj|AK113733.1| Ciona intestinalis cDNA, clone:ciad065h05, full insert sequence
          Length = 924

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 617 ttcttcctctccttcttcctcttcctc 643
           |||||||||| ||||||||||||||||
Sbjct: 908 ttcttcctcttcttcttcctcttcctc 882



to top

>gb|AC171017.3| Gallus gallus BAC clone CH261-1F11 from chromosome ul, complete sequence
          Length = 189284

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 616    cttcttcctctccttcttcctct 638
              |||||||||||||||||||||||
Sbjct: 165588 cttcttcctctccttcttcctct 165610



to top

>emb|CT009632.14| Mouse DNA sequence from clone RP23-5G10 on chromosome 16, complete
              sequence
          Length = 208600

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 616    cttcttcctctccttcttcctct 638
              |||||||||||||||||||||||
Sbjct: 196382 cttcttcctctccttcttcctct 196360



 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 615    ccttcttcctctccttcttcctcttc 640
              |||||||||||||||||||| |||||
Sbjct: 196371 ccttcttcctctccttcttcttcttc 196346



to top

>emb|AL732329.7| Mouse DNA sequence from clone RP23-118K22 on chromosome 2, complete
              sequence
          Length = 209002

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 616    cttcttcctctccttcttcctct 638
              |||||||||||||||||||||||
Sbjct: 183056 cttcttcctctccttcttcctct 183034



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 615    ccttcttcctctccttcttcctcttcctc 643
              |||||||| ||||||||||| ||||||||
Sbjct: 183075 ccttcttcttctccttcttcttcttcctc 183047



to top

>emb|AL589876.11| Mouse DNA sequence from clone RP23-117O11 on chromosome 2, complete
              sequence
          Length = 221782

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 614    cccttcttcctctccttcttcctcttc 640
              ||||||||||||| |||||||||||||
Sbjct: 110674 cccttcttcctcttcttcttcctcttc 110700



to top

>emb|AL590994.13| Mouse DNA sequence from clone RP23-382C19 on chromosome 11, complete
              sequence
          Length = 207814

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 617    ttcttcctctccttcttcctcttcctc 643
              |||||||||||||||||| ||||||||
Sbjct: 200721 ttcttcctctccttcttcttcttcctc 200747



to top

>gb|AC166328.4| Mus musculus BAC clone RP23-31H5 from chromosome 5, complete sequence
          Length = 215189

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 616    cttcttcctctccttcttcctcttcct 642
              ||||||| |||||||||||||||||||
Sbjct: 159131 cttcttcttctccttcttcctcttcct 159105



to top

>gb|AC002396.1| Arabidopsis thaliana chromosome I BAC F3I6 genomic sequence, complete
            sequence
          Length = 122358

 Score = 46.1 bits (23), Expect = 0.23
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 617  ttcttcctctccttcttcctcttcctc 643
            |||||||||| ||||||||||||||||
Sbjct: 8709 ttcttcctcttcttcttcctcttcctc 8735



to top

>gb|AC190152.2| Gallus gallus BAC clone CH261-171P12 from chromosome z, complete
            sequence
          Length = 287458

 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 618  tcttcctctccttcttcctcttcctc 643
            ||||||||||| ||||||||||||||
Sbjct: 2173 tcttcctctccctcttcctcttcctc 2198



to top

>gb|AY843356.1| Nandopsis managuensis voucher stri-178 cytochrome b gene, complete
            cds; mitochondrial
          Length = 1137

 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 619  cttcctctccttcttcctcttcctca 644
            |||||||| |||||||||||||||||
Sbjct: 1065 cttcctctacttcttcctcttcctca 1090



to top

>gb|AY843338.1| Nandopsis managuensis voucher stri-1128 cytochrome b gene, complete
            cds; mitochondrial
          Length = 1137

 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 619  cttcctctccttcttcctcttcctca 644
            |||||||| |||||||||||||||||
Sbjct: 1065 cttcctctacttcttcctcttcctca 1090



to top

>gb|AC188553.3| Pan troglodytes BAC clone CH251-326P23 from chromosome 7, complete
             sequence
          Length = 195466

 Score = 44.1 bits (22), Expect = 0.90
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 618   tcttcctctccttcttcctcttcctc 643
             ||||||||| ||||||||||||||||
Sbjct: 72273 tcttcctcttcttcttcctcttcctc 72248



 Score = 42.1 bits (21), Expect = 3.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 616   cttcttcctctccttcttcctcttc 640
             ||||||||||| |||||||||||||
Sbjct: 71951 cttcttcctcttcttcttcctcttc 71927


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 156,229,771
Number of extensions: 9049875
Number of successful extensions: 300916
Number of sequences better than 10.0: 1197
Number of HSP's gapped: 300822
Number of HSP's successfully gapped: 1571
Length of query: 947
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 924
Effective length of database: 18,503,978,556
Effective search space: 17097676185744
Effective search space used: 17097676185744
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top