ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf80g03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC161187.5| Mus musculus chromosome 5, clone RP23-297H22, com... 46 0.18
2gb|AC110251.11| Mus musculus chromosome 5, clone RP23-263O8, com... 46 0.18
3dbj|AK232936.1| Sus scrofa mRNA, clone:LVRM10052F08, expressed i... 44 0.69
4gb|AC159821.2| Mus musculus BAC clone RP23-152A3 from chromosome... 44 0.69
5gb|AC104111.2| Homo sapiens chromosome 5 clone RP11-176O14, comp... 44 0.69
6gb|AC142168.3| Mus musculus BAC clone RP24-80B23 from chromosome... 44 0.69
7ref|XM_001198584.1| PREDICTED: Strongylocentrotus purpuratus hyp... 42 2.7
8ref|XM_001203310.1| PREDICTED: Strongylocentrotus purpuratus hyp... 42 2.7
9gb|AY857619.1| Pectinaria gouldii ribosomal protein L13 mRNA, co... 42 2.7
10emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 42 2.7
11ref|XM_449076.1| Candida glabrata CBS138, CAGL0L06886g partial mRNA 42 2.7
12gb|AC172744.2| Medicago truncatula chromosome 2 BAC clone mth2-3... 42 2.7

>gb|AC161187.5| Mus musculus chromosome 5, clone RP23-297H22, complete sequence
          Length = 171367
 Score = 46.1 bits (23), Expect = 0.18
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 614    ggttggagttagagaaaagaagg 636
              |||||||||||||||||||||||
Sbjct: 132412 ggttggagttagagaaaagaagg 132390



to top

>gb|AC110251.11| Mus musculus chromosome 5, clone RP23-263O8, complete sequence
          Length = 197946

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 614   ggttggagttagagaaaagaagg 636
             |||||||||||||||||||||||
Sbjct: 74693 ggttggagttagagaaaagaagg 74671



to top

>dbj|AK232936.1| Sus scrofa mRNA, clone:LVRM10052F08, expressed in liver
          Length = 2526

 Score = 44.1 bits (22), Expect = 0.69
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 123  gatcaaccagcttctgcccaaaagagaaga 152
            |||||| |||||||| ||||||||||||||
Sbjct: 1530 gatcaatcagcttcttcccaaaagagaaga 1501



to top

>gb|AC159821.2| Mus musculus BAC clone RP23-152A3 from chromosome 9, complete sequence
          Length = 221672

 Score = 44.1 bits (22), Expect = 0.69
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 626    agaaaagaaggccaaggaaaga 647
              ||||||||||||||||||||||
Sbjct: 212181 agaaaagaaggccaaggaaaga 212160



to top

>gb|AC104111.2| Homo sapiens chromosome 5 clone RP11-176O14, complete sequence
          Length = 171234

 Score = 44.1 bits (22), Expect = 0.69
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 459    tccaaagaagctttggctaaagtcac 484
              |||||||||||||| |||||||||||
Sbjct: 108117 tccaaagaagcttttgctaaagtcac 108092



to top

>gb|AC142168.3| Mus musculus BAC clone RP24-80B23 from chromosome 9, complete sequence
          Length = 173152

 Score = 44.1 bits (22), Expect = 0.69
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 626    agaaaagaaggccaaggaaaga 647
              ||||||||||||||||||||||
Sbjct: 128504 agaaaagaaggccaaggaaaga 128483



to top

>ref|XM_001198584.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC762815 (LOC762815), partial mRNA
          Length = 1115

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 627 gaaaagaaggccaaggaaaga 647
           |||||||||||||||||||||
Sbjct: 929 gaaaagaaggccaaggaaaga 949



to top

>ref|XM_001203310.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC766982 (LOC766982), partial mRNA
          Length = 1115

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 627 gaaaagaaggccaaggaaaga 647
           |||||||||||||||||||||
Sbjct: 929 gaaaagaaggccaaggaaaga 949



to top

>gb|AY857619.1| Pectinaria gouldii ribosomal protein L13 mRNA, complete cds
          Length = 703

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 78  gctcactttcgcaaagactggcaaa 102
           |||||||||| ||||||||||||||
Sbjct: 72  gctcactttcacaaagactggcaaa 96



to top

>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence
          Length = 1440588

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 378    aacgtccaaagattaaagcaatacaagaccaagttggttctcttcccaagaaa 430
              |||||||||||||| ||| ||||| |  | |||||| || |||||||||||||
Sbjct: 775031 aacgtccaaagattgaaggaataccaatctaagttgattgtcttcccaagaaa 774979



to top

>ref|XM_449076.1| Candida glabrata CBS138, CAGL0L06886g partial mRNA
          Length = 629

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 378 aacgtccaaagattaaagcaatacaagaccaagttggttctcttcccaagaaa 430
           |||||||||||||| ||| ||||| |  | |||||| || |||||||||||||
Sbjct: 363 aacgtccaaagattgaaggaataccaatctaagttgattgtcttcccaagaaa 415



to top

>gb|AC172744.2| Medicago truncatula chromosome 2 BAC clone mth2-33p17, complete
             sequence
          Length = 116124

 Score = 42.1 bits (21), Expect = 2.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 689   tttgccaaataaatctcttcc 709
             |||||||||||||||||||||
Sbjct: 98912 tttgccaaataaatctcttcc 98932


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 140,881,770
Number of extensions: 8220625
Number of successful extensions: 190174
Number of sequences better than 10.0: 12
Number of HSP's gapped: 190174
Number of HSP's successfully gapped: 12
Length of query: 729
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 707
Effective length of database: 18,508,616,841
Effective search space: 13085592106587
Effective search space used: 13085592106587
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top